Konstruowanie wymaga* programowych

advertisement
Centrum Kształcenia Ustawicznego nr 2 w Lublinie
ul. Pogodna 52, 20-337 Lublin
tel./fax (81) 744 15 39
e-mail: [email protected]
www.cku2.pl
XXVI Liceum Ogólnokształcące dla Dorosłych – forma stacjonarna
SEMESTR PIERWSZY
Zagadnienia na egzamin ustny z biologii
1. Omów doświadczenie Avery’ego.
2. Przedstaw graficznie a następnie omów budowę DNA.
3. Omów budowę RNA oraz podaj funkcję jego poszczególnych rodzajów.
4. Omów budowę dowolnego nukleotydu DNA.
5. Porównaj budowę DNA i RNA.
6. Wyjaśnij pojęcia: genom, komórka diploidalna
7. Wyjaśnij pojęcia: kariotyp, komórka haploidalna.
8. Wytłumacz, na czym polega reguła komplementarności zasad azotowych.
9. Uwzględniając regułę komplementarności do podanego fragmentu dopisz komplementarne zasady.
ATACGTAGCAGTAGCACC
10. Omów zjawisko replikacji DNA. Wyjaśnij, dlaczego mówimy replikacja semikonserwatywna.
11. Wyjaśnij pojęcia: allel, homozygota, fenotyp.
12. Wyjaśnij pojęcia: gen, allel dominujący, genotyp.
13. Przedstaw graficznie i omów I prawo Mendla.
14. Przedstaw graficznie proces biosyntezy białka.
15. Omów proces transkrypcji.
16. Wyjaśnij na czym polega spicing.
17. Omów proces translacji.
18. Przedstaw cechy kodu genetycznego.
19. Korzystając z tabeli kodu genetycznego, podaj liczbę aminokwasów w zapisanej sekwencji.
AUCGCAUGAAUCGGUCACGUCGCCUUAUUCCGCGCUACGAAUCGUUA
20. Wyjaśnij, co to są mutacje oraz podaj przyczyny ich powstawania.
21. Na dowolnym przykładzie omów mutacje genowe.
22. Na dowolnym przykładzie omów mutacje strukturalne chromosomów.
23. Na dowolnym przykładzie omów chorobę powodowaną przez mutacje.
24. Wyjaśnij, co to jest biotechnologia, podaj przykłady procesów biotechnologicznych.
25. Istniejące odmiany kapusty nie przypominają swojego dziko żyjącego przodka. Zastanów się, która
odmiana powstała w wyniku selekcji opierającej się na rozwoju liści.
26. Istniejące odmiany kapusty nie przypominają swojego dziko żyjącego przodka. Zastanów się, która
odmiana powstała w wyniku selekcji opierającej się na rozwoju bulwiasto zgrubiałej łodygi.
27. Istniejące odmiany kapusty nie przypominają swojego dziko żyjącego przodka. Zastanów się, która
odmiana powstała w wyniku selekcji opierającej się na rozwoju kwiatostanu.
28. Wyjaśnij pojęcie bioreaktor, podaj ich przykłady.
29. Wymień dwa problemy, jakie stwarza wzrastająca liczba ludzi na świecie. Wyjaśnij, w jaki sposób
biotechnologia może pomóc rozwiązać te problemy.
30. Wyjaśnij, czym zajmuje się inżynieria genetyczna.
31. Wyjaśnij, jak powstaje zrekombinowane DNA.
32. Wyjaśnij pojęcia: transformacja, transdukcja.
33. Przedstaw w jaki sposób geny są wprowadzane do komórek.
34. Scharakteryzuj rodzaje dostępnych szczepionek.
35. Wyjaśnij, jakie znaczenie w leczeniu chorych na cukrzycę miało zastąpienie insuliny zwierzęcej
insuliną ludzką produkowana przez zmodyfikowane genetycznie bakterie.
36. Wyjaśnij określenie roślina genetycznie zmodyfikowana.
37. Wymień korzyści wynikające z uzyskiwania roślin genetycznie modyfikowanych.
38. Wyjaśnij określenie zwierzę transgeniczne.
39. Wymień przykłady dla których uzyskuje się zwierzęta transgeniczne.
Download
Random flashcards
ALICJA

4 Cards oauth2_google_3d22cb2e-d639-45de-a1f9-1584cfd7eea2

66+6+6+

2 Cards basiek49

Pomiary elektr

2 Cards m.duchnowski

Create flashcards