Nowoczesne systemy ekspresji genów

advertisement
Nowoczesne systemy ekspresji
genów
Ekspresja genów
w organizmach żywych
GEN - pojęcia podstawowe
promotor
sekwencja kodująca RNA
terminator
gen


Gen - odcinek DNA zawierający zakodowaną informację wystarczającą
do wytworzenia jednego rodzaju białka (definicja jest prawdziwa w
odniesieniu do większości genów komórki, ale istnieją też geny, które
kodują na przykład cząsteczki rRNA i tRNA)
Cistron - sekwencja kodująca RNA, której ekspresja prowadzi do
powstania pojedynczego łańcucha polipeptydowego
GEN - pojęcia podstawowe


Promotor
 Część genu, do której przyłączają się czynniki
transkrypcyjne i polimeraza RNA. Jest jedną z części
regulatorowych genu. Od przyłączenia polimerazy
RNA do promotora rozpoczyna się transkrypcja
Terminator
 Odcinek genu, na którym kończy się transkrypcja
GEN - pojęcia podstawowe
 Sekwencje
regulatorowe – części genu, które nie zawierają
informacji genetycznej, ale kierują jej odczytywaniem
 wzmacniacze ekspresji (Wz)
 wygaszacze ekspresji (Wy)
 inne - niezwiązane z działaniem czynników
transkrypcyjnych, np. sekwencje liderowe DNA
Ekspresja genów
Ekspresja genów może zachodzić z różną wydajnością w
zależności od środowiska i warunków
gen a
A
A
gen b
A
A
A
A
B
Ekspresja genów w organizmach
prokariotycznych i eukariotycznych
Prokariota
Eukariota
 Transkrypcja
 Transkrypcja



Transkrypcja jest połączona z
translacją
Geny transkrybowane są przez
jeden rodzaj polimerazy RNA
Pod kontrolą jednego
promotora może znajdować się
więcej niż jeden cistron – taką
jednostkę ekspresyjną
nazywamy operonem



Transkrypcja jest rozdzielona
od translacji
Geny są transkrybowane przez
trzy różne polimerazy RNA
Pod kontrolą jednego
promotora znajduje się jeden
cistron
Systemy ekspresji (nadekspresji)
genów
Nadekspresja białek - sens zastosowania
Eksperyment – badanie represora lac
 10 cząstek białka w jednej komórce

1 μmol cząsteczek potrzebny do badań biochemicznych

1 μmol = 6x1017 cząsteczek białka
Czyli do eksperymentu potrzeba 6x1016 komórek

1
litr hodowli E. coli w fazie stacjonarnej zawiera ~4x1011
komórek

Czyli (zakładając 100% wydajność procesu oczyszczania)
1 μmol represora lac
= 150000 litrów hodowli E. coli
Zastosowanie
 Badania
podstawowe:
 określenie struktury białek (NMR, krystalografia)

enzymologia
manipulacje genetyczne (mutageneza)
 badanie oddziaływań międzycząsteczkowych

 Zastosowania
terapeutyczne i komercyjne:
medycyna
 diagnostyka
 przemysł chemiczny
 przemysł spożywczy

Schemat postępowania
 Klonowanie
eukariotycznego cDNA lub genu
prokariotycznego
 (Przeklonowanie sekwencji do wektora ekspresyjnego)
 Przeniesienie konstruktu do komórek
gospodarza/komórek
 Charakterystyka produktu (białka):
 oczyszczanie
 testy enzymatyczne
Przygotowanie do eksperymentu

Wybór gospodarza
 systemy in vivo (przykłady)






Escherichia coli
Saccharomyces cerevisiae
Pichia pastoris
hodowla tkankowa komórek ssaczych
organizmy transgeniczne
wyspecjalizowane systemy in vitro
Przygotowanie do eksperymentu
 Wybór
wektora
 wydajność
 sposób oczyszczania
 modyfikacje potranslacyjne
 konieczność przeprowadzenia modyfikacji genu/cDNA
 koszt
 stopień trudności
http://www.biotechnantes.com/Conferences/Business%201/Jeudi/14h00/02%20Thiry.pdf#search=%22protein%20expression%20systems%20ppt%22
http://www.biotechnantes.com/Conferences/Business%201/Jeudi/14h00/02%20Thiry.pdf#search=%22protein%20expression%20systems%20ppt%22
Przygotowanie do eksperymentu
 wybór
protokołu klonowania/ekspresji
 rodzaj białka
 rozpuszczalność i stabilność białka
 miejsce produkcji białka (cytoplazma, pożywka)
 sposób oczyszczania białka
Etap I
– poszukiwanie informacji
Źródła informacji gdy sekwencja genu
jest znana
1.
―
―
Publikacje naukowe
zawierają informacje o systemach ekspresyjnych użytych do
ekspresji danego genu
powinny zawierać odnośnik do sekwencji genu w postaci
tzw. „Accession No.” dla wybranej bazy danych dostępnej w
internecie np. NCBI (www.ncbi.nih.gov)
Źródła informacji gdy sekwencja genu
jest znana
2.
―
―
Bazy sekwencji nukleotydowych
NCBI: National Centre for Biotechnology Information
(Rockville Pike, Bethesda)
Dostęp do sekwencji genów można uzyskiwać poprzez:
 podanie accession no. uzyskany z publikacji (Vonakis et al.
J. Biol. Chem. 272 (38), 24072-24080 (1997))
Accession No: AF000301
Jak zdobyć informacje o genie jeśli sekwencja
jego nie jest znana –
ale znana jest sekwencja białka lub jej fragmenty
Sekwencję białka mozna poznać dysponując jego
czystym preparatem dzięki ograniczonej
proteolizie i sekwencjonowaniu uzyskanych
peptydów
Jak zdobyć informacje o genie jeśli jego
sekwencja nie jest znana
W oparciu o sekwencje białka można zaprojektować
zdegenerowane startery, które użyjemy w reakcji PCR i
uzyskamy:
Który prążek wybrać do
sekwencjonowania???
Należy oprzeć się o
przybliżenie: 1 kD
białka – 333 par zasad
DNA i znaną masę
białka (w kD)
Jak zdobyć informacje o genie jeśli sekwencja jego nie
jest znana i nie jest znana sekwencja białka ale:
Znamy właściwości fizykochemiczne białka, przede
wszystkim jego Mw:



W przypadku Prokariota możemy stworzyć bibliotekę
DNA genomowego w celu uzyskania sekwencji
W przypadku Eukariota możemy stworzyć bibliotekę DNA
genomowego w celu uzyskania sekwencji
Jak zdobyć informacje o genie jeśli nie jest
znana jego sekwencja, ani sekwencja
kodowanego przez niego białka
Wykorzystując dane uzyskane z bibliotek cDNA
możemy uzyskać sekwencję genów interesujących nas
białek
Jak zdobyć informacje o genie, jeśli znamy
tylko jego źródło?
Istnieje możliwość zastosowania zasady genomiki
porównawczej:



Odnalezienie informacji o dostępności sekwencji
analogicznych genów z najbliższych „taksonomicznie”
krewnych
Porównanie sekwencji nukleotydowych wybranych
genów z organizmów pokrewnych do organizmu
źródłowego
Programy komputerowe
Gene doc
Programy komputerowe
VectorNTI (INVITROGEN)


Contig Express
AlignX
AlignX
MfAJ252337
McAY213657
MeAJ252330
rubrumAJ270808
Consensus
(1)
(1)
(1)
(1)
(1)
(1)
(255)
MfAJ252337(222)
McAY213657(245)
MeAJ252330(222)
rubrumAJ270808(219)
Consensus(255)
1
10
20
30
40
50
60
70
80
-------------------------------ATCATTAACGCGCAAGAGGTCGAAGTTGGCCCCCGAAGCTCTTCCGTCTCCCCCC
--------TCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAAGAGGTCGAAGTTGGCCCCCGAAGCTCTTCCGTCTCCCCCC
-------------------------------ATCATTAACGCGCAAGAGGTCGAAGTTGGCCCCCGAAGCTCTTCCGTCTCCCCCC
ACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCNGGCCG--GAGGCTGGCCCCCCACGAT---A----------TCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAAGAGGTCGAAGTTGGCCCCCGAAGCTCTTCCGTCTCCCCCC
255
260
270
280
290
300
310
320
CGCTCGCCGGAGGATTACTCTGGAAAACACACTCTTGAAAGAACATACCGTCTGAGCG---AGCAACGCAAAT
CGCTCGCCGGAGGATTACTCTGGAAAACACACTCTTGAAAGAACATACCGTCTGAGCG---AGCAACGCAAAT
CGCTCGCCGGAGGATTACTCTGGAAAACACACTCTTGAAAGAACATACCGTCTGAGCG---AGCAACGCAAAT
CGCCCGCCGGAGGACAGACACCAAGAAAAAATTCTCTGAAGAGCTGTCAGTCTGAGCGTTTAGCAAGCACAAT
CGCTCGCCGGAGGATTACTCTGGAAAACACACTCTTGAAAGAACATACCGTCTGAGCG
AGCAACGCAAAT
Download
Random flashcards
123

2 Cards oauth2_google_0a87d737-559d-4799-9194-d76e8d2e5390

bvbzbx

2 Cards oauth2_google_e1804830-50f6-410f-8885-745c7a100970

Motywacja w zzl

3 Cards ypy

66+6+6+

2 Cards basiek49

Prace Magisterskie

2 Cards Pisanie PRAC

Create flashcards