Biomedyczny przegląd naukowy. Tom 2

advertisement
Biomedyczny przegląd
naukowy. Tom 2
Biomedyczny przegląd
naukowy. Tom 2
Redakcja:
Beata Zdunek
Agata Pietraszek
Lublin 2016
Recenzenci:
















prof. dr hab. Marta Misiuk-Hojło
prof. dr hab. Małgorzata Sobieszczańska
dr hab. n. farm. inż. Monika Anna Olszewska, prof. nadzw. UM
dr hab. n. med. Barbara Mackiewicz
dr hab. n. med. Katarzyna Nowomiejska
dr hab. Anna Rymuszka
dr Agnieszka Kuźniar
dr Anna Pytlak
dr Ewa Rojczyk
dr Stanisław Adamiak
dr Michał Dzik
dr inż. Beata Świeczko-Żurek
dr inż. Jarosław Zubrzycki
dr n. o zdr. Mariola Janiszewska
dr n. med. Dorota Żołnierczuk-Kieliszek
dr n. med. Barbara Rajtar
Wszystkie opublikowane rozdziały otrzymały pozytywne recenzje.
Skład i łamanie:
Ilona Żuchowska
Projekt okładki:
Marcin Szklarczyk
© Copyright by Wydawnictwo Naukowe TYGIEL sp. z o. o.
ISBN 978-83-65598-09-7
Wydawca:
Wydawnictwo Naukowe TYGIEL sp. z o. o.
ul. Głowackiego 35/341, 20-060 Lublin
www.wydawnictwo-tygiel.pl
Spis treści
Żaneta Anna Mierzejewska
Analiza zjawiska biofilmu
– mechanizmy powstawania, wpływ na organizm i implanty ............................ 7
Alicja Janicka, Anna Cwynar, Blanka Ziomkowska, Joanna Sikora,
Emilia Siemińska
Antybiotykooporność – poważny problem dzisiejszej cywilizacji .................. 18
Joanna Woźniak, Natalia Dereń, Edyta Simińska
Mechanizmy wnikania koronawirusów do komórek gospodarza..................... 27
Maciej Gawroński, Arkadiusz Goede, Tomasz Wandtke
Wirusy onkolityczne jako potencjalna alternatywa
w leczeniu nowotworów złośliwych ................................................................... 35
Monika Dyńda
Wykorzystanie bakterii jako wektorów w terapii przeciwnowotworowej ...... 47
Anna Posmysz
Zastosowanie krwi pępowinowej w medycynie czyli o możliwościach
terapeutycznych komórek macierzystych pobranych z krwi pępowinowej ... 66
Małgorzata Waldowska, Wioleta Kowalska, Justyna Woś
Fenotypowe i funkcjonalne zróżnicowanie populacji komórek NKT .............. 77
Martyna Bednarczyk, Urszula Mazurek, Małgorzata Muc-Wierzgoń
Profil ekspresji genów zaangażowanych w autofagię w różnicowaniu
komórek raka jelita grubego ................................................................................ 94
Dominika Lach
Terapie przeciwzapalne – nowy cel
w leczeniu ostrych zespołów wieńcowych ....................................................... 112
Karolina Kątska, Jan Ostrowski, Ewa Kosior-Jarecka
Zaburzenia ze strony narządu wzroku w przebiegu oponiaków ..................... 121
Anna Łabejszo, Tomasz Wandtke, Maciej Gawroński
Alergiczne zapalenie pęcherzyków płucnych
– immunopatogeneza i leczenie......................................................................... 131
Adrian Dubicki
Metody leczenia deformacji czaszki u dzieci. Rodzaje kasków
korekcyjnych oraz metody ich wykonywania ................................................. 141
Adrian Dubicki, Żaneta Anna Mierzejewska
Ocena deformacji i metody pomiaru czaszki u dzieci .................................... 161
Alicja Janicka, Anna Cwynar, Blanka Ziomkowska, Tomasz Wybranowski
Fluorescencyjna spektroskopia czasowo-rozdzielcza.
Proste narzędzie diagnostyczne ......................................................................... 179
Alicja Janicka, Anna Cwynar, Blanka Ziomkowska, Joanna Sikora
Fotoluminescencja – proste narzędzie analizy wpływu pH
na aktywność przeciwnowotworową pochodnych kamptotecyny .................. 192
Arkadiusz Goede, Maciej Gawroński, Tomasz Wandtke
Technika DNA origami – potencjalne zastosowania ....................................... 204
Małgorzata Sieradzka, Joanna Kołodziejczyk-Czepas, Paweł Nowak
Nowe kierunki w badaniach biomedycznych kwasów
hydroksycynamonowych ................................................................................... 223
Aleksandra Kruk, Agnieszka Gadomska-Gajadhur, Paweł Ruśkowski
Wpływ prekursorów porów na morfologię membran półprzepuszczalnych
przeznaczonych do hodowli komórkowych ..................................................... 254
Bartosz Sikora, Aleksandra Skubis, Małgorzata Kimsa
Ekspresja markerów molekularnych ABCG2 oraz P63 w świńskich
epitelialnych komórkach macierzystych rąbka rogówki ................................. 265
Magdalena Antonowicz, Anita Kajzer, Magdalena Grygiel-Pradelok
Dobór własności mechanicznych elementów stabilizatora zewnętrznego
do leczenia kurzej klatki piersiowej .................................................................. 277
Żaneta Anna Mierzejewska
Wieloaspektowa analiza problematyki związanej
z mechanizmami niszczenia implantów ........................................................... 293
Żaneta Anna Mierzejewska
Przyczyny mechanicznego niszczenia implantów
wytwarzanych tradycyjnymi technologiami..................................................... 308
Adrian Dubicki, Żaneta Anna Mierzejewska
Projekt indywidualnego implantu kości biodrowej.......................................... 325
Magdalena Grygiel-Pradelok, Janusz Szewczenko, Wojciech Kajzer,
Magdalena Antonowicz
Ocena wpływu biodegradowalnej warstwy polimerowej (PLGA)
na korozję podłoża ze stopów tytanu ................................................................ 344
Adrian Dubicki
Współcześnie stosowane metody przywrócenia utraconych
w wyniku schorzeń i uszkodzeń funkcji miednicy .......................................... 357
Indeks autorów ................................................................................................... 378
Żaneta Anna Mierzejewska1
Analiza zjawiska biofilmu
– mechanizmy powstawania,
wpływ na organizm i implanty
1. Wstęp/Wprowadzenie
Biofilm to złożona struktura biologiczna, wielokomórkowy twór złożony
z drobnoustrojów jednego lub wielu gatunków mikroorganizmów, otoczony
warstwą zewnątrzkomórkowych polisacharydów [1]. W jego skład wchodzić
mogą bakterie, grzyby, glony i pierwotniaki. Biofilm powstaje w wyniku
rozrastania się form drobnoustrojów, które przyjmują uporządkowaną,
skomplikowaną strukturę złożoną z mikrokoloni bakteryjnych [2].
Mikrokolonie poprzedzielane są siecią otwartych kanalików, w których
krążąca ciecz jest odpowiedzialna za dostarczanie tlenu, substancji
odżywczych oraz usuwanie zbędnych produktów przemiany materii. Dzięki
temu nawet głębiej położone warstwy komórek mają zapewnione warunki do
życia i rozwoju[1].
Biofilm wpływa na wiele aspektów naszego życia, dlatego takie ważne jest
jego dokładne poznanie. Mikroorganizmy wchodzące w jego skład
charakteryzują się inwazyjnością, przyczyniają się do rozwoju wielu infekcji,
powstaje również na implantach biomedycznych, prowadząc do rozwoju
różnego typu stanów zapalnych, również w warunkach szpitalnych. Są one
oporne na działanie wysokiej temperatury, środków dezynfekujących
i antyseptycznych, surfaktantów oraz antybiotyków [3].
Do biomateriałów szczególnie podatnych na formowanie się biofilmu
zalicza się: sztuczne serce, protezy stawów, soczewki kontaktowe, zastawki
serca, cewniki, szwy, protezy naczyń krwionośnych, spirale domaciczne,
rozrusznik serca oraz implanty metaliczne [4]. W przypadku tych ostatnich
biofilmu może powodować powstawanie szczególnie uciążliwych i niebezpiecznych stanów zapalnych, które zapoczątkowują procesy resorpcji tkanki
kostnej wokół implantu. Zmniejszenie stabilizacji wszczepu prowadzi do jego
obluzowania, uszkodzenia otaczającej go tkanki kostnej, a w konsekwencji
zniszczenia jej struktury i złamania kości lub implantu [4‚6].
1
[email protected], Katedra Inżynierii Materiałowej i Biomedycznej,
Wydział Mechaniczny, Politechnika Białostocka
7
Żaneta Anna Mierzejewska
2. Cel pracy
Ze względu na duży wpływ biofilmu na życia człowieka oraz jego
otoczenie, bardzo ważne jest dokładne poznanie mechanizmów
formowania się oraz funkcjonowania tej struktury. Dotychczas badania
były prowadzone przede wszystkim w zawiesinach komórkowych, które
zawierały pojedyncze komórki mikroorganizmów [2]. Niestety komórki
swobodnie żyjące zasadniczo różnią się od komórek tworzących biofilm. Z
tego powodu powinno się skupić na badaniu komórek w kontekście
biofilmu jako całości. W tym celu należy przede wszystkim ulepszyć
techniki pozyskiwania oraz pomiaru tej struktury. Obecnie stosowane
metody są niestety mało efektywne. Należy również rozwijać modele
systemowe, które można wykorzystać do analizy biofilmu. Powinny one
umożliwiać uzyskanie powtarzalnych oraz dokładnych wyników. Istotne
jest także poznanie czynników indukujących i wpływających na tworzenie
się biofilmu [6].
3. Budowa biofilmu
Powstawanie biofilmu jest procesem wielostopniowym, uwarunkowanym właściwościami tworzących go mikroorganizmów oraz budową
i właściwościami kolonizowanych materiałów lub organizmów (rys.1) [7].
Szczególną rolę w procesie adhezji odgrywają wytwarzane przez mikroorganizmy tworzące biofilm polimery zewnątrzkomórkowe, lipopolisacharydy i białka ich ściany komórkowej. Kolonizację ułatwia także
struktura powierzchni oraz wszelkie jej uszkodzenia i chropowatości [8].
Adhezja komórek mikroorganizmów jest procesem wieloetapowym [9].
Początkowo przemieszczanie się komórek w kierunku zasiedlanej powierzchni
regulują oddziaływania fizyczne związane z działaniem sił hydrodynamicznych, grawitacyjnych, termodynamicznych oraz sił van der Waalsa [10].
Dużą rolę w procesie kolonizacji powierzchni przez bakterie odgrywają
ich struktury zewnętrzne, takie jak fimbrie czy rzęski [11]. Ruchliwość
bakterii wynikająca natomiast z posiadania przez nie rzęsek sprawia, że
łatwiej docierają one do powierzchni, a następnie po jej osiągnięciu
wędrują w poszukiwaniu innych drobnoustrojów, dążąc do wytworzenia
nowej mikrokoloni lub powiększenia już istniejącej [12]. Adhezja ma
charakter nieodwracalny, dochodzi bowiem do wytworzenia specyficznych
wiązań między zasiedlaną powierzchnią a występującymi na powierzchni
komórkami [13].
Podstawową rolę w tym procesie odgrywają polimery zewnątrzkomórkowe (EPS) tworzące tzw. glikokaliks [12‚14], który umożliwia
adhezję komórek do takich powierzchni, jak tworzywa sztuczne czy metale
[15]. Adhezja nieodwracalna umożliwi wytworzenie mikrokoloni i dojrze-
8
Analiza zjawiska biofilmu – mechanizmy powstawania, wpływ na organizm i implanty
wanie biofilmu. Następuje namnażanie drobnoustrojów i ich stopniowe
różnicowanie. W ich komórkach dochodzi do aktywacji lub hamowania
ekspresji niektórych genów [16].
Bakterie bytujące we wnętrzu biofilmu narażone są na ograniczenie
dostępu tlenu, z tego też względu zmienia się ich metabolizm – wzrasta
aktywność beztlenowych szlaków metabolicznych, zahamowaniu ulega też
synteza niektórych enzymów oraz toksyn [17]. Dzięki tym zjawiskom
komórki bakterii wchodzące w skład biofilmu wykazują odmienne cechy
niż komórki żyjące w postaci wolnej [16]. Dojrzała forma biofilmu otoczona
jest grubą warstwą glikokaliksu, do którego adsorbowane są substancje
mineralne, związki organiczne i komórki innych drobnoustrojów [18].
W ostatnim etapie rozwoju biofilm osiąga tzw. krytyczną grubość
i stopniowo przestaje utrzymywać istniejącą formę. Następuje wówczas
migracja komórek z peryferyjnych części dojrzałego biofilmu do otoczenia
[18-19]. Przyczyną tego zjawiska może być wyczerpanie składników
pokarmowych lub problemy ich przepływu w obrębie biofilmu.
Rysunek 1. Etapy rozwoju biofilmu [20]
3.1. Cechy biofilmu
Charakterystyczne dla biofilmów jest to, iż występuje w nich mieszanina
stanów metabolicznych. Bakterie na obrzeżach wykazują przejawy życia
np. wzrost, natomiast komórki położone w głębszych warstwach znajdują się
w stanie anabiozy (są żywe, ale „uśpione”). W obrębie biofilmu występuje
zróżnicowane środowisko chemiczne oraz ograniczony dostęp do składników
odżywczych (odmienne stężenie tlenu w warstwach), co jest główną przyczyną
9
Żaneta Anna Mierzejewska
zmian w metabolizmie komórek bakteryjnych (rys.2). Ze względu na to
komórki genetycznie identyczne mogą zachowywać się i wyglądać zupełnie
inaczej [17].
Miejscowe warunki wpływają także na wytwarzanie przez bakterie wielu
toksyn i innych substancji wywołujących objawy choroby. Mechanizmy
obronne uruchamiane przez układ odpornościowy nie potrafią pokonać
biofilmu. Często nawet antybiotykom nie udaje się pokonać lepkiej substancji
polisacharydowej i przedostać się do ich wnętrza, co zapewniają im zmienne
warunki środowiska oraz zróżnicowanie gatunkowego komórek tworzących
biofilm. Przykładowo penicylina penetrująca Biofilm jest rozkładana przez
beta-laktamazy, degradujące antybiotyk szybciej niż jest on w stanie
przedostać się do głębszych warstw biofilmu [13].
Rysunek 2. Zróżnicowanie aktywności metabolicznych w obrębie biofilmu [21]
4. Biofilm a organizm ludzki
W chwili obecnej uważa się, że 60 do 80% zakażeń z którymi spotyka się
człowiek jest związane z tworzeniem biofilmów. Są to infekcje dotyczące np.
implantów z tworzyw sztucznych, ale także odpowiadają za skutki m.in.
zapaleniach ucha środkowego, zakażeniach dróg moczowych, zakażeniach
dróg oddechowych w przebiegu mukowiscydozy itp. [13]
Infekcje związane z biofilmem mają zwykle charakter przewlekły,
niejednokrotnie groźny dla życia, a bakterie tworzące biofilm są szczególnie
odporne na działanie antybiotyków, jak i na mechanizmy odpornościowe
człowieka [17]. Nośnikiem informacji są związki chemiczne, które – po
10
Analiza zjawiska biofilmu – mechanizmy powstawania, wpływ na organizm i implanty
przekroczeniu krytycznego stężenia – mogą powodować tworzenie się bądź
rozpraszanie biofilmu, wydzielanie czynników zjadliwości oraz synchronizować aktywność całego biofilmu w kierunku korzystnym dla drobnoustrojów [18].
4.1. Miejsca występowania biofilmu
Zakażenie organizmu ludzkiego prowadzi do wielu niebezpiecznych
komplikacji. Pomimo, iż protezy naczyniowe, zastawki serca czy protezy
ortopedyczne ulegają zakażeniu dość rzadko, to jednak pojawienie się
zakażenia może wymagać usunięcia protezy, amputacji kończyny lub
spowodować śmierć pacjenta [22].
Biofilm powstający na zanieczyszczonych plastikowych implantach
(np. zastawki serca) jest prawie niemożliwy do usunięcia przy pomocy
antybiotyków. Dodatkowo, tworzywo sztuczne zniechęca migrację neutrofilów i makrofagów, które zwykle stanowią ochronę przed bakteriami [22].
Może to prowadzić do powstania zapalenia wsierdzia i uwolnienia bakterii
do krwiobiegu, powodując miejscowe uszkodzenie serca. Bakterie
odpowiedzialne za takie zakażenia to w szczególności S. epidermidis, S.
aureus i Enterococcus sp. [23]Przylegają one do tworzywa, powodując
powstawanie w nim zagłębień i szczelin. W wyniku tego konieczne jest
chirurgiczne usunięcie implantu. Biofilm jest także przyczyną chorób
szpitalnych spowodowanych mikroflorą pacjenta lub personelu (powstają
w cewnikach i powodują kłopotliwe zakażenia, bardzo trudne do wyleczenia)[17‚19, 23]
Ponadto bakterie tworzące biofilmy skórne mogą dostać się przez rurki
i igły kroplówek do krwiobiegu i wywołać infekcje zagrażające życiu.
Podając substancje bezpośrednio do krwiobiegu, omija się naturalny
system niespecyficznej obrony skóry [24].
Producenci sprzętu medycznego zaczęli impregnować cewniki i rurki
środkami przeciwbakteryjnymi takimi jak srebro czy antybiotyki w nadziei,
że bakterie przestaną tworzyć błony biologiczne. Niestety, S. epidermidis
uodparnia się bardzo szybko na nowo stosowane antybiotyki [24‚26].
4.2. Zakażenia biomateriałów
Zastosowanie implantów znacznie wzrosło w ciągu ubiegłych 20 lat.
Szacuje się ze liczba wszczepów medycznych rośnie rocznie w granicach
od 7% – 15% [25]. Materiały używane na wszczepy medyczne nazywane
są biomateriałami i są one definiowane jako materiały używane do
konstrukcji urządzeń medycznych charakteryzujące się biozgodnością
(obojętność fizyczna i chemiczna w stosunku do otaczających tkanek),
biofunkcjonalnością (właściwości danego materiału zoptymalizowane pod
11
Żaneta Anna Mierzejewska
kątem funkcji jaką mają zastępować w organizmie) oraz stałością (niezmienność wymiarów i kształtu podczas sterylizacji) [26].
Stosowanie biomateriałów jest często związane z występowaniem
infekcji bakteryjnych (Tabela nr. 1). Szacuje się, że jest to 1%-2% dla
implantów ortopedycznych, natomiast dla cewników stosowanych do
odprowadzania moczu 100%, dlatego ich stosowanie powinno być
krótkotrwałe [27].
Takie infekcje mają bardzo poważne konsekwencje, w szczególności
przy głęboko położonych tkankach i implantach naczyniowych, gdzie
jedynym sposobem ratunku jest amputacja, a w wielu przypadkach
zakażenie jest przyczyną śmierci pacjenta. Jak wynika z tabeli wiele
rodzajów implantów wykazuje niski zakres infekcji, ale każda z nich wiąże
się z poważnymi skutkami, dlatego proces kolonizacji implantów przez
bakterie wymaga lepszego zrozumienia.
Wielkości opisujące ilość infekcji na implantach spowodowanych
występowaniem biofilmu podane są w tabeli poniżej:
Tabela 1 Procentowy zakres infekcji na różnych biomateriałach [25]
Materiał
Rodzaj implantu
Zakres
infekcji
[%]
7-10
Cewniki moczowe
Silikon, Poliuretan, Polietylen
Implanty
ortopedyczne
Tytan, Stal, Polietylen, Kobalt,
Chrom
1-4
Implanty piersi
Stenty
Silikon
Teflon, silikon, poliuretan, polietylen
5
1-5
Szkła
kontaktowe
Sztuczne
naczynia
krwionośne
Zastawki serca
PMMA
0.05-0.2
Fluoropolimery, Dacron, poliuretan
0.5-1
Tkanki naturalne, węgiel, stal
1-12
5. Profilaktyka zakażeń
Celem profilaktyki antybiotykowej w przypadku zabiegów wszczepienia materiału sztucznego jest zminimalizowanie ryzyka kontaminacji
bakteryjnej w okresie okołooperacyjnym i we wczesnym etapie gojenia
rany [28]. W tym celu stosowane są antybiotyki o szerokim spektrum
działania. Ich zastosowanie zmniejsza ryzyko śródoperacyjnej i wczesnej
12
Analiza zjawiska biofilmu – mechanizmy powstawania, wpływ na organizm i implanty
pooperacyjnej drogi infekcji [28, 29]. Profilaktyka antybiotykowa w chirurgii
kostnej stosowana jest zarówno w przypadku zabiegów przeprowadzanych
w trybie planowym jak i tych, które z racji zaistniałych okoliczności muszą
być przeprowadzone w trybie dyżurowym.
Zgodnie z zaleceniami The Sanford Guide of Antimicrobial Therapy
z 2010 roku [30], profilaktyka antybiotykowa w przypadku wszczepienia
endoprotezy stawu powinna zostać wdrożona nie mniej niż 30 minut przed
zabiegiem operacyjnym. Dodatkową profilaktykę stosuje się u pacjentów
ze stwierdzonym nosicielstwem szczepów MRSA (methicillin-resistant
Staphylococcus aureus) lub na oddziałach ze stwierdzonym wzmożonym
ryzykiem wystąpienia zakażeń szpitalnych.
W przypadku wszczepienia implantu dentystycznego zagadnienie
celowości stosowania profilaktyki antybiotykowej było przedmiotem
dyskusji wśród wielu badaczy [29]. Zabiegi implantologiczne zostały
zakwalifikowane jako zabiegi czyste skażone, wśród których ryzyko
zakażenia miejsca operowanego jest oceniane na mniej niż 10% [31]. Przed
wykonaniem zabiegu obowiązuje przeprowadzenie pełnej sanacji jamy
ustnej, czyli eliminację wszelkich ognisk infekcji [1, 8].
Osobnym zagadnieniem jest profilaktyka antybakteryjna zakażeń
w traumatologii narządu ruchu. Uważa się, że o profilaktyce można mówić
wówczas, gdy wdrożenie leku nastąpiło do 6 h od urazu, gdy rana nie jest
zakażona [32, 33]. W badaniach in vitro zaobserwowano, że obecność
antybiotyku może zmniejszać adhezję komórek bakteryjnych do powierzchni implantu i tym samym opóźnić proces formowania biofilmu
bakteryjnego [30‚32].
5.1. Przykłady biofilmów na powierzchniach wyrobów
medycznych
Biofilmy mogą powstawać w wielu miejscach, gdzie może dojść do
poważnych infekcji. Poniżej zostały przedstawione trzy przykłady miejsc
występowania biofilmów i ich wpływ na zdrowie człowieka (rys.3) [8].
Stosowanie cewników wiąże się z niebezpieczeństwem zakażeń
pochodzenia cewnikowego. W następstwie złożonych procesów na
powierzchni cewnika powstaje biofilm, którego istotnym elementem są
drobnoustroje. Najczęściej są to gronkowce charakteryzujące się bardzo
wysoką opornością w stosunku do większości antybiotyków [11].
Zakażenia mogą rozwijać się lokalnie- w miejscu wprowadzenia
cewnika lub też rozprzestrzeniać się drogą krwi; z użyciem cewników
wiąże się występowanie septycznego zakrzepowego zapalenia żył,
zapalenia wsierdzia, ropnia płuca, ropnia mózgu oraz zapalenia szpiku
kostnego i gałki ocznej [21].
13
Żaneta Anna Mierzejewska
W protezach żółciowych powikłania obejmują najczęściej niedrożność
protezy plastikowej w skutek powstania bakteryjnego biofilmu, tworzącego
się na wewnętrznej powierzchni. Następstwem jest zapalenie dróg
żółciowych i żółtaczka. Przypuszcza się ze adherencja protein i bakterii do
wewnętrznej ściany protezy tworząca biofilm inicjuje jej zablokowanie.
Bakterie dostają się do światła dróg żółciowych najprawdopodobniej już
podczas wkładania protezy, a także refluksu treści dwunastniczej do dróg
żółciowych już po jej założeniu. Powoduje to przylegnie kolejnych kolonii
bakteryjnych wraz z kryształkami cholesterolu, tworząc szkielet włókien
będący przyczyna powolnego zamykania światła protezy [11‚15].
a)
b)
c)
d)
Rysunek 3. Biofilm na a) protezie żółciowej [34], b) panewce implantu stawu biodrowego [35],
c) szkliwie [36], d) implancie piersi [37]
6. Podsumowanie
Obecnie nie istnieje jeden sprawdzony protokół postępowania
diagnostycznego w przypadku zakażeń wynikających z obecności biofilmu.
We wszystkich przypadkach o ostatecznym rozpoznaniu decyduje wystąpienie
charakterystycznych objawów klinicznych wraz z odpowiednimi wynikami
analiz laboratoryjnych krwi, badań mikrobiologicznych, histopatologicznych
oraz diagnostyki obrazowej [2, 33]. Leczenie zakażeń jest trudne, długotrwałe
14
Analiza zjawiska biofilmu – mechanizmy powstawania, wpływ na organizm i implanty
i często kończy się niepowodzeniem w wyniku, którego implant należy usunąć
i zastosować inny algorytm postępowania leczniczego. Występowanie zakażeń
znacznie wydłuża okres hospitalizacji chorego, generuje koszty, przyczynia się
do obniżenia jakości jego życia a często nawet i śmierci pacjenta [38].
Praca zrealizowana przy wsparciu finansowym Wydziału Mechanicznego
Politechniki Białostockiej w ramach projektu „Rozwój młodych naukowców
i uczestników studiów doktoranckich‖ nr MB/WM/14/2014.
Literatura
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
Paduch D., Niedzielski J., Materiały biomedyczne. Część I: Pojęcie filmu
biologicznego (biofilmu) i fizykochemiczne podstawy przyczepności substancji
organicznych do biomateriałów, Chirurgia Polska, (2005)
Sałek A., Powstawanie biofilmu w warunkach przemysłowych. Cz.1.
Mechanizm formowania biofilmu i jego struktura, Przemysł Fermentacyjny
i Owocowo-Warzywny, 6 (2008)
Bartoszewicz M., Rygiel A., Biofilm jako podstawowy mechanizm zakażenia
miejsca operowanego, Chirurgia Polska, (2006)
Donlan R. M., Biofi lms: Microbial life on surfaces, Emerging Infectious
Disease, vol. 8 (2002), s. 136-151
Monds R. D., O´tool G. A., The developmental model of microbial biofi lms:
Ten years of a paradigm up for review, Trends Microbiol, 17 (2009), s. 73-87
Chmiel A., Biotechnologia podstawy mikrobiologiczne i biochemiczne, PWN
(1991)
Libudzisz Z., Kowal K., Żakowska Z., Mikrobiologia techniczna, tom I,
Mikroorganizmy i środowiska ich występowania, PWN (2001)
Czaczyk K., Wojciechowska K., Tworzenie biofilmów bakteryjnych – istota
zjawiska i mechanizmy oddziaływań, Biotechnologia, 3,62 (2003), s. 180-192
Marshall K. C., Adsorption and adhesion process in microbial growth at
interfaces, Advances in Colloid Interface Science, vol. 25, 1(1986), s. 59-86
Czaczyk K., Czynniki warunkujące adhezję drobnoustrojów do powierzchni
abiotycznych, Postępy Mikrobiologii, vol. 43, 3(2004), s. 267-283
Rijnaarts H. M., Norde W., Bouwer E. J., Lyklema J., Zehnder J. B., Bacterial
adhesion under static and dynamic conditions, Applied and Environmental
Microbiology, vol. 59 (1993), s. 3255-3265
Thi T. T. Le, Prigent-Combaret C., Dorel C., Lejeune P., First stages of biofi
lm formation: characterization and quantifi cation of bacterial functions involved
in colonization process, Methods in Enzymology, vol. 336(2001), s. 152-159
Percival S. L., Malic S., Cruz H., Williams D. W., Introduction to biofi lms,
Biofi lms and Veterinary Medicine, vol. 6 (2011), s. 41-68
Pitts B., Fluorescence Microscopy to Assess Microbial Activity and
Antimicrobial Performance in Biofilms, Biotechnologia, 3(2003), s. 180-192
Flemming H. C., Wingender J., Relevance of microbial extracellular
polymeric substances (EPSs) – Part I: Structural and ecological aspects,
Water Science and Technology, vol. 43(2001), s. 1-8
15
Żaneta Anna Mierzejewska
16. Costerton J. W., Lewandowski Z., DeBeer D., Caldwell D. E.,. Korber D. R,
James G., Biofilms, the customized microniche, Journal of Bacteriology, vol.
176 (1994), s. 2137-2142
17. Costerton J. W., Lewandowski Z., Caldwell D. E., Korber D. R., Lappin-Scott
H. M., Microbial biofilms, Annual Review of Microbiology, vol. 49 (1995),
s. 711-745
18. Chandra J., Zhou G., Channoum M. A., Fungal biofi lms and actimycotics,
Current Drug Targets, 8(2005), s. 887-894
19. Liu Y., Tay J. H., Detachment forces and their infl uence on the structure
and metabolic behavior of biofilms, Journal of Microbiology
and Biotechnology, vol. 17(2001), s. 111-117
20. https://pl.wikipedia.org/wiki/Biofilm [12.10.2015]
21. http://bioinfo.mol.edu.pl/articles/Buchala05 [12.10.2015]
22. Pokrowiecki R., Tyski S., Zaleska M., Problematyka Zakażeń
Okołowszczepowych, POST. MIKROBIOL., 53, 2 (2014), s. 123-134
23. Amarasinghe J. J., Scannapieco F. A., Haase E. M., Transcriptional
and translational analysis of biofilm determinants of Aggregatibacter
actinomycetemcomitans in response to environmental perturbation, Infect.
Immun. 77(2009), s. 2896-2907
24. Arciola C. R., Campoccia D., Gamberini S., Baldassarri L., Montanaro L.,
Prevalence of cna, fnbB adhesins genes among Staphylococcus aureus isolates
from orthopedic infections asossciated to different types of implants, FEMS
Microbiol. Lett. 246 (2005), s. 81-86
25. Lebeaux, D., Chauhan, A., Rendueles, O., Beloin, C., From in vitro to in vivo
Models of Bacterial Biofilm-Related Infections, Pathogens, 2 (2013), s. 288356
26. Barei D. P., Nork S. E., Mills W. J., Henley M. B., Benirschke S. K.
Complications associated with internal fixation of high-energy bicondylar
tibial plateau fractures utilizing a two-incision technique, J. Orthop. Trauma,
18 (2004), s. 649-657
27. Trends in Microbiology, vol. 17, 2 (2009), s. 73-87
28. Resnik R. R, Misch C. E., Biofilms in dentistry, (w) Contemporary Implant
Dentistry, red. Misch C.E., Abbas H.A. (2008), s. 495
29. Esposito M., Grusovin M. G., Loli V., Coulthard P., Worthington H. V., Does
antibiotic prophylaxis at implant placement decrease early implant failures?
A Cochrane systematic review, Eur. J. Oral. Implantol. 3(2010), s. 101-110
30. Gilbert D. N., Moellering R. C., Eliopoulos G. M., Chambers H. F., Saag M.
S., The Sanford Guide to Antimicrobial Therapy 2010, 40th ed. Sperryville,
VA: Antimicrobial Therapy (2010)
31. Resnik R. R, Misch C. E., Pharmacology in Implant Dentistry, (w)
Contemporary Implant Dentistry, red. Misch C. E., Abbas H. A. (2008), s. 468
32. Trampuz A., Zimmerli W., Antimicrobial agents in orthopaedic surgery,
Drugs, 66 (2006), s. 1089-1105
33. Trampuz A., Zimmerli W., Diagnosis and treatment of infections associated
with fracture-fixation devices, Injury, Int.J. Care Injured. 37, (2006), s. 59-66
34. http://polimery.am.wroc.pl/2006/301.pdf [12.10.2015]
16
Analiza zjawiska biofilmu – mechanizmy powstawania, wpływ na organizm i implanty
35. http://ec.europa.eu/research/health/infectious-diseases/antimicrobial-drug
resistance/projects/087_en.html [12.10.2015]
36. http://www.iab.kit.edu/microbio/489.php [12.10.2015]
37. http://www.talroudnerplasticsurgery.com/breast-plastic-surgery/breastimplant-failure-due-to-capsular-contracture-caused-by-biofilm/ [12.10.2015]
38. Fang G., Keks T. F., Getry L. O., Harris A. A., Rivera N., Gett K., Fuchs P.
C., Gustafson M., Wong E. S., Goetz A., Wagner M. M., Yu V. L., Prosthetic
Valle endocarditis resulting from nosocomial bacteremia. A prospective,
multicenter study, Ann. Intern. Med. 119, (1993), s. 560-567
Analiza zjawiska biofilmu – mechanizmy powstawania, wpływ
na organizm i implanty
Zadaniem implantów umieszczanych w organizmie ludzkim jest pełnienie funkcji zastępowanych
tkanek. Często zabiegi wszczepiania implantów wiążą się ze zwiększeniem komfortu pacjenta,
jednak nie są one pozbawione ryzyka. Szacuje się, że blisko 70% operacji wszczepiania implantów wiąże się z zakażeniami spowodowanymi występowaniem biofilmu. Infekcje związane
z biofilmem mają charakter przewlekły, niejednokrotnie groźny dla życia ludzkiego, przy czym
bakterie go tworzące są odporne na antybiotyki. Biofilm występując na powierzchniach
biomateriałów może powodować korozję oraz wpływać na ich właściwości mechaniczne.
Dlatego tak ważne jest poznanie mechanizmów powstawania biofilmów oraz znalezienie
skutecznych środków umożliwiających jego zwalczanie bez konieczności chirurgicznej ingerencji w organizm ludzki.
Analysis of the biofilm phenomenon – formation mechanisms, effects
on the body and implants
The task of implants placed in the human body is replacing the function of tissues. Common
treatments are associated with increased patient comfort, but they are not without risk. It is
estimated that nearly 70% of implant surgeries associated with infections caused by the
occurrence of biofilm. Biofilm infections are chronic, often life-threatening, while bacteria
forming it are resistant to antibiotics. The biofilm present on the surfaces of biomaterials can
cause corrosion and affect their mechanical properties. Therefore, it is important to understand the
mechanisms of biofilms and to find effective means to combat it without surgical intervention
in the human body.
17
Alicja Janicka1, Anna Cwynar2, Blanka Ziomkowska3, Joanna Sikora4, Emilia
Siemińska5
Antybiotykooporność
– poważny problem dzisiejszej cywilizacji
1. Wprowadzenie
Pierwszym krokiem w kierunku leczenia chorób bakteryjnych zarówno
ludzi jak i zwierząt było odkrycie penicyliny 28 września 1928r. przez
Aleksandra Fleminga. Penicylina miała okazać się panaceum na wszystkie
zakażenia bakteryjne. Po tym nowatorskim odkryciu powoli nakręcało się
koło napędowe, prowadzące do wyszukiwania i tworzenia coraz to
nowszych naturalnych i półsyntetycznych antybiotyków. Był to okres
przełomowy w medycynie, oddający w ręce lekarzy potężną broń do walki
z drobnoustrojami, które stanowiły przyczynę chorób i śmierci wielu ludzi
i zwierząt. W tamtym okresie mogłoby się wydawać, że lekom przeciwdrobnoustrojowym nic nie zagrozi. W latach 60. XX wieku uważano nawet,
że zakażenia bakteryjne przeszły w niepamięć i że zwalczono je na zawsze.
W późniejszym okresie jednak, zaczęto zauważać, że istnieją szczepy
bakterii wykazujące oporność na antybiotykoterapię, przez co leczenie
chorób przez nie wywołanych stało się problemem ówczesnych lat i trwa
do dnia dzisiejszego [1, 2, 23].
Gronkowce oporne na metycylinę, enterokoki oporne na wankomycynę,
a także pneumokoki oporne na penicyliny to tylko nieliczne przykłady
bakterii (grupa Gram-dodatnich), które stanowią coraz to większy problem
w lecznictwie, ze względu na fakt, że wiele z nich może być opornych
jednocześnie na antybiotyki jak i chemioterapeutyki [3]. Z biegiem czasu
i z postępami w pracach mających na celu odkrycie medykamentu, który
miałby uporać się z drobnoustrojami wykazującymi oporność na
dotychczasowe leczenie, okazało się że takim „antybiotykiem ostatniej
1
[email protected], Collegium Medicum w Bydgoszczy, Wydział Farmaceutyczny,
Studenckie Koło Naukowe Biofizyki przy Zakładzie Biofizyki
2
[email protected], Collegium Medicum w Bydgoszczy, Wydział Farmaceutyczny, Katedra
i Zakład Patobiochemii i Chemii Klinicznej
3
[email protected], Collegium Medicum w Bydgoszczy, Wydział Farmaceutyczny, Katedra
i Zakład Biofizyki
4
[email protected], Wydział Lekarski, Katedra Farmakologii i Terapii
5
[email protected], Wydział farmaceutyczny, Studenckie Koło Naukowe Chemii
Analitycznej
18
Antybiotykooporność – poważny problem dzisiejszej cywilizacji
szansy” jest wankomycyna. Jednak i ten antybiotyk jest nieskuteczny w walce
z infekcjami wywołanymi przez szczepy gronkowców i paciorkowców.
Szczególnie niebezpiecznymi szczepami bakterii zwłaszcza dla pacjentów
w trakcie leczenia szpitalnego, a także tych z zaburzeniami czynności
immunologicznych są zakażenia Staphylococcusaureus opornym na leczenie
metycyliną (MRSA – MethycillinResistantStaphylococcusaureus) [4].
Najważniejszym punktem w terapii chorób bakteryjnych, powinna być jak
najwcześniejsza identyfikacja tego drobnoustroju oraz ustalenie jego
wrażliwości na leki. Ma to wpływ na wywołanie pozytywnego efektu
terapeutycznego. Pominięcie tego istotnego kroku i stosowania leków
o szerokim spektrum działania jest jednym z powodów nabywania przez
drobnoustroje antybiotykoodporności [5].
2. Cel pracy
Celem pracy jest omówienie problemuantybiotykoodporności drobnoustrojów, mechanizmów prowadzących do wytworzenia przez bakterie
oporności oraz ewentualnych działań mających na celu zniwelowanie
niniejszego zagrożenia dla dobra przyszłości cywilizacji.
3. Omówienie
3.1. Przyczyny prowadzące do powstania oporności bakterii na
terapię antybiotykową
Standardowo wyróżnia się antybiotykooporność wrodzoną oraz nabytą.
Oporność na antybiotyki wrodzona, jak sama nazwa wskazuje jest naturalna
i charakteryzuje się niewrażliwością niektórych bakterii na poszczególne
antybiotyki. Jest to zjawisko, które obserwuje się u większości bakterii Gramujemnych, opornych na działanie penicylin pochodzenia naturalnego. Jest ono
spowodowane budową komórki drobnoustroju i poprzez to np. niemożliwe jest
wnikanie antybiotyku do wnętrza komórki bakteryjnej i oddziaływanie na nią.
Bakterie z opornością nabytą posiadają umiejętność przystosowania się do
środowiska w celu przeżycia w panujących warunkach. Jednym z takich
efektów przystosowawczych są mutacje bakterii pojawiające się
z częstotliwością 1 na 10-8-10-9 podziałów chromosomalnych. W wyniku tych
przemian dochodzi do współzawodnictwa z innymi bakteriami, migracją czy
też zmianą środowiska, a to z kolei prowadzi do nabycia przez drobnoustroje
niewrażliwości na działanie antybiotykoterapii. W obecnej dobie, kiedy to
antybiotyki są szeroko stosowane także w sektorze rolno-spożywczym,
bakterie oporne na ich działanie, rozwijają się również poprzez spożywanie
przez ludzi produktów spożywczych pochodzenia zwierzęcego. U tych
zwierząt wdrożone zostało leczenie antybiotykami i nie zachowano po tej
19
Alicja Janicka, Anna Cwynar, Blanka Ziomkowska, Joanna Sikora, Emilia Siemińska
terapii okresu między zakończeniem podawania antybiotyków, a ubojem
zwierzęcia [6, 7, 8, 24].
To właśnie stosowanie w życiu codziennym antybiotyków i nieprzestrzeganie okresów karencji jest głównym z powodów zwiększenia się ilości
patogenów opornych na działanie leków. Bardzo duże zagrożenie stanowią
doniesienia, mówiące o tym, że bakterie posiadające status bezpiecznych dla
człowieka (bakterie fermentacji mlekowej), mogą posiadać geny
odpowiedzialne za antybiotykooporność, które są w stanie przenieść się na
mikroorganizmy patogenne, poprzez m.in. transfer genów dzięki ruchomym
elementom DNA. Dodatkowym zagrożeniem może okazać się fakt, że np.
bakterie z rodzaju Lactobacillus, należące do grupy probiotyków, mogą
wytworzyć w swoich komórkach więcej niż jeden mechanizm antybiotykoodporności. Dlatego też bardzo istotnym krokiem jest poddanie bakterii
probiotycznych szerokim badaniom pod względem oporności na antybiotyki
oraz możliwości przenoszenia przez nie genów oporności poprzez transfer.
W dniu dzisiejszym po długoletniej, często syzyfowej, a także nadgorliwej
walce z bakteriami naukowcy z całego świata obawiają się, że może dojść do
sytuacji, gdzie oporność bakterii będzie tak duża, iż nie będą one wykazywać
wrażliwości na żadne antybiotyki [24, 25].
3.2. Mechanizmy prowadzące do nabywania
antybiotykoodporności przez komórki bakteryjne
Mutacja oraz horyzontalny transfer genów to dwa główne mechanizmy
nabywania przez drobnoustroje oporności [29]. Jeden z wymienionych
mechanizmów nabierania przez bakterie oporności na działanie antybiotyków – pionowy transfer genów, polega na tym, że bakterie obecne
w organizmie wrażliwe na antybiotykoterapię zostają w procesie leczenia
wyeliminowane, ustępując jednocześnie miejsca bakteriom opornym na
działanie tego medykamentu. Tak się dzieje w przypadku np. szczepu
Escherichia coli, kiedy to podczas leczenia streptomycyną jedna komórka
na ok 10-9 staje się oporna na ten antybiotyk. Mogłoby się wydawać, że
taka zmiana i uodpornienie się tak niewielkiej ilości bakterii nie powinno
mieć większego znaczenia dla organizmu. Biorąc jednak pod uwagę
szybkość z jaką bakterie się namnażają skala nowopowstałych
drobnoustrojów opornych jest ogromna [9‚11, 26, 29].
Bardzo niebezpieczną drogą prowadzącą do szerzenia się antybiotykooporności jest kontakt zwierząt zdrowych ze zwierzętami, paszą czy
środowiskiem zakażonym opornymi bakteriami. Innymi słowy duży wpływ
na szerzenie się antybiotykooporności ma łańcuch żywieniowy. Człowiek
może zostać zarażony poprzez spożywanie pokarmów odzwierzęcych
(np. mleko, mięso), ale także poprzez bliski kontakt ze zwierzętami
20
Antybiotykooporność – poważny problem dzisiejszej cywilizacji
(np. pies może zarazić człowieka gronkowcem opornym na metycylinę).
Bakterie poprzez umiejętność modyfikacji cząsteczki antybiotyku, potrafią
zmienić cel jego działania po czym przy pomocy pompy wypływowej
(zwiększa się wypływ antybiotyku, który już dostał się do wnętrza bakterii
dzięki tak zwanemu systemowi efflux(ang. efflux pumps of multi-drug
resistance) usunąć antybiotyk z własnej komórki. Jest to mechanizm dzięki
któremu, bakterie stają się niewrażliwe na działania antybiotyków. Są także
w stanie zakłócić wchłanianie antybiotyku przez ścianę komórkową
bakterii, zmienić jej strukturę oraz strukturę białek (poryn) jako kanałów,
które umożliwiają antybiotykom penetracje wnętrza bakterii Gramujemnych w przypadku grupy aminoglikozydów [12, 13,15, 16, 24].
Poziome przenoszenie genów oporności z komórki bakteryjnej opornej,
na komórki bakteryjne wrażliwe w procesach transformacji, transdukcji
oraz koniugacji to kolejny mechanizm nabywania przez bakterie oporności.
Transformacja polega na przejęciu materiału genetycznego ze środowiska
zewnętrznego przez bakterię, najczęściej z pozostałości po martwej
bakterii. Koniugacja zachodzi w trakcie kontaktu bakterii i przekazaniu
sobie DNA w postaci plazmidu. Do transdukcji natomiast przyczyniają się
bakteriofagi, które przenoszą DNA między bakteriami najczęściej tego
samego rodzaju. Główną rolę w przenoszeniu genów oporności między
bakteriami odgrywają wspomniane już plazmidy, często także transpozony
oraz integrony rozmieszczone zarówno na plazmidach jak i w chromosomach, dla których charakterystyczną cechą jest zdolność dodawania
i usuwania kodujących sekwencji z ruchomej kasety [9, 10, 11, 26, 29].
Enzymatyczna inaktywacja antybiotyku przez enzymy produkowane
przez bakterie oporne to kolejny bardzo niebezpieczny mechanizm
antybiotykoodporności. Najszerzej poznanymi (ze względu na częstość
używania antybiotyków β-laktamowych) enzymami są β-laktamazy. Ich
mechanizm działania polega na niszczeniu aktywności antybiotyku poprzez
hydrolizowanie wiązania między węglem a azotem (C-N), który jest
zlokalizowany w pierścieniu β-laktamowym antybiotyków z tej grupy
(np. penicyliny, karbapenemy, cefalosporyny). Przykładem bakterii posiadającej takie właściwości jest Pseudomonas aeruginosa, czyli pałeczka
ropy błękitnej [14, 26, 29].
4. Możliwości postępowania w terapiach chorób z udziałem
bakterii opornych na działanie antybiotyków
Jedną ze strategii postępowania z antybiotykoopornością bakterii jest
poszukiwanie nowych antybiotyków, mających wykazywać niszczące
działanie na oporne szczepy. Często antybiotyki z grupy β-laktamów łączy
się w preparatach z kwasem klawulanowym, sulbaktamem, czy też
21
Alicja Janicka, Anna Cwynar, Blanka Ziomkowska, Joanna Sikora, Emilia Siemińska
tazobaktamem, które mają spełniać rolę ochronną, poprzez umiejętność
hamowania produkcji enzymów – β-laktamaz [17, 26].
Cekropiny oraz sapecyny należą do polipeptydów kationowych
pozyskiwanych z owadów. Stwarzają one także możliwość alternatywnego
wykorzystania ich w terapii chorób bakteryjnych. Ich dodatkowym atutem
jest absolutny brak oddziaływania na organizm człowieka jak i zwierzęcia,
przez co nie wywołują skutków ubocznych [23].
W związku z coraz szerzej występującym zjawiskiem antybiotykoodporności podejmuje się także wdrożenie alternatywy dla antybiotyków
w postaci terapii przy pomocy bakteriofagów. Fagi działają wybiórczo na
konkretne gatunki bakterii, nie uszkadzając naturalnej flory bakterii
potrzebnych organizmowi (np. bakterie jelitowe). Między bakteriami,
a fagami nie obserwuje się oporności krzyżowej, dzięki czemu
w przypadku oporności na fagi dodatkowo można zastosować antybiotyk,
ponieważ wytworzenie mechanizmu obronnego bakterii równocześnie na
faga i antybiotyk jest niskie. Możliwe jest także wytworzenie superbakteriofaga, charakteryzującego się zdolnością do niszczenia jednocześnie
przynajmniej kilku szczepów lub gatunków bakterii. Jednak jak każda
metoda i ta posiada swoje ograniczenia do których zalicza się m.in. ewentualną replikacje fagów w leczonym organizmie i możliwość negatywnego
oddziaływania na komórki zainfekowane bakteryjnie np. szczepienia mogą
nie przynosić efektu uodparniającego [4, 18, 19, 20, 21, 22].
5. Podsumowanie
Antybiotyki często określane mianem „cudownych leków” są substancjami chemicznymi, które zabijają lub hamują wzrost bakterii poprzez,
zahamowanie syntezy ścian komórkowych bakterii, lub hamowanie
produkcji białek, RNA czy DNA.
Po odkryciu przez Fleminga penicyliny i jej dobroczynnych właściwości
w początkowym okresie wydawało się, że już niewielkie jej dawki są
w stanie zwalczyć infekcje bakteryjne, jednak w miarę upływu czasu efekty
nie były już tak spektakularne. Wtedy już, był to jeden z pierwszych
przykładów antybiotykoodporności jako reakcji obronnej bakterii na
działanie penicyliny, jako leku podawanego do organizmu w celu
zwalczenia infekcji. To ważne spostrzeżenie ze względu na fakt, że
zjawisko nabywania oporności jest procesem w pełni naturalnym i tak jak
w przypadku penicyliny, produkowanej głównie przez grzyby w celu
ochrony przed bakteriami nie powinno wzbudzać większego zdziwienia,
a raczej być przedmiotem badań nad uczynieniem oporności łatwiejszej do
kontrolowania [27, 28].
22
Antybiotykooporność – poważny problem dzisiejszej cywilizacji
Niestety w głównej mierze to właśnie człowiek przyczynił się do
powstania zjawiska antybiotykoodporności, bez umiejętności pełnej jej
kontroli, poprzez nadużywanie tych leków w różnych sektorach zarówno
medycznym pacjent-lekarz, jak i w sektorze rolnym. Przykładów można by
wymieniać wiele np. intuicyjne podparte na doświadczeniu lekarza
przepisywanie antybiotyku, bez wykonania antybiogramu, nawet jeśli
objawy występujące u chorego są efektem działania wirusów. Kolejnym
przykładem jest odstawienie przez pacjentów leku niedługo po ustąpieniu
objawów choroby takich jak gorączka lub też zbyt niskie stężenie stosowanego medykamentu (niemożliwe jest osiągnięcie stężenia terapeutycznego leku) co utrudnia pozbycie się bakterii i wytwarza u nich
oporność. W sektorze rolniczym natomiast największym problem jest
nadużywanie antybiotyków nie tyle w celu terapeutycznym, ale co przerażające, aż 80% jest wykorzystywana w celu profilaktycznym. Podawanie
antybiotyków zwierzętom hodowlanym powoduje ich szybki wzrost
i osiągnięcie znacznie większej masy, co z kolei przekłada się na zwiększoną produkcje mięsa, a co za tym idzie – wyższe dochody [30, 31, 32].
W walce z opornością bakterii na antybiotyk w celu zapobiegnięcia
powstania „superbakterii”, wymagane są działania w skali globalnej. Mowa
tu o racjonalnym gospodarowaniu antybiotykami, to znaczy używaniu ich
jako substancji leczniczych w terapii ludzi i zwierząt, zminimalizowanie
ich użycia w sektorze rolniczym i całkowite wykluczenie ich używania jako
dodatku do pasz w celu np. przyspieszonego wzrostu masy ciała zwierząt. Już
te zabiegi znacząco zminimalizowałyby szerzenie się oporności bakterii na
antybiotyki co mogłoby zaowocować lepszym zdrowiem oraz wyeliminowaniem zagrożenia jakim może stać się wyczerpanie możliwości leczenia
chorób o podłożu bakteryjnym [30].
W związku z nadużywaniem stosowania antybiotyków, zrodziła się
potrzeba promowania wiedzy na temat tych leków. Pierwszy na świecie
Światowy Tydzień Wiedzy o Antybiotykach, organizowany przez WHO,
odbył się między 16, a 22 listopada 2015 roku. Walka z antybiotykoopornością
jest priorytetowym zagadnieniem dla m.in. Światowej Organizacji Zdrowia,
Komisji Europejskiej, FDA, czy też dla Parlamentu Europejskiego.
23
Alicja Janicka, Anna Cwynar, Blanka Ziomkowska, Joanna Sikora, Emilia Siemińska
Literatura
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
Angulo F. J., Nunnerz. A., Bair H. D. Ł., Antimicrobial resistance in zoonotic
enteric pathogens, Rev. Sci. Tech. Off. Int. Epis. 23 (2004), 485-496
WHO,Containing of antimicrobial resistance: review of literature and report
of a WHO workshop on the development of a global strategy for the
containment of antimicrobial resistance, 4-5 February 1999, Geneva, WHO
Geneva, pp. 1-34
Tacconelli E., De Angelis G., Cataldo M.A., Pozzi E., Cauda R., Does
antibiotic exposure increase the risk of methicillin-resistant Staphylococcus
aureus (MRSA) isolation? A systematic review and meta-analysis. J.
Antimicrob. Chemother. 61 (2008), 26-38
Srinivasan A., Dick J. D., Perl T. M., Vancomycin resistance of staphylococci,
Clin. Mirobiol. Rev. 15, (2002), 430-438
Barza M., Trawers K., Excess infections due to antimicrobial resistance
to attributable infections, Clin. Infect. Dis. 34, (2002), 5126-5130
Denamur E., Matic I., Evolution of mutation rates in bacteria, Mol. Microbiol.
60, (2006), 820-827
Albrich W. C., Monnet D. L., Harbarth S., Antibiotic selection pressure
and resistance in Streptococcus pneumoniae and Streptococcus pyogenes,
Emerg. Infect. Dis. 10, (2004), 514-517
Szczypta K., AntybiotykoopornośćStreptococcuspyogenes, Diagnostyka
laboratoryjna, Laboratorium 3-4, (2015), 35-3
Martínez J. L., Antibiotics and antibiotic resistance genes in natural
environments, Science131, (2008), 365-367
Tsubokura M., Matsumoto A., Otsuki K., Animas S. B., Sanekata T., Drug
resistance and conjugative R plasmids in Escherichia coli strains isolated
from migratory waterfowl, J. Wildlife Dis. 31, (1995), 352-357
Alekshun M., Levy S. B., Molecular mechanisms of antibacterial multidrug
resistance, Cell128, (2007), 1037-1050
Mathew A. G., Cissell R., Liamthong S., Antibiotic resistance in bacteria
associated with food animals: a United States perspective of livestock
production, Foodborne Pathog. Dis. 4, (2007), 115-133
Damborg P., Top J., Hendrickx A. P., Dawson S., Willems R. J., Guardabassi
L., Dogs are a reservoir of ampicillin-resistant Enterococcus faecium lineages
associated with human infections, Appl. Environ. Microbiol. 75, (2009), 23602365
Savjani J. K., Gajjar A. K., Savjan, K. T., Mechanisms of resistance: useful
tool to design antibacterial agents for drug – resistant bacteria, MiniRevews.
Med. Chemistry 9, (2009), 194-205
Bruin de M. A., Riley L. W., Does vancomycin prescribing intevention affect
vancomycinresistant enterococcus infection and colonization in hospitals?
A systematic review, BMC Infect. Dis. 10, (2007), 7-24
Li X., Nikadio H., Efflux-mediated drug resistance in bacteria: an update,
Drug 69, (2009), 1555-1623
24
Antybiotykooporność – poważny problem dzisiejszej cywilizacji
17. Singh G., Kapoor I. P., Pandey S. K., Singh U. K., Singh R. K., Studies
on essential oils: part 10; Antibacterial activity of volatile oils of some spices,
Phytother. Res. 16, (2002), 680-682
18. Cao J., Sun Y., Berglindh T., Mellgard B., Li Z, Mardh B., Mardh S.,
Helicobacter pyloriantigen- binding fragments expressed on the filamentous
M13 phage bacterial growth, Biochem.Biophys. Acta 1474, (2000), 107-113
19. Carlton M., Phage therapy: past history and present prospects, Arch.
Immunol. Ther. Exp.47, (1999), 267-274
20. Boyd E. F., Davis B. M., Hochhut B., Bacteriophage – bacteriophage
interactions in the evolution of pathogenic bacteria, Trends Microbiol.
9, (2001), 137-144
21. Mathur M. D., Vidhani S., Mehndiratta P. L., Bacteriophage therapy: an
alternative to conventional antibiotics, J. Ass. Physicians 51, (2003), 593-596
22. Weber-Dąbrowska M., Mulczyk M., Górski A., Bacteriphage therapy of
bacterial infections: an update of our Institute‘s experiments, Arch. Immunol.
Ther. Exp. 48, (2000), 547-551
23. Gliński Z., Kostro K., Chełmiński M., Polipeptydy przeciwdrobnoustrojowe
owadów alternatywą w leczeniu zakażeń zwierząt, ludzi i roślin, Życie Wet.
81, (2006), 31-35
24. Rzepkowska A., Zielińska D., Kołożyn-Krajewska D., Antybiotykooporność
bakterii z rodzaju Lactobacillus pochodzących z żywności, jako kryterium
stawiane probiotykom, Zeszyty problemowe postępów nauk rolniczych 578,
(2014), 99-110
25. WHO, Antimicrobial resistance: global report on surveillance, WHO Library
Cataloguingin-Publication Data, (2014), 1-256
26. Wolska K., Kot B., Piechota M., Frankowska A., Oporność
Pseudomonasaeruginosa na antybiotyki, Post.Hig. Med. Dośw.; 67, (2013),
1300-1311
27. Purdom G., Antibiotic Resistance of Bacteria: An example of Evolution in
Action?,Answers, 2:3, (2007), 74-76
28. Todar K., Bacterial Resistance to Antibiotics, Lectures in Microbiology, 2009
29. Marciniak P., Oporność bakterii na antybiotyki, Gazeta farmaceutyczna. 12,
(2008), 30-32
30. Hryniewicz W., Grzesiowski P., Narodowy Program Ochrony Antybiotyków
w Polsce, Chrońmy antybiotyki, 2005
31. Khachatourians G. G., Agricultural use of antibiotics and the evolution and
transfer of antibiotic-resistant bacteria, Canadian MedicalAssociation. 159,
(1998), 1129-1136
32. Wise R., Hart T., Cars O., Streulens M., Helmuth R., Huovinen P., Sprenger
M., Antimicrobial resistance is a major threat to public health, 317, (1998),
609-610
25
Alicja Janicka, Anna Cwynar, Blanka Ziomkowska, Joanna Sikora, Emilia Siemińska
Antybiotykooporność – poważny problem dzisiejszej cywilizacji
Według Światowej Organizacji Zdrowia (WHO) poziom antybiotykooporności zarówno
w Państwach Unii Europejskiej jak i poza nią jest ogromnym problemem zdrowotnym
społeczeństwa i dotyczy coraz to większej liczby osób. Antybiotykooporność stanowi bardzo
poważne zagrożenie zdrowotne na całym świecie – zwłaszcza oporność na tak zwane antybiotyki
ostatniej szansy. Tworzenie nowych antybiotyków jest procesem długotrwałym i pracochłonnym.
Przy obecnym nadużywaniu ich, może okazać się, że leczenie najprostszych zakażeń krwi, skóry
czy dróg oddechowych będzie nieskuteczne, a infekcje te staną się śmiertelne. Istotnym krokiem
w walce z drobnoustrojami jest zarówno uświadomienie społeczeństwa o zagrożeniach płynących
z nadużywania antybiotyków, jak i poznanie mechanizmów rozwoju oporności przez bakterie
i opracowanie skutecznych strategii w walce z nimi.
Antibiotic resistance – a serious problem of modern civilization
According to the World Health Organization (WHO) the level of antibiotic resistance in
European Union Countries and beyond is a huge health problem of a population and affects more
and more people. Antibiotic resistance is a serious risk for health for whole world – especially
resistance to antibiotics known as antibiotics of last resort. Creation of new antibiotics is a process
that takes time and is very laborious. With the current situation of abusing the antibiotics it may
occur that the simplest treatment of blood infections, skin or respiratory system is ineffective, and
the infections become fatal. A very important step in the fight against microorganisms is both
educate the public about the danger of overuse of antibiotics, as well as understand the
mechanisms of the development of resistance by bacteria and develop effective strategies to
combat them.
26
Joanna Woźniak1, Natalia Dereń2, Edyta Simińska3
Mechanizmy wnikania koronawirusów
do komórek gospodarza
1. Wstęp
Koronawirusy (ang. Coronaviruses, CoVs) należą do wirusów RNA.
Pochodzą z podrodziny Coronavirinae, a wraz z Torovirinae należą do
dużej rodziny Coronaviridae, rzędu Nidovirales. Podrodzina Coronavirinae
została podzielona na podstawie cech genetycznych na różnerodzaje: alfa-,
beta- gamma, a także delta-koronawirusy, przy czym do gatunków
zakażających ludzkie organizmy należą alfa- i beta-koronawirusy [1].
Koronawirusy należą do jednych z największych wirusów RNA pod
względem długości genomu oraz wielkości wirionu. Jego wielkość waha
się od 80 do 120nm. Wirusowe RNA od strony końca 5’zajmuje gen
kodujący 4-5 białek strukturalnych, 15-16 niestrukturalnychoraz 1-8 białek
dodatkowych [2]. Wielkość genomu koronawirusów waha od 26,2 do 31,7
kb oraz zawiera od 6 do 10 otwartych ramek odczytu (ang. open
readingframe, ORF). Pierwsza ORF (ORF1a / b) koduje białka replikazy
i zawiera w przybliżeniu 2/3 genomu CoV. Pozostała 1/3 zawiera cztery
geny białek strukturalnych: białko S (białko odpowiedzialne za interakcję
z receptorem na powierzchni komórek, tzw. „Spike”), białko E (białko
otoczki), białko M (białko błonowe, zwane również białkiem macierzy)
oraz białko N (białko nukleokapsydu). Białka M i E są odpowiedzialne za
składanie wirusa, podczas gdy białko S pozwala na wniknięcie wirusa do
komórki gospodarza, tym samym pełniąc kluczową rolę z punktu widzenia
niniejszej publikacji.Ostatnie białko – N – jest odpowiedzialne za modyfikację procesów komórkowych oraz bierze udział w replikacji kapsydu
wirusowego RNA. Ponadto, niektóre z koronawirusówmogą także zawierać
w genomie kodowane dodatkowe białka, HE (hemaglutynina-esteraza),
a więc białka wirusowe, któresą znane jako białka odpowiedzialne za
interakcję wirusów z komórką gospodarza [3]. Celem niniejszej pracy jest
1
[email protected], Zakład Genoterapii, Uniwersytet Mikołaja Kopernika Collegium
Medicum im. Ludwika Rydygiera w Bydgoszczy, wydział lekarski
2
[email protected], Katedra Położnictwa, Zakład Medycyny Rozrodu
i Andrologii,Uniwersytet Mikołaja Kopernika Collegium Medicum im. Ludwika Rydygiera
w Bydgoszczy, wydział nauk o zdrowiu
3
[email protected], Katedra i Zakład Toksykologii, Uniwersytet Mikołaja Kopernika
Collegium Medicum im. Ludwika Rydygiera w Bydgoszczy, wydział farmaceutyczny
27
Joanna Woźniak, Natalia Dereń, Edyta Simińska
przedstawienie mechanizmów wnikania koronawirusów przez błonę
komórkową gospodarza.
2. Ludzkie koronawirusy – charakterystyka ogólna
Koronawirusy są w stanie zainfekować wiele różnych gatunków ptaków
i ssaków. Infekcje CoVsdotyczą zwłaszcza układu oddechowego
i pokarmowego wśród ssaków i ptaków. W niewielu przypadkach
omawiane wirusy są przyczyną zapalenia wątroby i różnych chorób
neurologicznych [4]. Podczas, gdy pierwsze wzmianki o koronawirusach
sięgają 1930 roku [5], zyskały one sławę w 2003 roku jakoprzyczyna
zespołu ostrej ciężkiej niewydolności oddechowej (ang. severe acute
respiratory syndrome, SARS) [6]. Wirus wywołujący SARS, SARS-CoVto
ludzki koronawirus o pojedynczej dodatniej nici RNA, o genomie wielkości 27-31kb i ogonem poli-A na końcu 3'. W latach 2002-2003 SARSCoV spowodował prawie 8000 zakażeń, a wskaźnik śmiertelności wyniósł
aż 10% [7].
Wysoce niebezpieczny jest także koronawirusMERS (ang. middleeast
respiratory syndrome – CoronaVirus, MERS-CoV), który został po raz
pierwszy zidentyfikowany w Arabii Saudyjskiej w 2012 roku. Najnowsze
doniesienia Światowej Organizacji Zdrowia (ang. World Health Organization,
WHO) z 4 grudnia 2015 roku podają że dotychczas odnotowano 1621
laboratoryjne potwierdzonych przypadków zakażenia wirusem MERS,
o śmiertelności wynoszącej blisko36%. Było to odpowiednio 584 zgonów
związanych z MERS-CoV [8]. Dlatego też badania nad koronawirusamimogą
mieć istotny wpływ nie tylko na wskaźniki zdrowotne, ale także ekonomiczne.
2.1. Białko S jako główny czynnik odpowiedzialny za wnikanie
koronawirusa przez błonę komórki
Białko S odgrywa niezwykle istotną rolę w procesie wnikania
koronawirusa do komórki gospodarza, ponieważ wchodzi w interakcje
z białkami gospodarza na błonie komórkowej. Dochodzi następnie do
wnikania wirusowego nukleokapsydu, co spowodowane jest konformacją
białka S [9].
Białko S to białko transmembranoweklasy I o typowym rozmiarze
w zakresie od 1160 do 1400 aminokwasów. Zawiera on 21-35 miejsc
N-glikozylacji. Białka S koronawirusów mają tendencję do wiązania się
wtrimery na powierzchni wirionu. To właśnie z tego powodu koronawirusy
zyskały nazwę rodziny. Przedrostek „korona” (łac. corona), nawiązuje do ich
charakterystycznego wyglądu pod mikroskopem elektronowym [10].
Jako jedno z białek klasy I, białko S składa się z trzech segmentów:
zewnętrznego, transmembranowego i krótkiego ogona wewnątrzkomórkowego
28
Mechanizmy wnikania koronawirusów do komórek gospodarza
[11]. Segment zewnętrzny białka S zawiera 2 domeny: S1 (N-końcowa), która
jest odpowiedzialna za wiązanie z receptorem, a następnie wnikanie przez
błonę komórkową, a także S2 (C-końcową), stanowiącą najbardziej
konserwatywny region białka S. Podjednostka S2 składa się z domen
uczestniczących w fuzji błon: peptydu fuzyjnego (ang. fusion peptide, FP),
hydrofobowych domen-1 i -2 (ang. heptadrepeat domains HR1, HR2)
i domeny transbłonowej (ang. transmembrane domain, TM) [10]. Powszechnie
domeny białka S pozostają połączone w przypadku alfa- i większości z betakoronawirusów. Jednakże w przypadku gamma-, a także w u niektórych
betakoronawirusach białko S jest przecinane pomiędzy tymi domenami.
Domena S1 składa się z dwóch niezależnych subdomen: N-końcowej (S1NTD) oraz C-końcowej (S1-CTD). Obie posiadają zdolność wiązania
cząsteczek, takich jak cukry lub domeny wiążące receptory (ang. receptor
binding domains, RBD) [9].
Casaisi wsp. wykazali znaczenie białka S w przypadku tropizmu
komórkowego. Postanowili użyć rekombinowanego wirusa zakaźnego
zapalenia oskrzeli, szczep Beaudette, (ang. infectious bronchitis virus, IBV),
członka rodzinyCoronaviridae, który replikuje się głównie w drogach
oddechowych, a także w komórkach nabłonkowych nerek. Typowa dla
szczepów IBV jest infekcja tylko komórek zarodków kurzych. Postanowili
więc wyprodukować rekombinowaną wersję wirusa,rIBV, w którym zastąpili
białko S szczepu Beaudette na odpowiadający mu gen kodujący białko S ze
szczepu IBV M41-CK. Szczep IBV Beaudette jest w stanie rozmnażać się
w komórkach CK, CEF, BHK-21, a także w Vero. W przeciwieństwie do IBV
Beaudette, IBV M41-CK może rozmnażać tylko w komórkach CK. Różnice te
dały możliwość badania mechanizmu tropizmu komórkowego. W rezultacie,
otrzymany BeauR-M41 posiadał taki sam tropizm komórkowy jaki
występował w przypadku IBV M41-CK. To doświadczenie wykazało, że
białka S są z pewnością odpowiedzialne za tropizm komórkowy [12].
2.2. Białko N jako cząsteczka wirulencji
Białko nukleokapsydu jest białkiem wiążącym RNA, które wchodzi
w interakcję z białkiem M podczas składania wirionów. Jest także zaangażowanew tworzeniu kapsydu wirusa i odgrywa ważną rolę w replikacji
[13]. Białko N wiąże się przede wszystkim zarówno z mRNA genomowym
i subgenomowym oraz z mikrotubulami. Ponadto białko N wykazuje
aktywność L RNazy, będąc antagonistą interferonu typu I (IFN) [14].
Białko nukleokapsydu składa się z dwóch domen: N-końcowej
(N-NTD) oraz C-końcowej (N-CTD). Posiada również 3 konserwatywne
regiony (I, II, III), które są odłączane w regionach A i B. Region II jest
odpowiedzialny za wiązanie RNA, natomiast region III odgrywa ważną
29
Joanna Woźniak, Natalia Dereń, Edyta Simińska
rolę w wiązaniu białka M [13]. Domenę NTD rozpoczyna konserwatywny
region I, natomiast zakończona jest regionem II. Natomiast domena CTD
znajduje się wewnątrz konserwatywnego regionu II i kończy się tuż przed
obszarem B [15].
Cowely i wsp. postanowili zbadać rolę białka N w chorobie wywołanej
przez wirus zapalenia wątroby u myszy (ang. Mouse hepatitis virus,MHV)
wśród szczepów A59 i JHS. Badania były oparte na fakcie, że prawie 95%
sekwencji aminokwasowych w białkach N tych szczepów jest identyczne.
Badacze użyli dwóch chimerycznych wirusów, między którymi dokonano
wymiany białek nukleokapsydu między szczepami A59 i JHS. W rezultacie
nie zaobserwowano żadnych zmian morfologicznych w porównaniu ze
szczepem dzikim. Jednakże zaobserwowano istotne zmiany dotyczące
wirulencji, ponieważ zauważono istotne statystycznie różnicepodczas
replikacji wirusów w ośrodkowym układzie nerwowym (OUN). Co
ciekawe,znacznie większą ekspresję antygenu w mózgu zauważono
w przypadku, gdy zastosowano chimerę A59 z białkiem N pochodzącym ze
szczepu JHS [16].
2.3. Receptory koronawirusów
Pierwszym etapem infekcji komórki gospodarza jest rozpoznanie
receptora przez wirus. Jak opisano powyżej, białko S jest odpowiedzialne
za wiązanie do swoistego receptora na powierzchni komórki, a następnie
fuzjędo komórki gospodarza [10, 17]. W kolejnym ważnym etapie infekcji
biorą udział RBD oraz receptory.
Koronawirusy są zdolne do wiązania wielu różnych receptorów.
Inhibitory enzymu konwertującego angiotensynę 2 (ang. angiotensin
converting enzyme 2, ACE-2), to charakterystyczny receptor dla ludzkiego
wirusa wywołującego SARS [18]. ACE-2 reguluje funkcje układu
sercowo-naczyniowego [19, 20].
Kolejnym receptorem jest aminopeptydaza N (APN), znana również
jako CD13.Jest to ektopeptydaza, której działanie zależne jest od cynku. W
efekcie APN odpowiedzialna jest za odczepianie białek od N-końca
peptydu. APN to białko transbłonowe typu II, z którym związane jest wiele
funkcji, takich jak odczuwanie bólu, regulacja ciśnienia krwi, ale
równieżangiogeneza, chemotaksja oraz adhezja komórek [21]. Do
rozpoznawania APN zdolne są dwa CoVs: TGEV (ang. transmissible
gastroenteritis virus), który infekuje komórki jelita cienkiego i dróg
oddechowych, oraz PRCoV (ang. porcine respiratory CoronaVirus) [22].
Molekuła adhezji komórkowej antygenu karcynoembrionalnego 1, (ang.
carcino embryonic antigen-related cell adhesion molecule 1, CEACAM1)
jest cząsteczką adhezji komórkowej, która występuje na leukocytach,
30
Mechanizmy wnikania koronawirusów do komórek gospodarza
nabłonka i śródbłonka. Jest ona odpowiedzialna za apoptozę, rozwój naczyń,
a także indukcję odpowiedzi immunologicznej [23].
Dipeptydylopeptydaza-4 (DPP4), będąca egzoproteazą, odgrywa ważną
rolę w procesach fizjologicznych poprzez usuwanie aminokwasów
z N-końcaz wielu peptydów, w tym hormonów, neuropeptydów, chemokin
i mitogennych czynników wzrostu [23].
Niektóre koronawirusy, na przykład atenuowany wirus zakaźnego
zapalenia oskrzeli ptaków (ang. infectious bronchitis virus, IBV), wiążą
cukry, które odgrywają istotną rolę w rozmaitych procesach biologicznych,
takich jak interakcje międzykomórkowe czy w przypadku procesów
związanych z regulacją układu odpornościowego [24].
Niestety powyższe przykłady nie potrafią odpowiedzieć na pytanie
którekoronawirusy są w stanie rozpoznać jakie specyficzne receptory. Nie
znaleziono dotychczas reguły dotyczącej sposobów rozpoznania swoistych
receptorów. Podobne CoVs z tych samych rodzajów potrafią rozpoznawać
różne receptory, np. MERS-CoV i SARS-CoV należą do beta-koronawirusów, ale ich S1CTDs wiążą odpowiednio DPP4 i ACE-2 [25, 26].
Z drugiej strony, niektóre CoVs z różnych rodzajów, są zdolne do
rozpoznawania tego samego receptora, np NL63-CoV należy do alfakoronawirusów, natomiast SARS-CoV należy do beta-koronawirusów.
Jednakże ich S1-CTDs wiążą ACE-2 [27].
2.4. Mechanizmy wnikaniakoronawirusów do komórek
gospodarza
Po związaniu ze specyficznymi receptorami wirusy dochodzą do etapu
fuzji z błoną gospodarza, aby następnie dostarczyć swój genom do komórki
gospodarza.
Istnieją dwie główne drogi infekcji. Pierwszy z nich, pH-niezależny,
zachodzi w przypadku wirusów, otoczonych błoną lipidową, która zawiera
białko fuzyjne. W tym mechanizmie dochodzi do tzw. fuzji otoczki
lipidowej z błoną komórkową komórki docelowej, dzięki czemu wirus
wnika do jej wnętrza. Jednakże, wiele koronawirusówwybieradrugi
z mechanizmów – endocytozę – jako sposób na wniknięcie do komórki
gospodarza. W tym procesie kluczowy etap odbywa się w endosomach,
a cały proces uzależniony jest od niskiego pH. Równie istotne są reakcje
redoks, a także aktywności proteolityczne, aby doszło do zmian
w konformacji białek wirusowych, które w konsekwencji doprowadzą do
fuzji osłonki wirusa i błony komórkowej gospodarza. Taki mechanizm
umożliwia ścisłą kontrolę nad fuzją poprzez ochronę miejsca cięcia przed
przedwczesną proteoliząumożliwiając efektywną reakcję dopiero po
związaniu się z receptorem na komórkach docelowych [28].
31
Joanna Woźniak, Natalia Dereń, Edyta Simińska
Komórkowa endocytozamoże odbywać się zarówno na szlaku klatrynozależnym, kaweolozależnym, jak i również niezależnym od klatryny lub
kaweoli. Wiele badań wykazało natomiast, że wirusy mogą wykorzystać
więcej niż jedną drogę wejścia do komórki gospodarza [29].
3. Podsumowanie
Koronawirusy są jednymi z największych wirusów RNA, które
wykształciły różne mechanizmy wnikania do komórek gospodarza.
Najbardziej kluczową molekułą w tym procesie wydaje się być białko S.
Niemniej istotne jest również białko N, stanowiące cząsteczkę, która
odpowiada za wirulencję. Po rozpoznaniu swoistego receptora przez wirus
następuje fuzja z błoną gospodarza, a następnie dostarczenie genomu
wirusa do komórki gospodarza. Najczęściej odbywa się do na zasadzie
endocytozy klatryno- lub kaweolozależnej, jak i również niezależnej od
klatrynylub kaweoli. Poznanie szczegółowych mechanizmów wnikania
koronawierusów do komórek gospodarza wydaje się kluczowe w celu
projektowania przyszłych strategii skierowanymi przeciwko CoVs.
Literatura
1.
Hamre D., Procknow J. J., A new virus isolated from the human
respiratorytract, Proc SocExpBiol Med., 121: (1966), s. 190-193
2. Perlman S., Netland J., Coronaviruses post-SARS: update on replication
and pathogenesis, Nat Rev Microbiol 7: (2009), s. 439-450
3. Enjuanes L.,Almazan F., Sola I., Zuniga S., Biochemical aspects
of coronavirus replication andvirus-host interaction, Annu. Rev. Microbiol,
60: (2006), s. 211-230.
4. Weiss S. R., Navas-Martin S., Coronavirus pathogenesis and the emerging
pathogen severe acute respiratory syndrome coronavirus, Microbiol. Mol.
Biol. Rev., 69: (2005), s. 635-664
5. Hudson C. B., Beaudette F. R. Infection of the cloaca with the virus
of infectious bronchitis, Science, 76:(1932), s. 34
6. Peiris J. S., Guan Y., Yuen K. Y., Severe acute respiratory syndrome,
Nat Med., 10: (2004), s. 88-97
7. Ziebuhr J., Molecular biology of severe acute respiratory
syndromecoronavirus, Curr. Opin. Microbiol., 7: (2004), s. 412-419
8. http://www.who.int/csr/don/4-december-2015-mers-saudi-arabia/en/
– (04.12.2015)
9. Belouzard S., MilletJ. K., LicitraB. N., Whittaker G. R., Mechanisms
of Coronavirus Cell Entry Mediated by the Viral Spike Protein, Viruses 4:
(2012), s.1011-1033
10. Bosch B. J.,Van der Zee R., de Haan C. A., Rottier P. J., The coronavirus
spike protein is a class I virus fusion protein: Structural and functional
characterization of the fusion core complex, J. Virol.,77: (2003), s. 8801-8811
32
Mechanizmy wnikania koronawirusów do komórek gospodarza
11. Li F., Berardi M., Li W. H., Farzan M., Dormitzer P. R., Harrison S.
C.,Conformational states of the severe acute respiratory syndrome
coronavirus spike protein ectodomain, J.Virol., 80: (2006), s. 6794-6800
12. Casais R., Dove B., Cavanagh D., Britton P., Recombinant Avian Infectious
Bronchitis Virus Expressing a Heterologous Spike Gene Demonstrates that the
Spike Protein Is a Determinant of Cell Tropism, J. Virol., : (2003), s. 9084-9089
13. Hurst K .R., Kuo L., Koetzner C .A., Ye R., Hsue B., Masters P. S., A major
determinant for membrane protein interaction localizes to thecarboxyterminal domain of the mouse coronavirus nucleocapsid protein, J. Virol.,
79: (2005), s. 13285-13297
14. Ye Y., Hauns K., Langland J. O., Jacobs B. L., Hogue B. G.,Mouse
hepatitis coronavirus A59 nucleocapsid protein is a type I interferon
antagonist, J. Virol., 81: (2007), s. 2554-2563
15. Saikatendu K. S., Joseph J. S., Subramanian V., Neuman B. W., Buchmeier
M. J., Stevens R. C., Kuhn P., Ribonucleocapsid formation of severe acute
respiratory syndrome coronavirus through molecular action of the N-terminal
domain of N protein, J. Virol., 81:(2007), s. 3913-3921
16. Cowley T. J., Long S. Y., Weiss S. R, The Murine Coronavirus Nucleocapsid
Gene Is a Determinant of Virulence, J. Virol., (2010), s. 1752-1763
17. Spaan W., Cavanagh D., Horzinek M. C., Coronaviruses: structure and
genome expression, J. Virol., 69: (1988), s. 2939-2952
18. Towler P., Staker B., Prasad S. G., Menon S., Tang J., Parsons T., Ryan D.,
Fisher M., Williams D., Dales N. A., Patane M. A., Pantoliano M. W., ACE2
X-ray structures reveal a large hinge-bending motion important for inhibitor
binding and catalysis, J. Biol. Chem., 279: (2004), s. 17996-18007
19. Keidar S., Kaplan M., Gamliel-Lazarovich A., ACE2 of the heart: from
angiotensin I to angiotensin (1-7), Cardiovasc. Res., 73: (2007), s. 463-469
20. Boehm M., Nabel E. G., Angiotensin-converting enzyme 2–a new cardiac
regulator, N. Engl., J. Med., 347: (2002), s. 1795-1797.
21. Mina-Osorio P.,The moonlighting enzyme CD13: old and new functions to
target, Trends Mol. Med., 14: (2008), s. 361-371
22. Schultze B., Krempl C., Ballesteros M. L., Shaw L., Schauer R., Enjuanes L.,
Herrler G., Transmissible gastroenteritis coronavirus, but not the related
porcine respiratory coronavirus, has a sialic acid (N-glycolylneuraminic acid)
binding activity, J. Virol.,70: (1996), s. 5634-5637
23. Tan K., Zelus B .D., Meijers R., Liu J. H, Bergelson J. M, Duke N., Zhang
R.,Joachimiak A., Holmes K. V., Wang J. H., Crystal structure of murine
sCEACAM1a[1 ,4]: a coronavirus receptor in the CEA family, EMBO J.,
21(9): (2002), s. 2076-2086
24. Ghazarian H., Idoni B., Oppenheimer S., A glycobiology review:
Carbohydrates, lectins and implications in cancer therapeutics,
ActaHistochemica, 113:(2011),s. 236-247
25. Raj V. S., Mou H., Smits S. L., Dekkers D. H., Müller M. A., Dijkman R.,
Muth D., Demmers J. A., Zaki A., Fouchier R. A., Thiel V., Drosten C.,
Rottier P. J., Osterhaus A. D., Bosch B. J., Haagmans B. L.,Dipeptidyl
33
Joanna Woźniak, Natalia Dereń, Edyta Simińska
26.
27.
28.
29.
peptidase 4 is a functional receptor for the emerging human coronavirusEMC,Nature,14: (2013),s. 251-254
Mou H., Raj V. S., Van Kuppeveld F. J., Rottier P. J., Haagmans B. L., Bosch
B. J., The receptor binding domain of the new Middle East respiratory
syndrome coronavirus maps to a 231-residue region in the spike protein that
efficiently elicits neutralizing antibodies, J.Virol.,87: (2013), s. 9379-9383
Lin H. X., Feng Y., Wong G., Wang L., Li B., Zhao X., Li Y., Smaill F.,
Zhang C.,Identification of residues in the receptor-binding domain (RBD)
of the spike protein of human coronavirus NL63 that are critical for the RBDACE2 receptor interaction, J. Virol.,89: (2008), s. 1015-1024
Burkard C., Verheije M. H., Wicht O., Van Kasteren S. I., Van Kuppeveld F.
J., Haagmans B. L., Pelkmans L., Rottier P. J., Bosch B. J., De HaanC.
A.,Coronavirus cell entry occurs through the endo-/lysosomal pathway
in a proteolysis-dependent manner,PLoSPathog.,6: (2014), s. 1004502
Wang H., Yang P., Liu K., Guo F., Zhang Y., Zhang G., Jiang C., SARS
coronavirus entry into host cells through a novel clathrin- and caveolaeindependent endocytic pathway, Cell Res., 18: (2008), s. 290-301
Mechanizmy wnikania koronawirusów do komórek gospodarza
Pierwsze doniesienia o koronawirusach sięgają lat 60’tych XIX wieku. Koronawirusy
(ang. Coronaviruses, CoVs) należą do jednych z większych wirusów RNA pod względem
wirionu oraz genomu, którego wielkość waha się od 80 do 120nm. Najbardziej znanym
koronawirusem jest SARS-CoV, który na przełomielat 2002-2003 spowodował prawie 8 tysięcy
zakażeń, ze wskaźnikiem śmiertelności blisko 10%. Kolejnym równie niebezpiecznym wirusem
jest MERS, którym dotychczas zostało zarażone ponad 1,5 tysiąca osób ze wskaźnikiem
śmiertelności o ok.36%. Białko S odgrywa niezwykle ważną rolę w procesie wnikania
koronawirusa do komórki gospodarza. Infekcja wywoływana jest przez składowe wirusa, które
wchodzą w interakcję z białkami gospodarza na błonie komórkowej. Dochodzi następnie do
wiązania ze swoistym receptorem, a następnie do wnikania wirusowego nukleokapsydu.
Zrozumienie mechanizmów rozpoznawania receptora przez CoVs wydaje się być kluczowe dla
badań nad lekami skierowanymi przeciwko koronawirusom.
Mechanisms of coronaviruses entry into host cells
The first report of the coronavirus is from 1960. Coronaviruses (CoVs) are RNA viruses, whose
size ranges from 80 to 120nm. The best known coronavirus is SARS-CoV, which infects in 20022003 almost 8,000 people, with a mortality rate up to 10%. Another dangerous virus is MERS,
which has infected more than 1,500 people with a mortality rate of approximately 36%. The S
protein plays an extremely important role in the fusion of the coronavirus into the host cell. The
infection is caused by a virus components that interact with proteins of the host cell membrane.
Subsequently it leads to bind with a specific receptor, and finally to the fusion of the viral
nucleocapsid. Understanding the mechanisms of receptor recognition by CoVs seems to be
essential for the studies about drugs directed against coronaviruses.
34
Maciej Gawroński1, Arkadiusz Goede2, Tomasz Wandtke-3
Wirusy onkolityczne
jako potencjalna alternatywa
w leczeniu nowotworów złośliwych
1. Wstęp
Choroby nowotworowe stanowią obecnie jedno z największych zagrożeń
dla zdrowia człowieka w wysoce rozwiniętych krajach Europy i w Stanach
Zjednoczonych. Głównymi przyczynami takiego stanu rzeczy są: ciągle
wydłużający się średni czas życia, zarówno wśród kobiet, jak i mężczyzn,
postępujące zanieczyszczenie środowiska naturalnego substancjami
o potencjale kancerogennym, zwiększona ekspozycja na promieniowanie
jonizujące, dieta ubogo-resztkowa, bogata w tłuszcze nasycone i kancerogenne
produkty powstające w wyniku termicznej obróbki pokarmu, jak również
niepohamowane spożycie napojów alkoholowych, konsumpcja produktów
tytoniowych (głownie papierosów, cygar, cygaretek, palenie fajki, zażywanie
tabaki i żucie liści tytoniowych) i niewystarczająca aktywność fizyczna. Części
z wymienionych powyżej czynników można oczywiście uniknąć prowadząc
tzw. „zdrowy styl życia”, nie zmienia to jednak faktu, iż ekspozycja na
kancerogeny środowiskowe i promieniowanie jonizujące z roku na rok jest
coraz większa, a dłuższy średni czas życia, będący paradoksalnie rezultatem
postępu w medycynie i naukach pokrewnych, sprzyja akumulacji mutacji
somatycznych, a co za tym idzie przekłada się na zwiększoną częstotliwość
zachorowań na nowotwory w wysoce rozwiniętych, zachodnich społeczeństwach [1].
Dlatego też profilaktyka i leczenie chorób nowotworowych są obecnie
jednym z największych wyzwań, przed jakimi stoi współczesna medycyna.
Szczególnie duży nacisk kładzie się na badania naukowe, których celem jest
opracowanie nowych, bardzo często spersonalizowanych, technik
terapeutycznych, które wykorzystując najnowsze zdobycze biologii mole1
[email protected], Studenckie Koło Naukowe Terapii Genowej, Zakład Genoterapii,
Wydział Lekarski, Uniwersytet Mikołaja Kopernika, Collegium Medicum im. Ludwika
Rydygiera w Bydgoszczy, http://www.cm.umk.pl
2
[email protected], Zakład Genoterapii, Wydział Lekarski, Uniwersytet Mikołaja
Kopernika, Collegium Medicum im. Ludwika Rydygiera w Bydgoszczy, http://www.cm.umk.pl
3
[email protected]; Zakład Genoterapii, Wydział Lekarski, Uniwersytet Mikołaja
Kopernika, Collegium Medicum im. Ludwika Rydygiera w Bydgoszczy, http://www.cm.umk.pl
35
Maciej Gawroński, Arkadiusz Goede, Tomasz Wandtke
kularnej, genetyki, biochemii, bioinformatyki, metabolomiki, czy też
inżynierii tkankowej i genetycznej, stanowiłyby alternatywę dla obecnie
stosowanych metod leczenia nowotworów złośliwych. Jest to niezwykle
istotne, gdyż standardowe terapie bardzo często okazują się mało
skuteczne, wykazują niską specyficzność względem komórek nowotworowych, a także generują szereg skutków ubocznych, do których
możemy zaliczyć między innymi: indukowanie nowotworów wtórnych,
bezpłodność, zaburzenia w funkcjonowaniu układu immunologicznego,
a w konsekwencji częste zakażenia bakteryjne i wirusowe, zaburzenia
w funkcjonowaniu narządów (np. nefropatia, niewydolność mięśnia
sercowego), wymioty, utratę włosów. Wymienione wyżej skutki uboczne
mogą być równie groźne dla życia i zdrowia pacjenta, co choroba nowotworowa, którą próbuje się wyleczyć. Co więcej, ich leczenie generuje
dodatkowe koszty, co ma istotne znaczenie w skali systemów ochrony
zdrowia danego kraju [2].
Nie dziwi zatem fakt, iż przy poszukiwaniu nowych metod walki
z nowotworami, naukowcy sięgają po rozwiązania kontrowersyjne
i nieszablonowe. Takim właśnie podejściem jest wykorzystanie tzw.
wirusów onkolitycznych, które zostaną pokrótce omówione w niniejszej
pracy.
2. Wirusy onkolityczne
U podstaw idei wykorzystania wirusów jako narzędzia do niszczenia
komórek nowotworowych leży ich ewolucyjnie nabyta zdolność do
infekowania komórek eukariotycznych, namnażania się w nich, jak również
zdolność do ich lizy, która umożliwia rozprzestrzenianie się cząsteczek
wirusa w zainfekowanej tkance. Jednakże główną przeszkodą, jaka stała na
drodze wykorzystania tych cech wirusów w celach terapeutycznych był
fakt, iż wirusy infekują zarówno komórki zdrowe, jak i komórki zmienione
nowotworowo, a zatem nie wykazują specyficzności lizy zainfekowanych
komórek [3].
Rozwiązanie tego problemu nadeszło wraz z rozwojem technik
inżynierii genetycznej, dzięki którym udało się poznać funkcję i sekwencję
genów tworzących genom poszczególnych wirusów. Szczególnie istotnym,
z punktu widzenia przyszłych zastosowań wirusów onkolitycznych, było
poznanie molekularnych mechanizmów stojących za procesem ich
replikacji w komórkach eukariotycznych, jak również mechanizmów
warunkujących proces infekowania i lizy komórek. Dzięki genetycznym
modyfikacjom poszczególnych genów stworzono pierwsze wirusy
onkolityczne (OV, ang. oncolitic viruses), czyli takie, które mogą namnażać się jedynie w komórkach zmienionych nowotworowo [3, 4].
36
Wirusy onkolityczne jako potencjalna alternatywa w leczeniu nowotworów złośliwych
Takie właściwości omawianych cząsteczek można uzyskać na kilka
sposobów. Pierwszym z nich jest usunięcie genów koniecznych do
replikacji wirusa w prawidłowych komórkach. Zazwyczaj geny te
odpowiedzialne są za inaktywację genów supresorowych, które hamują
cykl komórkowy (np. gen p53, czy RB), lub warunkują syntezę substratów
niezbędnych do replikacji wirusa. Modyfikacje genetyczne obejmujące
usunięcie z genomu wyżej wymienionych genów skutkują tym, iż
zmodyfikowany wirus zdolny jest do namnażania się jedynie w komórkach
posiadających jakiś defekt genetyczny (np. brak aktywności białka p53
stwierdza się w większości komórek nowotworowych) [4, 5].
Drugim sposobem jest podmiana promotora genu wirusowego
promotorem tkankowo specyficznym. W tym przypadku wirus jest zdolny
do namnażania się tylko w komórkach tkanek, w których występują
odpowiednie czynniki transkrypcyjne. Szczególną odmianą tej metody jest
wykorzystanie promotorów, które ulegają aktywacji tylko i wyłącznie
w komórkach charakteryzujących się odpowiednim stanem. Doskonałym
przykładem takiej strategii jest wykorzystanie promotora dla czynnika
drugiego indukowanego stanem hipoksji (HIF-2, ang. hipoxia inducible
factor-2), dzięki któremu cząsteczki wirusa mogą replikować się tylko
w komórkach niedotlenionych, a właśnie do takich należą komórki
nowotworowe [4‚7].
Trzecia metoda opiera się na modyfikacji genów odpowiedzialnych za
zdolność do infekowania komórek w taki sposób, by cząsteczki wirusa
wykazywały znacznie większy tropizm do komórek nowotworowych, niż
do komórek prawidłowych. Ma to szczególne znaczenie w przypadku
wirusów, które mogą infekować komórki różnych tkanek, a chcemy je
wykorzystać jedynie do niszczenia komórek nowotworowych wywodzących się z jednej z nich [8].
Wartym odnotowania jest także fakt, iż modyfikacje genetyczne
wirusów onkolitycznych nie ograniczają się jedynie do genów odpowiedzialnych za infekcję, replikację i lizę komórek nowotworowych.
Bardzo często do genomu wirusowego wprowadzane są tzw. „geny samobójcze”. Zazwyczaj są to geny kodujące enzymy, które standardowo nie
występują w docelowej tkance. Posiadają one zdolność do enzymatycznego
przekształcania bezpiecznych, nieaktywnych substancji, zwanych
prolekami, do form cytotoksycznych. Dzięki tej modyfikacji komórki
nowotworowe nabywają nową cechę, dzięki której po ogólnoustrojowym
podaniu bezpiecznego proleku, efekt cytotoksyczny zostaje ograniczony
jedynie do komórek zainfekowanych wirusem onkolitycznym. Takie
podejście pozwala na uniknięcie ogólnoustrojowych skutków ubocznych,
charakterystycznych dla standardowych terapii. Do najczęściej wykorzystywanych genów samobójczych należą: gen kinazy tymidynowej (TK,
37
Maciej Gawroński, Arkadiusz Goede, Tomasz Wandtke
ang. thymidine kinase), deaminaza cytozyny (CDA, ang. cytosine
deaminase), fosforybozylotransferaza uracylu (UPRT, ang. uracil
phosphoribosyltransferase), fosforylaza nukleozydu purynowego (PNP,
ang. purine nucleoside phosphorylase), czy też geny cytochromu p450
(np. CYP2B1 warunkujący przemiany cyklofosfamidu) [9‚12].
W ten sposób, dzięki modyfikacjom genetycznym otrzymuje się cząsteczki,
które nie tylko w sposób selektywny infekują komórki nowotworowe,
namnażają się w nich i doprowadzają do ich lizy, ale także uwrażliwiają
zainfekowane komórki na standardowo stosowane chemioterapeutyki takie jak
5-fluorouracyl, cyklofosfamid, czy 2-fluoroadenina i gancyklowir. Co więcej,
komórki nowotworowe po infekcji wirusem onkolitycznym zaczynają
eksprymować na swojej powierzchni cząsteczki głównego układu zgodności
tkankowej klasy I (MHC I, ang. major histocompatibility complex class I),
przez co wracają pod nadzór układu immunologicznego – mogą zostać rozpoznane przez limfocyty cytotoksyczne CD8+ (Tc) i usunięte z organizmu [13].
Łatwość z jaką można manipulować genomem wirusowym sprawiła, iż
badacze opracowali szereg wirusów onkolitycznych, które bazowały na
wirusach różnego typu. Obecnie, do najczęściej stosowanych OV należą
adenenowirusy, zmodyfikowane wirusy opryszczki, rabdowirusy, reowirusy,
czy też wirus odry. W dalszej części pracy pokrótce omówione zostaną
poszczególne wirusy onkolityczne, należące do wyżej wymienionych grup.
2.1. Adenowirusy
Do najczęściej stosowanych wirusów onkolitycznych należą zmodyfikowane genetycznie adenowirusy. Są to relatywnie małe cząsteczki,
o symetrii ikosaedralnej, zawierające podwójną nić DNA o długości około
36 tysięcy par zasad. Powstało wiele różnych modyfikacji adenowirusów,
które pozwoliły na uzyskanie specyficzności względem komórek nowotworowych. Pierwszym przykładem jest wirus ONYX-015, występujący
także pod nazwami dl1520 lub CI-1042, w którym dokonano delecji genu
E1B. Produkt białkowy tego genu jest odpowiedzialny za inaktywację
białka p53 w prawidłowych komórkach, dzięki czemu, podczas infekcji
wirusowej cykl komórkowy nie zostaje zatrzymany, a sam wirus może
replikować. Pozbawienie wirusa genu E1B sprawia, iż może on replikować
jedynie w komórkach z nieaktywnym białkiem p53, a jak powszechnie
wiadomo zaburzenia w funkcjonowaniu tego białka należą do jednych
z najczęstszych defektów genetycznych, jakie znajduje się w komórkach
nowotworowych. Badania kliniczne II fazy potwierdziły bezpieczeństwo
stosowania tego wirusa w przypadku nowotworów głowy i szyi,
w szczególności zauważono całkowitą remisję choroby u 10% chorych
poddanych leczeniu, natomiast u 62% badanych udało się zahamować
38
Wirusy onkolityczne jako potencjalna alternatywa w leczeniu nowotworów złośliwych
rozwój choroby [14]. Co więcej, wykazano efekt synergii w przypadku
zastosowania terapii wirusowej w połączeniu z radioterapią. Połączenie to
skutkowało znaczącym zmniejszeniem tkanki guzów litych w porównaniu
do zastosowania pojedynczej terapii wirusem lub samej radioterapii [15].
Wykazano także podobną synergię dla połączenia terapii wirusowej
z wykorzystaniem ONYX-015 i chemioterapii [16] Wyniki te sprawiły, iż
obecnie ONYX-015 trafił do III fazy badań klinicznych w leczeniu
nowotworów głowy i szyi.
Jednakże wykorzystanie omawianego wyżej wirusa onkolitycznego,
z racji wprowadzonych modyfikacji, zostało ograniczone do komórek
z nieaktywnym białkiem p53, a co za tym idzie, nie może być on
zastosowany do leczenia komórek nowotworowych z funkcjonującym p53,
ale z zaburzeniami w funkcjonowaniu innych genów. Dlatego tez
stworzono inne wirusy, które zostały pozbawione innego genu warunkującego replikację, mianowicie E1A, odpowiedzialnego za inaktywację
białka RB. Ad5Delta24 jest takim wirusem, znalazł on zastosowanie
w leczeniu glejaków, gdzie jego zastosowanie iv vivo skutkowało znaczącym zmniejszeniem masy guzów [17]. Natomiast w przypadku wirusa
AxdAdB-3 dokonano delecji zarówno genu E1A, jak i E1B, co przełożyło
się na jego wysoką skuteczność w leczeniu nowotworów posiadających
mutacje zarówno w genie p53, jak i RB, takich jak rak woreczka
żółciowego czy rak trzustki. Co więcej, taka modyfikacja skutkuje
znacznym spadkiem toksyczności tego wirusa względem komórek
prawidłowych, w porównaniu z wirusem ONYX-015 [18, 19]. W podobny
sposób stworzono więcej wirusów zdolnych do namnażania się
w komórkach z defektywnym RB np. wirusy Ar6pAE2fF i Ar6pAE2fE3F,
m. in. z nieaktywnym promotorem dla E1A [20].
Innym przykładem zastosowania zmodyfikowanych adenowirusów są
próby leczenia raka prostaty, który jest atrakcyjnym celem dla takiej terapii
ze względu na łatwy dostęp do zmienionej nowotworowo tkanki, którą
można nastrzyknąć roztworem zawierającym wysokie stężenie cząsteczek
wirusa. Doskonałym przykładem takiego postępowania jest wirus CV787,
w którym promotor dla genu E1B wymieniono na promotor specyficznego
antygenu prostaty (PSA, ang. prostate specific antygen), natomiast
promotor genu E1A został wymieniony na promotor PSRP (ang. prostatespecific rat probasin promoter). Dzięki tym modyfikacjom wirus może
replikować jedynie w komórkach raka prostaty. Co więcej, terapia
wirusowa z jego zastosowaniem wykazuje synergię z chemioterapią
docetakselem i paklitakselem. W związku z tym wirus CV787 trafił do II
fazy badań klinicznych leczenia nowotworu prostaty [21, 22].
Innymi przykładami użycia nowotworowo specyficznych promotorów
jest adenowirus TRAD, w którym geny E1A i E1B podpięto pod gen
39
Maciej Gawroński, Arkadiusz Goede, Tomasz Wandtke
ludzkiej telomerazy – enzymu, który jest aktywny w większości komórek
nowotworowych. Podobne strategie wykorzystano w przypadku adenowirusów skierowanych przeciwko komórkom czerniaka, raka wątrobokomórkowego, raka piersi [7], czy raka jajnika opornego na chemioterapię
(wektor Ad5/3MDR1E1) [23].
2.2. Wirus opryszczki (Herpes Simplex Virus)
HSV jest wirusem równie często stosowanym w terapii wirusowej, jak
adenowirusy, przy czym posiada pewną przewagę ze względu na znacznie
większy rozmiar cząsteczki dwuniciowego DNA (około 150 kpz), co sprawia,
iż w większym stopniu można modyfikować jego genom. Główne
modyfikacje tego wirusa polegają na wyeliminowaniu jego zdolności do
namnażania się w komórkach prawidłowych. Obejmują one delecję genu dla
reduktazy rybonukleotydów, genu kinazy tymidynowej, czy też czynnika
wirulencji γ134.5. Reduktaza rybonukleotydów odgrywa kluczową rolę
w syntezie deoksyrybonukleotydów, koniecznych do syntezy DNA – jej
wysoki poziom jest charakterystyczny dla komórek szybko proliferujących,
jest jej zaś mniej w komórkach w stanie spoczynku. Usunięcie genu UL39
kodującego dużą podjednostkę reduktazy rybonukleotydów powoduje, iż tak
zmodyfikowany wirus może replikować jedynie w komórkach dzielących się,
a do takich należą komórki nowotworowe. Brak genu kinazy tymidynowej
uzależnia replikację wirusa od obecności tego enzymu w genomie infekowanej
komórki, a obecność ta jest również charakterystyczna dla komórek dzielących
się. Te cechy, w połączeniu z naturalnym neurotropizmem sprawiły, iż tak
zmodyfikowane wirusy znalazły zastosowanie w próbach leczenia
nowotworów mózgu, gdyż prawidłowe neurony, jako komórki niedzielące się,
są oszczędzane przez tak zaprojektowane OV, natomiast komórki zmienione
nowotworowo, dzielące się, ulegają zniszczeniu [24‚27].
Stworzono także szereg wirusów zawierających w swojej budowie geny,
których celem, oprócz lizy komórek nowotworowych, była stymulacja układu
immunologicznego. Zawierały one m.in. gen dla czynnika stymulującego
tworzenie kolonii granulocytów i makrofagów (GM-CSF) [28], geny
interleukiny 2 i 12 [29, 30] – efektem działania tych cytokin jest wywołanie
polaryzacji immunologicznej w stronę odpowiedzi komórkowej, kluczowej
z punktu widzenia terapii antynowotworowej.
Ciekawym przykładem ogromnych modyfikacji, jakich można dokonać
w wirusie opryszczki jest wirus rRp450. Posiada on delecję genu UL39, jak
również szczurzy gen cytochromu P450, dzięki czemu jest on zdolny do
enzymatycznej aktywacji cyklofosfamidu do formy cytotoksycznej, co
przekłada się na uwrażliwienie komórek na ten lek i lepszy efekt
terapeutyczny [31]. Co więcej, w tym przypadku wirus posiada gen kinazy
40
Wirusy onkolityczne jako potencjalna alternatywa w leczeniu nowotworów złośliwych
tymidynowej, przez co zainfekowane komórki są również uwrażliwione na
gancyklowir. Warto także zaznaczyć, iż podanie gancyklowiru i jego
aktywacja w zainfekowanych komórkach skutkuje ich apoptozą, a co za
tym idzie hamuje replikacje wirusa. Zatem podanie gancyklowiru można
uważać za tzw. ”hamulec bezpieczeństwa” w razie niekontrolowanego
rozprzestrzeniania się wirusa w organizmie, a także poprzez jego podanie
uzyskuje się silną synergię działania z cyklofosfamidem, jak i samym
działaniem litycznym wirusa [32]. Wykazano skuteczność terapii
wirusowej z wykorzystaniem rRp450 w próbach leczenia raka okrężnicy
i wątroby [33, 34].
2.3. Reowirusy
Wirusy te są od niedawna w polu zainteresowania terapii onkolitycznej,
gdyż swoje właściwości lityczne wykazują jedynie w komórkach
z nadaktywnym białkiem Ras, odpowiedzialnym za przekazywanie
sygnałów z receptorów na powierzchni komórek (np. EGFR, receptor dla
naskórkowego czynnika wzrostu, ang. epidermal growth factor receptor)
do jądra komórkowego [35]. W komórkach prawidłowych dwuniciowy
RNA, który stanowi materiał genetyczny reowirusów, aktywuje kinazę
PKR, która w efekcie blokuje czynnik eIF2α (ang. eukaryotic initiation
factor 2α), konieczny do replikacji wirusa. Jednakże w komórkach
z nadekspresją Ras, aktywność omawianej wyżej kinazy jest zahamowana,
a co za tym idzie możliwe jest wejście wirusa w fazę lityczną.
Zastosowanie reowirusów wydaje się bardzo atrakcyjne, gdyż około 30%
nowotworów posiada nadaktywność białka Ras, a także zaburzenia
w funkcjonowaniu układu EGF/EGFR [36].
Wykazano onkolityczną aktywność reowirusów w przypadku modelu
nowotworu pęcherza moczowego. Co więcej, wirusy te trafiły do badań
klinicznych I fazy (glejaki) [37] i II fazy (przerzuty mięsaków tkanek
miękkich do płuc) [38]. Podejmuje się także próby ich wykorzystania
w leczeniu raka jajnika, jelita grubego, czerniaków, czy medulloblastomy
[39, 40, 41].
3. Podsumowanie
Wirusy onkolityczne to potężne i wysoce wyrafinowane narzędzie do
walki z nowotworami. Dzięki dogłębnemu poznaniu genomów wirusowych
i zrozumieniu molekularnych mechanizmów, jakie stoją za procesami
replikacji poszczególnych wirusów, możliwym stało się modyfikowanie ich
genów w taki sposób, by uzyskać niezwykle specyficzne cząsteczki, zdolne
do selektywnego niszczenia komórek nowotworowych. Ich główną zaletą
jest fakt, iż w przeciwieństwie do standardowych strategii terapeutycznych,
41
Maciej Gawroński, Arkadiusz Goede, Tomasz Wandtke
generują znacznie mniejsze skutki uboczne, a w połączeniu z wspomnianymi strategiami wykazują efekt synergii, co znacząco podnosi
skuteczność leczenia. Ich wykorzystanie jest także relatywnie tanią metodą,
gdyż o ile same badania prowadzące do stworzenia wirusa onkolitycznego
są bardzo kosztowne, o tyle jego późniejsza synteza generuje niewielkie
koszty. Warto także nadmienić, iż zastosowanie wirusów onkolitycznych
jest metodą bezpieczną, gdyż ich aktywność ogranicza się do komórek
nowotworowych. Co więcej w przypadku nadmiernego rozprzestrzenienia
się w organizmie, cząsteczki wirusów są naturalnie usuwane przez komórki
układu immunologicznego. Ponadto w razie konieczności możliwym jest
podanie pacjentowi leków anty-wirusowych, które zapobiegną ich
nadmiernemu rozprzestrzenianiu się. Z drugiej strony aktywność układu
immunologicznego pełni rolę „obosiecznego miecza’ i może zmniejszać
aktywność omawianych cząsteczek. Dlatego też duża część z obecnie
prowadzonych badań skupia się na polepszeniu specyficzności wirusów
onkolitycznych, obniżeniu ich immunogenności, jeszcze większej poprawie
bezpieczeństwa stosowania, wzmocnieniu efektu onkolitycznego, jak
również na wprowadzaniu dodatkowych modyfikacji, zwiększających ich
potencjał terapeutyczny. Warto także nadmienić, iż wiele z omawianych
w niniejszej pracy wirusów trafiło do II, a nawet do III fazy badań
klinicznych, tak więc wydaje się, iż w niedalekiej przyszłości mogą one
stać się uzupełnieniem rutynowego postępowania terapeutycznego
w leczeniu nowotworów złośliwych, a w dalszej perspektywie być może
zastąpić standardowo stosowane strategie leczenia.
Literatura
1.
2.
3.
4.
5.
6.
7.
Kułakowski A., Skowrońska-Gardas A., Onkologia Podręcznik dla studentów
medycyny, Wydawnictwo Lekarskie PZWL., (2003),s. 10-150
Meder J., Podstawy onkologii klinicznej, Centrum Medyczne Kształcenia
Podyplomowego., (2011), s. 5-260
He S., Li P., Chen C. H., Bakst R. L., Chernichenko N., Yu Y.A, et al.
Effective oncolytic vaccinia therapy for human sarcomas, Journal of Surgical
Research., 2 (2012), s.53-60
Wong H. H., Lemoine N. R., Wang Y., Oncolytic viruses for cancer therapy:
Overcoming the obstacles, Viruses., 2 (2010), s. 78-106
Prestwich R. J., Errington F., Harrington K. J., Pandha H. S., Selby P.,
Melcher A., Oncolytic viruses: do they have a role in anti-cancer therapy?,
Clinical Medicine. Oncology., 2 (2008), s. 83-96
Russell S. J., Peng K. W., Bell J. C., Oncolytic virotherapy, Nature
Biotechnology., 7 (2012), s. 658-670
Zeyaullah M., Patro M., Ahmad I., Ibraheem K., Sultan P., Nehal M., et al.,
Oncolytic viruses in the treatment of cancer: a review of current strategies,
Pathology and Oncology Research., 4 (2012), s.771-781
42
Wirusy onkolityczne jako potencjalna alternatywa w leczeniu nowotworów złośliwych
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
Verheije M. H., Rottier P. J. Retargeting of viruses to generate oncolytic
agents, Advances in Virology 2012 (2012),
http://dx.doi.org/10.1155/2012/798526
Thirukkumaran C. M., Morris D. G. Oncolytic virotherapy for multiple
myeloma: past, present, and future, Bone Marrow Research., 2011 (2011),
http://dx.doi.org/10.1155/2011/632948
Tai C .K., Wang W., Lai Y. H., Logg C. R., Parker W. B., Li Y. F., Hong J. S.,
Sorscher E. J., Chen T. C., Kasahara N. Enhanced efficiency of prodrug
activation therapy by tumor-selective replicating retrovirus vectors armed
with the escherichia coli purine nucleoside phosphorylase gene, Cancer Gene
Therapy., 17 (2010), s. 614-623
Bharara S., Sorscher E. J., Gillespie G. Y., Lindsey J. R., Hong J. S., Curlee K.
V., Allan P. W., Gadi V. K., Alexander S. A., Secrist J. A, Parker W. B.,
Waud W. R., Antibiotic-Mediated Chemoprotection Enhances Adaptation
of E. coli PNP for Herpes Simplex Virus-Based Glioma Therapy, Human Gene
Therapy., 3 (2005), s. 339-347
Wei M. X., Tamiya T., Chase M., Boviatsis E. J., Chang T. K., Kowall N. W.,
Hochberg F. H., Waxman D. J., Breakefield X. O., Chiocca E. A.,
Experimental tumor therapy in mice using the cyclophosphamide-activating
cytochrome P450 2B1 gene, Human Gene Therapy., 8 (1994), s. 969-78
Mahoney D. J, Stojdl D. F. Molecular pathways: multimodal cancer-killing
mechanisms employed by oncolytic vesiculoviruses, Clinical Cancer Research.,
19 (2013), s.758-763
Nemunaitis J., Khuri F., Ganly I., Arseneau J., Posner M., Vokes E., Kuhn J.,
McCarty T., Landers S., Blackburn A., Romel L., Randlev B., Kaye S., Kirn
D. Phase II trial of intratumoral administration of ONYX-015, a replicationselective adenovirus, in patients with refractory head and neck cancer, Journal
of Clinical Oncology., 2 (2001), s. 289-29
Kenneth R. Rogulski K. R., Freytag S. O., Zhang K., Gilbert J. D., Paielli D.
L., Kim J. H., Heise C. C., Kirn D. H., In Vivo Antitumor Activity of ONYX015 Is Influenced by p53 Status and Is Augmented by Radiotherapy, Cancer
Research., 60 (2000), s.1193-119
Galanis E., Okuno S. H., Nascimento A. G., et al., Phase I-II trial of ONYX015 in combination with MAP chemotherapy in patients with advanced
sarcomas, Gene Therapy., 5 (2005), s.437-445
Juan-Fueyo J., Gomez-Manzano C., Alemany R., Lee P. S. Y., McDonnell T.
J., MitliangaP., Shi Y., Levin V. A., Yung A. W. K., Kyritsis A. P. A mutant
oncolytic adenovirus targeting the Rb pathway produces anti-glioma effect in
vivo, Oncogene., 1 (2000), s. 2-12
Fukuda K., Abei M., Ugai H., et al., E1A, E1B double-restricted adenovirus
for oncolytic gene therapy of gallbladder cancer, Cancer Research., 63 (2003),
s. 4434-4440
Sunamura M., Hamada H., Motoi F., et al., Oncolytic virotherapy as a novel
strategy for pancreatic cancer, Pancreas., 3 (2004), s. 326-329
Jakubczak J. L., Ryan P., Gorziglia M., et al. An oncolytic adenovirus selective
for retinoblastoma tumor suppressor protein pathway-defective tumors:
43
Maciej Gawroński, Arkadiusz Goede, Tomasz Wandtke
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
dependence on E1A, the E2F-1 promoter, and viral replication for selectivity
and efficacy, Cancer Research., 63 (2003), s. 1490-1499
Yu D. C., Chen Y., Seng M., Dilley J., Henderson D. R. The addition
of adenovirus type 5 region E3 enables calydon virus 787 to eliminate distant
prostate tumor xenografts, Cancer Research., 59 (2000), s. 4000-4003
Yu D. C, Chan Y., Dilley J., et al., Antitumor synergy of CV787, a prostate
cancer-specific adenovirus, and paclitaxel and docetaxel, Cancer Research.,
61 (2001), s. 517-25
Gooding L. R., Regulation of TNF-mediated cell death and inflammation by
human adenoviruses, Infectious Agents and Diseases., 3 (1994), s. 106-115
Shen Y., Nemunaitis J. Herpes simplex virus 1 (HSV-1) for cancer treatment,
Cancer Gene Therapy., 11 (2006), s. 975-992
Mineta T., Rabkin S. D., Martuza R. L., Treatment of malignant gliomas using
ganciclovir-hypersensitive, ribonucleotide reductase-deficient herpes simplex
viral mutant, Cancer Research.,54 (1994), s. 3963-3966
Langelier Y., Champoux L., Hamel M., et al., The R1 subunit of herpes
simplex virus ribonucleotide reductase is a good substrate for host cell protein
kinases but is not itself a protein kinase, The Journal of Biological Chemistry.,
3 (1998),s. 1435-1443
Sanders P. G., Wilkie N. M.,. Davison A. J., Thymidine kinase deletion
mutants of herpes simplex virus type 1, Journal of General Virology.,
63 (1982), s. 277-295
Wong R. J., Patel S. G., Kim S. H. etal., Cytokine gene transfer enhances
herpes oncolytic therapy in murine squamous cell carcinoma, Human Gene
Therapy., 3 (2001), s. 253-265
Carew J. F., Kooby D. A., Halterman M. W., Kim S. H., Federoff H. J., Fong
Y., A novel approach to cancer therapy using an oncolytic herpes virus to
package amplicons containing cytokine genes, Molecular Therapy., 3 (2001),
s. 250-256
Toda M., Martuza R .L, Kojima H., Rabkin S. D., In situ cancer vaccination:
an IL-12 defective vector/replicationcompetent herpes simplex virus
combination induces local and systemic antitumor activity, Journal
of Immunology., 9 (1998), s.4457-4464
Pawlik T. M., Nakamura H., Yoon S. S., et al., Oncolysis of diffuse
hepatocellular carcinoma by intravascular administration of a replicationcompetent, genetically engineered herpesvirus, Cancer Research., 60 (2000),
s. 2790-2795
Yoon S. S., Carroll N. M., Chiocca E. A., Tanabe K. K. Cancer gene therapy
using a replication- competent herpes simplex virus type 1 vector, Annals
of Surgery., 3 (1998), s. 366-374
Aghi M., Chou T. C., Suling K., Breakefield X. O., Chiocca E. A. Multimodal
cancer treatment mediated by a replicating oncolytic virus that delivers the
oxazaphosphorine/rat cytochrome P450 2B1 and ganciclovir/herpes simplex
virus thymidine kinase gene therapies, Cancer Research., 59 (1999), s. 3861-3865
44
Wirusy onkolityczne jako potencjalna alternatywa w leczeniu nowotworów złośliwych
34. Pawlik T. M., Nakamura H., Mullen J. T., et al., Prodrug bioactivation and
oncolysis of diffuse liver metastases by a herpes simplex virus 1 mutant that
expresses the CYP2B1 transgene, Cancer., 5 (2002), s. 1171-1181
35. Coffey M. C., Strong J. E., Forsyth P. A., Lee P. W. K. Reovirus therapy
of tumors with activated Ras pathway, Science., 5392 (1998), s. 1332-1334
36. Bos J .L., Ras Oncogenes in human cancer: a review, Cancer Research.,
49 (1989), s. 4682-4689
37. Forsyth P., Rold G., George D., et al., A phase I trial of intratumoral
administration of reovirus in patients with histologically confirmed recurrent
malignant gliomas, Molecular Therapy., 3 (2008), s. 627-632
38. Soefje S. A., Sarantopoulos J., Sankhala K. K., et al., A phase II study
of intravenous reolysin (wild-type reovirus) in the treatment of patients with
bone and soft tissue sarcomas metastatic to the lung, Journal of Clinical
Oncology., 26 (2008), supplement, abstract 10568
39. Hirasawa K., Nishikawa S. G., Norman K. L., Alain T., Kossakowska A., Lee
P. W. Oncolytic reovirus against ovarian and colon cancer, Cancer Research
62 (2002), s. 1696-1701
40. Jansen B., Schlagbauer-Wadl H., Kahr H., et al., Novel Ras antagonist blocks
human melanoma growth, Proceedings of the National Academy of Sciences
of the United States of America., 24.(1999), s. 14019-14024
41. Yang W. Q., Senger D., Muzik H., et al., Reovirus prolongs survival
and reduces the frequency of spinal and leptomeningeal metastases from
medulloblastoma. Cancer Research 63 (2003), s. 3162-3172
Wirusy onkolityczne jako potencjalna alternatywa w leczeniu
nowotworów złośliwych
Dynamiczny rozwój medycyny, biologii molekularnej i inżynierii genetycznej nie rozwiązał jak
dotąd problemu zachorowań na nowotwory złośliwe, które są jednym z największych wyzwań
współczesnej nauki. Co więcej, obecnie stosowane terapie leczenia nowotworów bardzo często
zawodzą i wiążą się z szeregiem niepożądanych skutków ubocznych. Dlatego też poszukuje się
innowacyjnych metod leczenia nowotworów, które stanowiłyby uzupełnienie i bezpieczną
alternatywę dla obecnie stosowanych strategii. Dlatego szczególnym zainteresowaniem cieszy się
wykorzystanie wirusów onkolitycznych, czyli wirusów zmodyfikowanych genetycznie, które
selektywnie infekują i wybiórczo mnożą się w komórkach nowotworowych. Charakteryzują się
wysokim tropizmem do komórek nowotworowych, szybkim tempem proliferacji, a także
zdolnością do lizy zainfekowanych komórek, a ich użycie stymuluje antynowotworową odpowiedź układu immunologicznego. Cząsteczki zmodyfikowanych wirusów mogą także stanowić
nośnik dla leków antynowotworowych, czy też genów samobójczych i terapeutycznych.
Wykorzystano je w próbach klinicznych leczenia raka okrężnicy, szyjki macicy, jajnika, wątroby
i trzustki. Wykazano także synergizm terapii wirusami onkolitycznymi i chemioterapii.
Stworzono także wektory na bazie wirusa opryszczki (HSV), namnażające się tylko w komórkach nerwowych np. wektor rRp450, który znalazły zastosowanie w leczeniu nowotworów
mózgu.
Wirusy onkolityczne to różnorodna grupa wirusów, które selektywnie infekują i niszczą komórki
nowotworowe przy jednoczesnym oszczędzaniu komórek prawidłowych. Ich prosta budowa
pozwala na niemal dowolną modyfikację ich genomu. Dzięki unikalnym właściwościom
i relatywnie niskim kosztom produkcji wektory te wydają się atrakcyjnym narzędziem
terapeutycznym i potencjalnie mogą w przyszłości stanowić alternatywę dla obecnie stosowanych
metod.
45
Maciej Gawroński, Arkadiusz Goede, Tomasz Wandtke
Oncolytic viruses as potential alternative in the treatment of malignant
tumorsitle in English
The dynamic development of medicine, molecular biology and genetic engineering has not
solved the problem of cancer diseases, which are one of the greatest challenges of modern
science. Furthermore currently used anti-cancer therapies are often ineffective and are associated
with a number of undesirable side effects. Therefore, there is an urgent need to find innovative
cancer treatments that would be a complement and safe alternative to currently used therapeutic
strategies. That is why there is particular interest in using oncolytic viruses – genetically modified
vectors, that selectively infect and multiply only in cancer cells. They are characterized by a high
tropism for cancer cells, high proliferation rate and the ability to lyse infected cells. Moreover,
their usage stimulates anti-tumor immune response. Modified viral vectors may also act as
a transporter of anticancer drugs or suicide and therapeutic genes.
They were used in clinical trials in treatment of colon, cervical, ovarian, liver and pancreas
cancer. Synergy between viral therapy and chemotherapy has also been shown. Vectors based on
herpes simplex virus (HSV), capable to proliferate only in nerve cells such as vector rRp450 were
created and are currently used in the treatment of brain tumors.
Oncolytic viruses are diverse group of viruses that selectively infect and destroy cancer cells
while saving normal cells. Due to their simple construction it is possible to modify their genome
in almost any way. Due to unique properties and relatively low production costs, these vectors
appear to be an attractive therapeutic tool and a potential alternative to currently used methods in
the future.
46
Monika Dyńda1
Wykorzystanie bakterii jako wektorów
w terapii przeciwnowotworowej
1. Wprowadzenie
Celem pracy jest przeglądowe przedstawienie zastosowań wybranych
drobnoustrojów i ich szczepów w terapii przeciwnowotworowej ze szczególnym uwzględnieniem prób leczenia guzów litych.
Schorzenia nowotworowe są jednymi z najczęstszych ludzkich
przypadłości, których występowanie zazwyczaj nie jest uwarunkowane
wiekiem. Istnieją natomiast dowody na korelację występowania różnego typu
mutacji spontanicznych oraz indukowanych działaniem mechanicznych
i chemicznych czynników mutagennych a rozwojem komórek nowotworowych.
Aktualnie stosowane terapie przeciwnowotworowe są bardzo wyniszczające dla organizmu ludzkiego. Zalicza się do nich chemioterapię, czyli
stosowanie cytostatyków działających degradująco nie tylko na komórki
nowotworowe, ale i na pozostałe zdrowe, radioterapię i/lub immunoterapię.
Cechą wspólną tych wszystkich metod jest brak specyficzności wobec samego
nowotworu, niszczone są wszystkie komórki, w tym odpornościowe.
Konsekwencją jest zazwyczaj zniszczenie flory bakteryjnej organizmu oraz
pozbawienie go bariery ochronnej w postaci aktywnego układu odpornościowego i ogólne osłabienie organizmu.
Jednym z nowszych kierunków badań jest zastosowanie bakterioterapii,
czyli wykorzystanie określonych gatunków bakterii w celu niszczenia
nowotworów. W ostatnich kilku latach obiecujące wyniki badań uzyskano na
modelach zwierzęcych, podczas eksperymentalnej terapii bakteriami z rodzaju
Clostridium,Listeria, Pseudomonas czy Salmonella. Pozytywne skutki
uzyskano zarówno przy samodzielnym stosowaniu szczepów bakteryjnych
w różnych postaciach, jak i przy ich współdziałaniu z terapiami standardowymi.
1
[email protected], Wydział Biologii i Ochrony Środowiska, Uniwersytet Łódzki
47
Monika Dyńda
1.1. Obiecujące perspektywy wykorzystania bakterii w terapii
antynowotworowej
Uczeni starają się znaleźć nowe, innowacyjne metody w walce
z nowotworem odznaczające się mniejszą inwazyjnością wobec organizmu
oraz podobną, a nawet lepszą skutecznością niż w przypadku chemio- czy
radioterapii. W tym celu zaczęto badać zależność między środowiskiem
rozwoju komórek nowotworowych, a miejscem bytowania niektórych
z bakterii. Bakterie żyjące w warunkach beztlenowych lub względnie
beztlenowych, takie jak Clostridium, czy Salmonella są zdolne do
zasiedlania obszarów, w których rozwijają się guzy lite, wykazując
jednocześnie lizę tych komórek [22]. Mikroorganizmy modyfikuje się
genetycznie, aby zwiększyć ich powinowactwo do kumulowania się
w obrębie nowotworu lub w sposób, który umożliwia im przenoszenie
odpowiedniego antygenu, który będzie stymulował przeciwnowotworową
odpowiedź immunologiczną. Są to tak zwane szczepionki przeciwnowotworowe, których celem jest stymulacja limfocytów T cytotoksycznych skierowanych przeciwko komórkom nowotworowym poprzez
prezentację antygenów przez komórki dendrytyczne kompleksom MHC-I.
Ogólnie, immunoterapia przeciwnowotworowa polega na ponownej
aktywacji mechanizmów obronnych organizmu oraz skierowaniu ich
przeciwko komórkom nowotworowym, co jest m.in inicjowane przez
dostarczenie odpowiednich antygenów oraz ich efektywne zaprezentowanie
komórkom żernym i limfocytom T [8].
Antynowotworowe działanie bakterii odkrył nowojorski chirurg
William Coley pod koniec XIX wieku po przeprowadzonej operacji
usunięcia mięsaka u jednej ze swoich pacjentek. Przypadkowo doszło do
zakażenia bakteriami Streptococcus pyogenes, które wywołały wysoką
gorączkę, czyli aktywowały układ odpornościowy, co w konsekwencji
spowodowało remisję choroby.
Coley postanowił zbadać dokładniej tę metodę terapii, dlatego zaczął
podawać swoim pacjentom S. pyogenes. Pojawiły się jednak problemy
w postaci słabej stymulacji układu odpornościowego, wystąpienia zbyt
silnej reakcji zapalnej czy wystąpienia zakażeń śmiertelnych. Coley użył
więc dwóch szczepów nieżywych bakterii S. pyogenes i Serratia marcescens,
a taką szczepionkę nazwano toksynami Coley’a. Jeden z pacjentów
z poważnym stadium choroby, z nieoperacyjnym mięsakiem został
poddany terapii wyżej wymienionymi toksynami po czym zaobserwowano
u niego całkowitą remisję choroby.
Po śmierci Coley’a naukowcy prowadzili dalsze badania, jednak szybko
ich zaprzestano ze względu na brak pozytywnych wyników eksperymentów, oraz rozwój innych, skutecznych metod terapeutycznych jak
chemioterapia i radioterapia [9].
48
Wykorzystanie bakterii jako wektorów w terapii przeciwnowotworowej
1.2. Metabolizm komórek nowotworowych
Komórki nowotworowe powstają w wyniku nagromadzenia w organizmie
różnego rodzaju mutacji oraz pod wpływem czynników epigenetycznych.
Takie „ingerencje” genetyczne prowadzą do powstania zmian metabolicznych
w poszczególnych komórkach, które w sumie generują powstanie odmiennego
mikrośrodowiska niż istniejące wśród komórek zdrowych.
Jednym z procesów zachodzących podczas transformacji nowotworowej
jest formowanie się tworów przypominających naczynia krwionośne. Procesy,
w wyniku których powstają, to angiogeneza oraz mimikra waskulogenna [18].
Pierwszy z nich odpowiada za tworzenie się naczyń z tych już obecnych
w organizmie, natomiast drugi proces odpowiada za tworzenie sieci naczyniopodobnej, która jest znacznie mniej różnicowana niż naczynia krwionośne
organizmu, a krew płynie w nich znacznie wolniej.
Obecność naczyń krwionośnych, zarówno tych nowopowstałych jak i tych,
w obrębie której nowotwór usytuował się, zapewnia komórkom nowotworowym dostęp do tlenu oraz jego rozprzestrzenianie się w organizmie [19].
Oba procesy przebiegają jednak powolnie co sprawia, że komórki przez długi
czas są niedotlenione, co prowadzi do stymulacji tworzenia nowych naczyń
oraz syntezy ATP podczas procesu glikolizy, który jest jednym z systemów
adaptacji komórek do beztlenowego środowiska. Komórki nowotworowe
potrzebują energii w postaci adenozynotrójfosforanu, aby przeżyć i wytworzyć
nową sieć prymitywnych naczyń krwionośnych, które ponownie doprowadzą
do niedotlenienia. Wnioskując, jeżeli komórki przeprowadzają proces
glikolizy, niezbędne do ich przeżycia są cząsteczki glukozy. Przystosowaniem
komórek do beztlenowych warunków jest również ekspresja niektórych genów
w tych warunkach, których produkty zwiększają inwazyjność nowotworu.
Naukowcy starają się jak najdokładniej poznać mechanizmy powstawania
oraz bytowania komórek nowotworowych ponieważ dzięki temu możliwe jest
opracowywanie nowych metod terapeutycznych. Jednymi z obiecujących
metod są terapie z użyciem niektórych gatunków bakterii, u których wykryto
powinowactwo do gromadzenia się w okolicach lub wewnątrz nowotworu
dzięki obecności beztlenowego środowiska oraz wykorzystanie ich jako
wektorów szczepionkowych zawierających odpowiednie antygeny
stymulujące układ immunologiczny. Informacje na ten temat zostaną
omówione w dalszych rozdziałach.
49
Monika Dyńda
2. Charakterystyka wybranych drobnoustrojów wykorzystanych
w terapii przeciwnowotworowej
2.1. Clostridium novyi-NT
Bakterie z rodzaju Clostridium należą do rodziny Clostridiaceae i liczą
obecnie 203 gatunki, przy czym tylko kilka z nich wywiera toksyczny wpływ
na organizm człowieka. Są to Gram-dodatnie-laseczki wytwarzające spory.
Clostridium to przeważnie bezwzględne beztlenowce. Są to organizmy
wytwarzające silne egzotoksyny jak np. neurotoksyny powodujące tężec.
Toksyny Clostridium są aktywnymi biologicznie białkami o charakterze
antygenowym, czyli stymulującym wytwarzanie przeciwciał w organizmie
gospodarza.
Najbardziej niebezpieczną, powodującą objawy kliniczne jest alfa-toksyna
wywołująca miejscową nekrozę tkanek poprzez stworzenie beztlenowego
środowiska w obrębie danej tkanki spowodowanego obumieraniem naczyń
krwionośnych [2].
Mimo swojej toksyczności, bakterie Clostridium, a raczej ich spory, zostały
wykorzystane w eksperymentalnych terapiach bakteryjnych nowotworów.
Techniki biologii molekularnej pozwoliły na uzyskanie nietoksycznego
szczepu – Clostridium novyi-NT od słów „non toxic” poprzez wyeliminowanie
genu, którego ekspresja powodowała wydzielanie egzotoksyny alfa [10, 15].
Rysunek1. Obraz mikroskopowy spor Clostridium novyi-NT [15]
50
Wykorzystanie bakterii jako wektorów w terapii przeciwnowotworowej
Do celów terapeutycznych wykorzystano również cykl życiowy
Clostridium, a dokładniej ich bezwzględną beztlenowość, która umożliwia
zasiedlanie przez bakterie wnętrza guzów litych.
W przeprowadzonych doświadczeniach, które zostaną przedstawione
w tym podrozdziale spory podawano do organizmu poprzez ich wstrzyknięcie,
gdzie po określonym czasie kiełkowały rozpoczynając działanie terapeutyczne.
Brak genu odpowiedzialnego za syntezę alfa-toksyn powoduje, że układ
immunologiczny nie reaguje gwałtownie, jego aktywność uwidacznia się
dopiero po zasiedleniu bakterii w obszarze nowotworu. Badania nad
wykorzystaniem Clostridium w leczeniu nowotworów wykazały ich korzystne
działanie, przejawiające się toksycznym działaniem bakterii na komórki
rakowe. Beztlenowe warunki mikrośrodowiska nowotworu sprawiają, że
bakterie gromadzą się w zmienionym chorobowo miejscu, następnie czynniki
wydzielane przez komórki nowotworowe aktywują bakterie do działania
litycznego, w wyniku czego Clostridium namnaża się i powoduje nekrozę
pobliskich komórek czyli nowotworu.
Rysunek2. Mechanizm działania antynowotworowego bakterii jest uzależniony
od mikrośrodowiska nowotworu. Kiedy Clostridium wnikają do organizmu, wytwarzają spory,
które lokalizują się wewnątrz litego guza, czyli w miejscu występowania środowiska
beztlenowego. Wewnątrz guza następuje kiełkowanie spor i wytworzenie toksyn, które działają
nekrotycznie na komórki nowotworowe [14]
51
Monika Dyńda
Jednym z badań w modelu zwierzęcym, jakie przeprowadzono, było
wyznakowanie komórek rakowych lucyferazą. Powszechnie lucyferaza jest
traktowana jako wskaźnik wzrostu nowotworu, dlatego spadek jej aktywności
oznacza nekrozę komórek rakowych. Następnie bezpośrednio w okolice
komórek nowotworowych podano przetrwalniki zmodyfikowanego szczepu
Clostridium. Po ich wykiełkowaniu, które nastąpiło po 24 godzinach
zaobserwowano spadek aktywności lucyferazy, co jest przejawem lizy
komórek nowotworowych [20, 17].
Badania przeprowadzono też na szczurach z rakiem mózgu (glejak
wielopostaciowy), którego terapia jest mocno utrudniona a samo wycięcie
guza powoduje naruszenie zdrowych tkanek i niekiedy prowadzi do
upośledzenia funkcjonowania całego organizmu. Po podaniu C. novyi-NT
zaobserwowano remisję choroby, jednak efektem ubocznym było powstanie
obrzęku w mózgu. Nie uznano tego faktu za wadę terapii, ponieważ leczenie
obrzęku mózgu jest zdecydowanie łatwiejsze niż eliminacja samego
nowotworu [17].
Dowód na gromadzenie się C. novyi-NT wewnątrz guza potwierdziły
badania, które opisano w artykule z 2004 roku, gdzie zastosowano model
nowotworu rozprzestrzeniający się w wątrobie i jamie opłucnej królików
powodujący śmierć po około ośmiu tygodniach. Zwierzęta zaszczepiano
zawiesiną komórek nowotworowych a po jego rozwoju, szczepiono
bakteriami. Po 4 dniach od podania C. novyi króliki uśmiercano, oraz
wycinano zmiany nowotworowe poddając je opracowaniu histopatologicznemu [1].
52
Wykorzystanie bakterii jako wektorów w terapii przeciwnowotworowej
Rysunek 3. Na zdjęciach przedstawiono przekrój poprzeczny guza u królika kontrolnego oraz
zaczepionego C. novyi-NT. Zdjęcia a i b przedstawiają przekrój tkanki guza w powiększeniu 40x,
wybarwionej hematoksyliną&eozyną oraz obszar nekrotyczny oznaczony literą N. A- to grupa
kontrolna, b – organizm zaszczepiony C. novyi-NT. C- powiększenie 400x pokazuje wybarwione
na fioletowo, wyraźnie widoczne jądra komórek guza oraz składniki cytoplazmy w obszarze
nekrotycznym. D – w przypadku C. novyi-NT obraz nekrotyczny jest ujednolicony, niemożliwe
jest wyodrębnienie jąder i poszczególnych składników nowotworu. Zdjęcia e i f przedstawiają ten
sam preparat w powiększeniu 1000x wybarwiony zielenią Pico. Na zdjęciu f widoczne są
wybarwione na zielono formy wegetatywne C. novyi-NT [1]
Wyniki badań są obiecujące, jednak należy wziąć pod uwagę fakt, że taka
terapia może nie być do końca bezpieczna, ponieważ bakterie w organizmie
mogą odpowiednio zmutować i zacząć ponownie produkować toksyny. Są to
jedne z niebezpieczeństw terapii, które musi zostać szczegółowo poznane
i wyeliminowane. Trudno również ustalić czy C. novyi-NT zachowają
aktywność terapeutyczną w obszarach tlenowych guza.
53
Monika Dyńda
2.2. Listeria monocytogenes
W terapiach antynowotworowych bakteriami Listerianie wykorzystuje się
pojedynczych właściwości czynników wirulencji, lecz cały cykl rozwojowy
bakterii,używając w tym celu najczęściej żywych, atenuowanych szczepionek
bakteryjnych.
Działanie szczepionki jest oparte na cyklu życiowym L. monocytogenes
i polega na wywoływaniu w organizmie silnej odpowiedzi immunologicznej,
która zostanie później skierowana przeciwko komórkom nowotworowym.
Bakterie wchodzące w skład szczepionki zostają wzbogacone o antygen
specyficzny dla danej odmiany nowotworu. Listeria przeprowadzają swój
naturalny cykl życiowy, czyli wnikają do komórek, a antygeny nowotworowe
podlegając silnej ekspresji są prezentowane kolejno cząsteczkom MHC klasy
pierwszej i drugiej. Następnie limfocyty T odbierają sygnał od antygenów, po
czym zostaje uruchomiona silna odpowiedź immunologiczna skierowana
przeciwko komórkom nowotworowym [3].
54
Wykorzystanie bakterii jako wektorów w terapii przeciwnowotworowej
Rysunek4. Indukcja odpowiedzi immunologicznej przez L. monocytogenes poprzez stymulowane
rozpoznanie antygenu przez komórki dendrytyczne oraz współdziałaniu MHC klasy I i II
z jednoczesną aktywacją cytotoksycznych limfocytów T, które atakują komórki nowotworowe
[3]
L. monocytogenes wnikają do organizmu drogą pokarmową, a dokładniej
przez komórki nabłonka jelitowego. Bakterie te wykorzystują do tego komórki
M, do których wiążą się z udziałem adhezyn-internaliny A, co pozwala na
bezpośrednie wnikanie bakterii przez nabłonek. Po przekroczeniu bariery
w postaci nabłonka i śluzu, Listeria rozpoczyna penetrację komórek
gospodarza poprzez proces fagocytozy. Po wydostaniu się z fagosomu,
bakterie poruszają się w cytoplazmie komórki wytwarzając specjalną strukturę,
55
Monika Dyńda
tzw. „kometę listeryjną” na biegunach komórki, w której skład wchodzą
filamenty aktynowe, które uległy polimeryzacji po zadziałaniu produktu
bakterii – białka ActA. Bakterie przechodzą następnie do sąsiedniej komórki,
gdzie zostają otoczone przez podwójną błonę fosfolipidową, z której ponownie
się wydostają przy pomocy produkowanych enzymów (fosfolipaz).
Cały proces penetracji komórek gospodarza przez L. monocytogenes
odbywa się z pobudzeniem układu immunologicznego, w tym zachodzących
z udziałem antygenów zgodności tkankowej klasy pierwszej i drugiej. Rozwój
L. monocytogenes następuje wewnątrz komórek prezentujących antygen,
którymi są monocyty, makrofagi i komórki dendrytyczne. Bakterie prezentują
swoje antygeny (trawione w lizosomie białka i toksyny) cząsteczkom MHC
klas I i II i tym samym stymulują do odpowiedzi limfocyty T pomocnicze
i cytotoksyczne (CD4+ CD8+), co w przypadku nowotworów jest zjawiskiem
pozytywnym, ponieważ specyfikacja nowotworu powoduje zahamowanie
aktywności limfocytów T regulatorowych oraz cząsteczek MDCs. Taka
stymulacja odpowiedzi immunologicznej znalazła zastosowanie przy produkcji
wektorów szczepionkowych, które byłyby wykorzystywane jako środek
terapeutyczny chorób, gdzie ważna jest wtórna indukcja układu
odpornościowego [21].
Najnowsze badania przeprowadzone z użyciem L. monocytogenes
dotyczyły skonstruowania oraz wykorzystania wektora szczepionkowego
w terapii raka szyjki macicy, poprzez stymulację i skierowanie odpowiedzi
immunologicznej przeciwko komórkom nowotworowym.
Działanie szczepionki opisano w artykułach w 2008 roku, gdzie badania
przeprowadzono na pacjentkach z zaawansowanym stadium raka szyjki
macicy. Produkt poddawany badaniom to Lovaxin-C czyli rekombinowane,
żywe, atenuowaneL. monocytogenes zawierające specyficzny dla nowotworu
antygen oraz pozbawioną hemolitycznych właściwości listeriolizynę O [16].
Przełomowym wynikiem badań okazała się nie tylko skuteczność szczepionki,
ale również jej bezpieczeństwo wobec ludzkiego organizmu. Po trzech
miesiącach kuracji zaobserwowano uwstecznienie objawów chorobowych
u siedmiu z 15 pacjentek, u których chemioterapia oraz radioterapia nie
przyniosły efektów.
Kobietom poddawanym terapii szacowano około pół roku życia, włączono
je więc w fazę kliniczną pierwszą i drugą. W odstępie trzech tygodni
otrzymywały one szczepionkę. Do trzech miesięcy terapia przebiegała
bezproblemowo w porównaniu do standardowych metod. Jedynymi efektami
ubocznymi były gorączka, dreszcze i nudności. Po tym czasie, u pięciu
pacjentek choroba postąpiła, natomiast u siedmiu stan ustabilizował się. Jedna
z pacjentek, która była w IV stadium zaawansowania choroby została
poddana chemioterapii, w wyniku czego po dwóch latach guz całkowicie
zanikł [12].
56
Wykorzystanie bakterii jako wektorów w terapii przeciwnowotworowej
2.3. Pseudomonas aeruginosa
Najbardziej intensywne badania prowadzone są obecnie na jednym
z niedawno zmodyfikowanych szczepów Pseudomonas o symbolu BN10. Jest
to szczep Gram-ujemny, tlenowy z jedną wicią, nie formujący spor, zdolny do
produkcji związków powierzchniowo czynnych, m. in.ramnolipidów
należących do biosurfaktantów. Ramnolipidy mają glikolipidową budowę,
a w ich w skład wchodzi ramnoza tworząc hydrofilową główkę oraz kwas
beta-hydroksydekanowy formujący hydrofobowy ogon związku. Bakterie
Pseudomonas charakteryzuje synteza oraz wydzielanie na zewnątrz tych
związków. Z wyżej wymienionego szczepu udało się wyizolować na żelu
krzemionkowym dwa rodzajeramnolipidów – RL-1 i RL-2, które zbadano
metodą rezonansu magnetycznego i spektrometrii masowej (NMR-MS).
Działanie poszczególnych związków badano m.in. na liniach komórkowych
białaczki promielocytarnej (HL-60). Mechanizmem działania ramnolipidów
jest wprowadzanie zmian morfologicznych w komórkach fagocytów
i komórek niefagocytujących poprzez reorganizację cytoszkieletu w wyniku
czego następuje różnicowanie keratynocytów i fibroblastów. Działanie
przeciwnowotworowe obserwowano w przypadku RL-1, który spowodował
zahamowanie żywotności komórek nowotworowych nawet w 50% już przy
niskich stężeniach. W komórkach eksponowanych na RL-1 obserwowano
zmiany kondensacji chromatyny, fragmentację organelli czy zmianę struktury
cytoplazmy [5].
57
Monika Dyńda
Rysunek 5. Wpływ różnych ilości stężeń RL-1 i RL-2 na żywotność komórek nowotworowych
białaczki promielocytarnej i ostrej białaczki limfoblastycznej typu B [5]
Bakterie P. aeruginosa mają również zastosowanie jako wektor
szczepionkowy. Ogólna zasada działania tego typu szczepionek polega na
indukcji komórek układu odpornościowego oraz ukierunkowaniu aktywności
komórek żernych i stymulacji odpowiedzi humoralnej przeciwko czynnikom
chorobotwórczym, które wcześniej przez organizm nie zostały rozpoznane. W
tym celu najczęściej wprowadza się do DNA bakterii odpowiednie geny
kodujące określone białka, które ulegają ekspresji w organizmie gospodarza
i stymulują odpowiedź immunologiczną dzięki lepszemu zaprezentowaniu
komórkom żernym swoistego antygenu.
W artykule z 2006 roku, autorstwa Epaulard’a i Toussaint’a [7], została
opisana szczepionka zawierająca zmodyfikowane szczepy P. aeruginosa.
Szczepionka, której bazą była albumina o zwiększonej przyswajalności,
składała się z zawiesiny bakterii P. aeruginosa oraz mysich komórek
dendrytycznych i limfocytów T. Do badań użyto myszy, u których
indukowano nowotwór o typie czerniaka, którym wszczepiono podskórnie,
w miejsce gdzie rozwijał się nowotwór terapeutyczną mieszaninę. Działanie
substancji obserwowano po 5 i 12 dniach od implantacji nowotworu, gdzie
zaobserwowano remisję choroby u 6 myszy.
58
Wykorzystanie bakterii jako wektorów w terapii przeciwnowotworowej
Inne zastosowanie bakterii Pseudomonas przedstawiono w badaniach
przeprowadzonych zaledwie rok temu. Naukowcy wykorzystali szczepy tych
bakterii do stymulacji aktywności cytotoksycznej komórek działających
przeciwko komórkom nowotworowym. Mowa o krwi pępowinowej
(CB – Cord Blood), która stanowi bogate źródło komórek krwiotwórczych oraz
NK indukowanych cytokinami (CIK). Są to komórki efektorowe, które
wykazują aktywność antynowotworową zarówno w eksperymentach in vitro
jak i in vivo w odniesieniu do odmian złośliwych nowotworu. Ich głównym
zadaniem jest ekspresja limfocytów T oraz komórek dendrytycznych i tym
samym wywołanie efektu cyto-toksycznego wobec komórek nowotworowych.
W przeprowadzonym eksperymencie wykazano, że komórki CIK indukowane
szczepem Pseudomonas indukują wydzielanie prozapalnych cytokin jak IFNgamma oraz wzmagają ekspresję receptorów TLR2, TLR4, TLR6, co powoduje zwiększenie stopnia cytotoksyczności wobec komórek rakowych [24].
Rysunek6. Wykres przedstawiający wzrost komórek nowotworowych poddanych wpływowi
komórek CIK. Komorki nowotworowe potraktowane komórkami CIK przedstawione są na
wykresie jako linie A, B i C (najmniejszy wzrost komórek), pozostałe krzywe przedstawiają
wyniki wzrostu nowotworu bez CIK. H to kontrola [23]
59
Monika Dyńda
2.4. Salmonella typhimurium
Bakterie z rodzaju Salmonella są ruchliwymi, orzęsionymi, Gramujemnymi pałeczkami. Nie wytwarzają toksyn, jak ma to miejsce w przypadku
Clostridium, Pseudomonas czy Listeria. Niepożądanym immunostymulatorem
jest jedynie lipopolisacharyd występujący w błonie zewnętrznej, który
nadmiernie indukuje odpowiedź organizmu w momencie lizy komórki
bakteryjnej, co może prowadzić do szoku toksycznego [13].
Pierwszym i najczęściej wykorzystywanym do badań jest szczep o obniżonej toksyczności VNP20009, w którym usunięto gen Purl potrzebny do
syntezy puryn oraz msbB czego efektem była zmniejszona indukcja TNF-α
przez LPS w organizmie gospodarza. Efekt ten zapobiega szokowi
septycznemu [6].
Autorzy jednego z artykułów z 2010 roku przedstawiają wyniki badań na
temat szczepu VNP20009, z których wynika, że wśród 31 pacjentów
z czerniakiem złośliwym, tylko u trzech stwierdzono kolonizację guza przez
bakterie. Jedną z możliwych odpowiedzi dlaczego tak się dzieje jest stopień
wrażliwości układu odpornościowego danego pacjenta na szczep VNP20009,
który próbuje usunąć go z organizmu. Podczas podawania S. typhimurium
myszom z rakiem okrężnicy zauważono duży napływ krwi do wnętrza guza,
co doprowadziło do nekrozy centralnej części nowotworu, tam gdzie bakterie
proliferowały. Efekt ten został wykryty dzięki wysokiemu stężeniu cytokin
w organizmie, które efekt ten powodowały. W martwiczych obszarach guza
bakterie są zdolne do bardzo intensywnego rozwoju. Stwierdzono więc, że
niepowodzenie poprzednich badań było spowodowane zbyt małą indukcją
uwalniania TNF-α, co jest niezbędne do efektywnej inwazji i niszczenia
nowotworu. Dlatego kolejnym krokiem było zmodyfikowanie szczepu
S. typhimurium w taki sposób, aby był wystarczająco wirulentny wobec guzów
przy jednocześnie zmniejszonych efektach ubocznych [11]. Podanie dożylnie
dużej ilości bakterii nie wywołuje niepożądanych efektów u ludzi i jest dobrze
tolerowane przez organizm, dlatego szczep VNP jest postrzegany jako
stosunkowo bezpieczny wektor szczepionkowy [4].
Obiecujące badania z wykorzystaniem bakterii Salmonella przeprowadzili
polscy naukowcy z Uniwersytetu Jagiellońskiego w Krakowie. Badania
dotyczyły zmodyfikowania szczepu VNP w taki sposób, aby uzyskany wektor
szczepionkowy wykazywał jak największe powinowactwo oraz toksyczność
wobec komórek nowotworowych. Efekt taki próbowano uzyskać poprzez
wymuszenie opóźnionej nadekspresji białka SipB w miejscach zmienionych
chorobowo. Białko to jest kodowane przez pierwszą wyspę patogenności
i odpowiada za indukcję apoptozy komórkowej, oraz usunięcie genu Trg
odpowiedzialnego za chemotaksję bakterii w obszary o zwiększonym
stężeniu glukozy. Nagromadzenie glukozy występuje w zewnętrznej części
60
Wykorzystanie bakterii jako wektorów w terapii przeciwnowotworowej
guzów litych, dlatego usunięcie tego genu zwiększało powinowactwo
gromadzenie się szczepu wewnątrz guza [4].
Próbowano znaleźć sposób w jaki bakterie mogłyby skuteczniej dotrzeć do
komórek nowotworowych. Wykorzystano różnego rodzaju receptory, które
w wyniku chemotkasji przyciągnęłyby S. typhimurium do specyficznych
regionów guza.
Szczep VNP zmodyfikowano tak, aby produkował fragment przeciwciała,
który wiązałby antygen karcynoembrionalny (CEA) na powierzchni komórek
nowotworowych. Dzięki oddziaływaniu przeciwciała z CEA bakteria
pozostaje w guzie nowotworowym, zakaża niektóre komórki nowotworowe
i wywołuje ich śmierć. Natomiast opóźniona nadekspresjagenu sipB potęguje
ten efekt [4].
Do zweryfikowania skuteczności terapeutycznie zmodyfikowanego
szczepu użyto myszy, którym wszczepiono podskórnie komórki nowotworów
czerniaka i gruczolaka oraz czekano na jego rozwój. Zmodyfikowane bakterie
Salmonella, czyli szczep VNP20009 z wbudowaną sekwencją 6xHis-sipB
podawano w miejsce, gdzie rozwijał się nowotwór. Wyniki pokazały
jednoznacznie, że bakterie ze wstawką hamują rozwój nowotworu
w większym stopniu niż zastosowanie dzikiego szczepu VNP20009. U 80%
myszy zakażonych nowotworem zaobserwowano całkowite wyeliminowanie
choroby w wyniku zastosowania szczepu Salmonella z genem sipB, natomiast
przy zastosowaniu bakterii bez wstawki, efekt ten wystąpił jedynie u 20%
myszy. Pozytywne wyniki dotyczą linii komórkowych gruczolakoraka
MC38CEA i nowotworów płuc, w przypadku których zaobserwowano
zahamowanie rozwoju komórek nowotworowych w porównaniu z grupą
kontrolną [4].
Podstawową wadą zmodyfikowanego szczepu VNP20009 była słaba
inwazyjność względem komórek MC38CEA oraz ich niska przeżywalność in
vivo. Było to spowodowane nagła ekspresją genu sipB. Aby wyeliminować
niepożądane efekty, wprowadzono do plazmidu wstawkę składającą się
z promotora PsifB, histydyny oraz białka sipB, który miał za zadanie
indukować opóźnioną ekspresję genu kodującego białko sipB. Przesunięta
w czasie ekspresja, czyli zachodząca już wewnątrz komórki bakteryjnej
pozwoliła na zwiększenie przeżywalności szczepu oraz inwazyjności
zakażanych komórek eukariotycznych.
Nowopowstałego szczepu użyto ponownie stosując wybrane modele
nowotworowe u myszy. W przypadku zwierząt z gruczolakorakiem
(MC38CEA), po podaniu bakterii już w ósmym dniu zaobserwowano
zmniejszenie guzów, natomiast cztery dni później guzy były niemożliwe do
zmierzenia. W ciągu miesiąca eliminacja nowotworu nastąpiła u trzech myszy.
W przypadku czerniaka zlokalizowanego w płucach, lepsze efekty zaobser-
61
Monika Dyńda
wowano przy zastosowaniu szczepu VNP/SipB niż samego VNP. U dwóch
osobników nastąpiła całkowita eliminacja nowotworu [4].
Rysunek 7. Efekty terapii nowotworowej przebiegającej z zastosowaniem zmodyfikowanych
szczepów bakteryjnych Salmonella. Najlepsze efekty terapeutyczne uzyskano stosując szczep
VNP/sipB [4].
W 2009 roku szczep VNP/SipB, proces jego otrzymywania oraz
wykorzystanie jako wektora szczepionkowego zgłoszono do Urzędu
Patentowego. Wynalazek został opatentowany na początku 2013 roku.
Aktualnie trwają dalsze badania nad ulepszeniem i wykorzystaniem bakterii
Salmonella oraz opisanego wektora VNP/sipB w leczeniu przeciwnowotworowym.
62
Wykorzystanie bakterii jako wektorów w terapii przeciwnowotworowej
3. Podsumowanie
Mimo dużego postępu w opracowywaniu nowych leków o działaniu
przeciwnowotworowym, skuteczność klasycznych terapii jest wciąż
niezadowalająca. Dlatego też naukowcy na całym świecie poszukują
alternatywnych sposobów leczenia pozbawionych większości skutków
ubocznych. Wszystkie te metody, mają swoje zalety oraz wady, ale próby
ich zastosowania w przyszłości mogą przynieść oczekiwane skutki. Jednym
z nowszych kierunków badań jest zastosowanie bakterioterapii, czyli
wykorzystanie określonych gatunków bakterii w celu niszczenia nowotworów. Wiele prób klinicznych przyniosło pozytywne skutki leczenia,
dlatego warto analizować i ulepszać te metody terapii przeciwnowotworowej.
Literatura
1.
2.
3.
4.
5.
6.
7.
8.
Agrawal N., Bettegowda Ch., Cheong I., Geschwind J. F., Drake Ch. G.,
Hipkiss E. L., Tatsumi M., Dang L. H., Diaz L. A., Pomper M., Abusedera M.,
Wahl R. L., Kinzler K. W., Zhou S., Huso D.L., Vogelstein B., Bacteriolytic
therapy can generate a potent immune response against experimental tumors,
PNAS, 101 (2004), s. 15172-15177.
Boyd N., Walker P., Thomson R., The prevention of experimental Clostridium
novyi gas gangrene in high-velocity missile wounds by passive immunisation,
J Med. Microbiol., 5 (1972), s. 459-465
Brockstedt D., Dubensky T., Promises and challenges for the development
of Listeria monocytogenes – based immuno therapies, ExpertRev. Vaccines,
7 (2008), s. 1069-1084
Chorobik P., Opracowanie metody zwiększenia efektywności bakterii Salmonella
typhimurium w terapii przeciwnowotworowej poprzez nadekspresję endogennego
białka SipB, Kraków, Uniwersytet Jagielloński, (2010)
Christova N., Tuleva B., Kril A., Georgieva M., Konstantinov S., Terzlyski I.,
Nikolova B., Stoineva I., Chemicalstructure and in vitro antitumoractivity
of rhamnolipids from Pseudomonasaeruginosa BN10, Appl. Biochem.
Biotechnol., 170 (2013), s. 676-689
El-Bahy A. A., Abou-Aisha K., Noaman E., Mahran L. G., Regression
of murineehrlichascites carcinoma using tumor-targeting Salmonella
VNP20009 – comparison with the effect of the anticancerdrugdoxorubicin.
Advances in cancer, Research&Treatment, (2012)
Epaulard O. 1, Toussaint B., Quenee L., Derouazi M., Bosco N., Villiers Ch.,
Le Berre R., Guery B., Filopon D., Crombez L., Marche P., Polack B., Antitumor immunotherapy via antigendelivery from a live attenuated genetically
engineered Pseudomonas aeruginosa type III secretion system-based vector,
Nature, 14 (2006), s. 656-661
Epaulard O. 1, Toussaint B., Quenee L., Derouazi M., Bosco N., Villiers Ch.,
Le Berre R., Guery B., Filopon D., Crombez L., Marche P., Polack B., Antitumor immunotherapy via antigendelivery from a live attenuated genetically
63
Monika Dyńda
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
engineered Pseudomonas aeruginosa type III secretion system-based vector,
Nature, 14 (2008), s. 656-661
Hoption C. S. A, Netten J. P, Netten C., Dr William Coley and tumor regression:
a place in history or in the future, Postgrad Med. J, 79 (2003), s. 672-680
http://www.hopkinsmedicine.org/neurology_neurosurgery/centers_clinics/spin
e/clinical_trials/chordoma_study_announcement.pdf
Leschner S., Weiss S., 2010 Salmonella – allies in the fight against cancer,
J Mol Med. 88 (2010), s. 763-773
Lowry F., Live Listeria vaccine proves safe against end-stagecervical
ca in humantrial. Ob. Gyn. News, 15 (2008), s. 2
Mizerski W., Bednarczuk B., Kawalec M. Słownik bakterii [w:] Salmonella.
Adamantan, Łódź, (2008)
Olson, West Virginia University,
www2.hsc.wvu.edu/som/physio/ppts/FIS%201Intro%20to%20bacteriology%20Olson%202006.ppt
Plomp M., McCaffery M., Cheong I., Huang X., Bettegowda Ch., Kinzler K.,
Zhou S., Vogelstein B., Malkin A., Spore coat architecture of Clostridium
novyi NT spores, J. Bacteriol. 189 (2007), s. 6457-6468
Radulovic S., Brankovic-Magic M., Malisic E., Jankovic R., Dobricic J.,
Plesinac-Karapandzic V., Maciag P. C., Rothman J., Therapeutic cancer
vaccines in cervical cancer: phase I study of Lovaxin-C,J B.U.ON. 14 (2009),
s. 165
Staedtke V., Bai R., Kinzler K., Zhou S., Vogelstein B., Riggins G., The
genetically engineered Clostridium novyi-NT is effecacious in the treatment
of intracranial glioblastomas, Neuro-Oncology, 16 (2014), s. 79-95
Szala S., Komórki mikrośrodowiska nowotworowego: cel terapii przeciwnowotworowej, Nowotwory Journal of Oncology, 57 (2007), s. 633-645
Szala S., Jarosz M. 2011. Nowotworowe naczynia krwionośne,
PostepyHigMedDosw, 65: 437-446
Tiffen J. C., BaileyCh. G., Ng C., Rasko J., Holst J., Luciferaseexpression
and bioluminescencedoes not affect tumor cellgrowth in vitro or in vivo,
Molec. Cancer, 9 (2010), s. 299-307
Wiki.biol.uw.edu.pl
Yu H., Bacteria-mediated disease therapy, ApplMicrobiolBiotechnol,
92 (2011), s. 1107-1113
Zhang L., Hou Y., Zhang J., Hu J., Zhang K., Cytotoxicity of cytokine-induced
killer cells targeted by a bispecific antibody to gastric cancer cells, Oncol.
Lett., 5 (2013), s. 1826-1832
Zhang Z., Wang L. P., Zhao X. L., Wang F., Huang L., Wang M., Chen X. F.,
Li H., Zhang Y., Pseudomonas aeruginosa injection enhanced antitumor
cytotoxicity of cytokine-induced killer cells derived from cordblood, Biomed
Pharmacother, 68 (2014), s. 1057-1063
64
Wykorzystanie bakterii jako wektorów w terapii przeciwnowotworowej
Wykorzystanie bakterii i ich wektorów w terapii przeciwnowotworowej
Współcześnie, jednymi z oporniejszych terapii jest leczenie chorób nowotworowych, dlatego
naukowcy starają się opracować jak najskuteczniejsze metody w zwalczaniu komórek nowotworowych. Szerokim spektrum badań zostały poddane bakterie jak na przykład Clostridium
novyi, Listeriamonocytogenes, Pseudomonasaeruginosa czy Salmonella typhimurium, gdzie
wykorzystano ich specyficzny cykl życiowy w opracowywaniu skutecznych terapii przeciwnowotworowych. W przypadku C. novyizrekombinowano pozbawiony toksyczności szczep,
który jako bezwzględny beztlenowiec namnaża się w beztlenowym mikrośrodowisku guzów
litych. Natomiast L. monocytogenes została użyta do skonstruowania szczepionki z żywymi,
atenuowanymi bakteriami, które mają za zadanie wzbudzać odpowiedź humoralną organizmu
i skierować ją przeciwko komórkom nowotworowym. Szczepionka była testowana między
innymi u kobiet w zaawansowanym stadium raka szyjki macicy. Podobne działanie wykazuje P.
aeruginosa, która działa immunostymulująco na organizm gospodarza. Zastosowanie w terapii
nowotworowej znalazł również specjalnie zmodyfikowany szczep BN10, który wydziela
ramnolipidy działające toksycznie na komórki białaczki promielocytarnej. Obiecujące wyniki
badań uzyskano również w przypadku S. typhimurium, a konkretnie szczepu VNP20009, który
wykazuje nekrotyczne działanie w przypadku czerniaka złośliwego oraz szczep VNP/SipB
skonstruowany przez polskich naukowców, który przyniósł pozytywne efekty u myszy
z gruczolakiem, a nawet całkowitą eliminację nowotworu.
Anti-tumor therapies with application of bacteriaand theirvectors
Nowadays, cancer therapy is very challenging treatment so scientists are trying to discover the
most effective way to kill cancer cells. Bacteria like Clostridium novyi, Listeria monocytogenes,
Pseudomonas aeruginosa or Salmonella typhimurium were widely examined and surveys were
focused on use their lifecycle in cancer therapy. During examination of C. novyi new recombinant
strain was created and this strain was deprived of toxic features. This strain as obligate anaerobe
was able to proliferate in anaerobic microenvironment of solid tumors. On the other hand
L. monocytogenes was used to create vaccine. This vaccine contained alive, attenuated bacteria
and the aim of this vaccine was to activate humoral immune response against cancer cells. This
treatment was tested among women with late stadium of cervical cancer. Similar action can be
observed in therapy with P. aeruginosa, which has immunostimulating influence on human
organism. The strain of P.aeruginosa BN10 is also used in cancer therapy. This strain excrete
ramnolipids, which can be toxic to promyelocytic leukemia cells. The examination of
S. typhimurium ended with some promising results especially examination of strain called
VNP20009. This strain was observed to cause necrosis of malignant melanoma cells. Another
examined strain VNP/SipB, which was created by Polish scientists was tested on mice and it was
effective in lung adenoma, even some mice fully recovered from this type of cancer
65
Anna Posmysz1
Zastosowanie krwi pępowinowej w medycynie
czyli o możliwościach terapeutycznych
komórek macierzystych
pobranych z krwi pępowinowej
1. Wstęp
Praca ta ma charakter przeglądowy. Na podstawie dostępnych publikacji
w bazie PubMed oraz na stronach Polskiej Akademii Nauk dokonano
usystematyzowania wiedzy na temat możliwości zastosowania krwi
pępowinowej w leczeniu różnych jednostek chorobowych. Temat komórek
macierzystych i ich wykorzystania w terapii chorób neurodegeneracyjnych,
po zawałach serca i mózgu, medycynie sportowej czy nawet onkologii jest
bardzo często poruszany w środowiskach naukowych i medycznych.
Ponieważ krew pępowinowa jest odpadem medycznym, warto jest
rozważyć jej zdeponowanie w bankach krwi pępowinowej czyli dokonanie
tzw. bankowania. Aktualny stan wiedzy pozwala sformułować wnioski, że
komórki macierzyste obecne w krwi pępowinowej wykazują duże
możliwości różnicowania się w różnorodne typy komórek trzech listków
zarodkowych. Ponadto, łatwiej je wyizolować niż np. ze szpiku kostnego.
Mogą być stosowane w leczeniu nie tylko najbliższych nam osób, ale także
ludzi zupełnie niespokrewnionych np. chorych na białaczkę, pacjentów po
zawałach sercach, udarach mózgu i nowotworach będących zmorą
współczesnego świata. Użycie tych komórek nie wymaga tak
skomplikowanych zabiegów jak w przypadku poszukiwań dawcy szpiku
kostnego, a tym samym leczenie może odbyć się szybciej, niż w sytuacji
gdy dopiero poszukuje się odpowiedniego dawcy szpiku do przeszczepu.
Jak wiadomo, im szybciej podejmie się terapię chorego, tym lepsze są dla
niego rokowania.
1
[email protected], studia doktoranckie, Katedra Nauk Fizjologiczno-Medycznych,
Zakład Fizjologii, Akademia Wychowania Fizycznego im. Jerzego Kukuczki w Katowicach,
www.awf.katowice.pl
66
Zastosowanie krwi pępowinowej w medycynie
czyli o możliwościach terapeutycznych komórek macierzystych pobranych z krwi pępowinowej
2. Wprowadzenie
Komórki macierzyste (SC) to takie komórki, które charakteryzują się
dużymi możliwościami samoodnowy oraz zdolnością do wielokierunkowego
różnicowania się. Rozróżniamy trzy ich rodzaje: embrionalne, zarodkowe
i somatyczne. Wymienione typy komórek macierzystych wykazują
zróżnicowany potencjał. Komórki węzła zarodkowego są totipotencjalne,
zarodkowe – pluripotencjalne, płodowe oraz somatyczne czyli te występujące
w organizmie po urodzeniu –multipotencjalne [1, 2]. Wśród somatycznych SC
wyróżnić można dwa podtypy: hematopoetyczne SC (HSC) oraz mezenchymalne SC (MSC). Zarówno HSC jak i MSC są multipotencjalne. W tabeli
nr 1 zestawiono najważniejsze cechy wyżej wymienionych komórek w celu
porównawczym.
2.1. Embrionalne komórki macierzyste
Embrionalne komórki macierzyste (ES) w porównaniu z pozostałymi
SC są najbardziej plastyczne – mają zdolność do przekształcania się
w dowolny rodzaj komórek [1]. Komórki macierzyste ulegają podziałom
symetrycznym (ES) lub asymetrycznym (płodowe SC, somatyczne SC).
Somatyczne SC są obecne w znacznie większej liczbie typów tkanek
i odpowiadają za odbudowywanie i regenerację organów i tkanek przez
całe nasze życie. Na rycinie nr 1 przedstawiono graficznie pochodzenie
ludzkich komórek macierzystych [3].
Rys. 1. Pochodzenie i właściwości ludzkich komórek macierzystych wg Jezierskiej-Woźniak [3]
67
Anna Posmysz
2.2. Różnicowanie komórek macierzystych i ich nisza
Cecha nazywana różnicowaniem to nic innego jak zdolność komórki do
zmiany fenotypu pod wpływem ekspresji, której ulegają geny związane
z daną czynnością komórki. SC wcale nie dzielą się tak często, w dodatku
do podziału potrzebują odpowiedniego bodźca. Przykład takiego zjawiska
świetnie ukazuje znane wielu sportowcom dyscyplin wytrzymałościowych
zwiększone wytwarzanie czerwonych krwinek w organizmie człowieka
przez szpik kostny w warunkach hipoksji tlenowej podczas przebywania
i trenowania na wysokości ponad 1500 m n.p.m. Drugi popularny przykład
to złuszczanie się naskórka. Powszechnie wiadomo, że naskórek często
ulega uszkodzeniu i gdyby nie komórki macierzyste, jego samoodnawianie
się nie byłoby możliwe. Komórki macierzyste są regulowane przez tzw.
niszę czyli mikrośrodowisko fizjologiczne o specyficznych właściwościach. To właśnie ona wysyła określone sygnały, które mają wpływ na
powstawanie wewnętrznych sygnałów między komórkami macierzystymi
i tym samym decyduje o przeznaczeniu komórki oraz reguluje proliferację
komórkową [4, 5].
Tab. nr 1. Charakterystyka cech komórek macierzystych – opracowanie własne
Totipotencjalne
Zdolne do
różnicowania
się w dowolny
rodzaj
komórek
budujących
organy
dorosłego
osobnika,
a także do
komórek
tworzących
łożysko.
Komórki
totipotencjalne
to zygota
i blastomery
Pluripotencjalne
Zdolne do
różnicowania się
w dowolny typ
komórek
somatycznych,
z wyłączeniem
komórek trofoblastu.
Pluripotencjalne
komórki macierzyste,
które pochodzą
z wczesnego stadium
zarodkowego
(kilkudniowa
blastocysta) dają
początek wszystkim
rodzajom komórek.
Do komórek
pluripotencjalnych
zalicza się również
dorosłe komórki
macierzyste szpiku
kostnego
68
Multipotencjalne
Unipotencjalne
Zdolne do
różnicowania się
w różne typy
komórek,
zazwyczaj
jednak typy te
mają podobne
właściwości
i pochodzenie
embrionalne. Do
tej grupy
komórek zalicza
się między
innymi komórki
macierzyste
pochodzące
z krwi
pępowinowej
Zdolne do
różnicowania się
tylko i wyłącznie
w jeden typ
komórek.
Komórki
macierzyste
wykazujące
tą zdolność
nazywa się także
prekursorowymi.
Komórki
unipotentne to
np. keratynocyty
Zastosowanie krwi pępowinowej w medycynie
czyli o możliwościach terapeutycznych komórek macierzystych pobranych z krwi pępowinowej
2.3. Przeszczepy komórek macierzystych
Po przeszczepieniu komórki macierzyste namnażają się. Prawie nigdy nie
atakują komórek biorcy i nie dochodzi do odrzucenia przeszczepu. Jest to
szczególne istotne przy ratowaniu chorych na białaczki. Komórki macierzyste
z krwi pępowinowej nie są nośnikiem chorób nowotworowych, które mogą się
rozwijać w trakcie życia człowieka np. na skutek oddziaływania środowiska
lub pod wpływem zaburzonej ekspresji genów [6]. Świadczy to o bezpieczeństwie ich stosowania, które to cały czas jest udowadniane w badaniach
naukowych na całym świecie. Najwięcej komórek macierzystych znajduje się
w ludzkich embrionach, ale pozyskiwanie ich z płodów, np. w wyniku aborcji,
nie może być akceptowane bez zastrzeżeń.
Drugim, alternatywnym źródłem może być krew pępowinowa pobierana
z pępowiny. Do niedawna była ona niszczona w szpitalach wraz z łożyskiem
czyli stanowiła tzw. odpad medyczny. Ponieważ pobieranie krwi pępowinowej
tuż po porodzie nie wiąże się z żadnym ryzykiem dla matki czy noworodka,
powinno się rozważyć bankowanie krwi pępowinowej. Jednak przechowywanie krwi w tzw. bankach krwi pępowinowej wiąże się z pewnymi
kosztami.
2.4. Bankowanie krwi pępowinowej
Jak pisze w swoim artykule Pilonis, nie wszyscy uważają bankowanie krwi
pępowinowej za coś wspaniałego i potrzebnego. Autorka opisuje postawę
Profesora Wiesława Wiktora Jędrzejczaka z Warszawskiego Uniwersytetu
Medycznego, który nie uważa, by bankowanie krwi pępowinowej przez banki
komercyjne wiązało się z takimi korzyściami, jakie przedstawiane są rodzicom
nowonarodzonych dzieci. Profesor podkreśla potencjał wykorzystania SC
z krwi pępowinowej w autoprzeszczepach i terapii medycznej, lecz nie do
końca zgadza się z polityką komercyjnych banków krwi [7].
Innym Znanym naukowcem opisywanym przez Pilonis w tym samym
artykule jest Profesor Ryszard Poręba, prezes Polskiego Towarzystwa
Ginekologii. Stoi on na stanowisku, że zainteresowane kobiety spodziewające
się dzieci, które pytają o bankowanie krwi, powinny mieć dostęp do wszelkich
sprawdzonych i rzetelnych informacji na ten temat [7].
Profesor Jędrzejczak sam dokonał przeszczepu komórek macierzystych
choremu na białaczkę i nie jest wrogiem jego stosowania, zwłaszcza że bardzo
często trudno jest znaleźć dawcę szpiku [7]. Pilonis przytacza słowa
Jędrzejczaka – Wykonano już kilka tysięcy takich przeszczepień i połowa z nich
się powiodła. Chodzi jednak o krew innego dziecka, a nie krew samego
chorego. W 1/4 przypadków bowiem we krwi pępowinowej już znajdują się
komórki nowotworowe, mimo że nie ma klinicznych objawów białaczki. Poza
tym, wskutek reakcji przeszczepu przeciw nowotworowi, obca krew daje lepszy
69
Anna Posmysz
efekt terapeutyczny. Prowadzi się wiele prac badawczych dotyczących
wykorzystania komórek macierzystych do odbudowy uszkodzonych tkanek. Nie
są to jednak nawet badania kliniczne, nie mówiąc o wykorzystywaniu tej
technologii jako metody leczenia. Wyniki wykonanych dotąd pojedynczych
przeszczepów autologicznych krwi pępowinowej nie zostały udokumentowane
w czasopismach naukowych. Opisane zostało w 2007 r. tylko 1 udane przeszczepienie autologiczne, ale w przypadku ostrej białaczki limfoblastycznej, co
oznacza, że może nastąpić jej nawrót – komentuje Jędrzejczak [7]. Pilonis
stwierdza, że wszyscy znani jej eksperci są zgodni, że krew pępowinowa
w przeszczepach allogenicznych może uratować życie pacjentom, dla których
nie można znaleźć odpowiedniego dawcy szpiku. Dotyczy to około 40%
chorych [7]. Profesor Jędrzejczak zaznacza, że całe piękno krwi pępowinowej
tkwi w tym, że zgodność cech może wynosić 4 na 6, podczas gdy do
przeszczepu szpiku konieczne jest 9 na 10. Ponadto, jest ona dostępna
błyskawicznie, a dawcy szpiku się szuka, co trwa często długo [7]. Polskie
Ministerstwo Zdrowia nie stosuje specjalnych działań promujących
bankowanie krwi pępowinowej ani nie finansuje takich zabiegów, gdyż uważa,
że potrzeba znacznie więcej badań naukowych na ten temat [7]. Jednocześnie
daje wolność obywatelom w tym temacie, więc mogą oni swobodnie zawierać
transakcje komercyjne [7]. 12 października 2010 roku został przyjęty przez
Radę Ministrów tzw. Program Wieloletni: Narodowy Program Rozwoju
Medycyny Transplantacyjnej na lata 2011-2020. W programie tym przewidziany jest rozwój allogenicznego bankowania komórek krwiotwórczych krwi
pępowinowej w celach publicznych [7].
3. Naukowe uzasadnienie bankowania krwi pępowinowej i jej
zastosowania w terapii medycznej
3.1. Badania chińskich naukowców dotyczące leczenia SAA
Lin Na Xie i Fang Zhou z Chin przeprowadzili eksperyment, w który
zaangażowali pacjentów chorych na ciężką niedokrwistość aplastyczną
(SAA). Wszystko przebiegało za zgodą pacjentów i odpowiednich komisji
bioetycznych. Pacjentów z ciężką postacią SAA poddawali zwiększonemu
leczeniu immunosupresyjnemu (IST). Następnie dokonywali transfuzji
krwi pępowinowej (UCB). W rezultacie wykazali oni wysoką wydajność
leczenia SAA przy pomocy transfuzji krwi pępowinowej, a także dowiedli
niskiego ryzyka nawrotów tej choroby. Wspomagane leczenie immunosupresyjne jakie zastosowali to nic innego jak popularny cyklofosfamid
w niskich dawkach i tzw. antymiocytowe globuliny [8].
Innym, równie ciekawym i spektakularnym eksperymentem tego zespołu
naukowego było badanie przeprowadzone na dwóch pacjentach z SAA.
70
Zastosowanie krwi pępowinowej w medycynie
czyli o możliwościach terapeutycznych komórek macierzystych pobranych z krwi pępowinowej
Tym razem także zaaplikowali chorym leczenie IST i przetoczyli krew
pępowinową. Badacze skupili się na obserwacji oznak powikłania
nazywanego powszechnie przeszczep przeciwko gospodarzowi (GVHD).
Badanie trwało dwa lata i przez ten dwuletni okres obserwacji nie
zauważyli objawów GVHD. Nie było także żadnych nawrotów [8].
3.2. Eksperymenty z MSC
Mezenchymalne komórki macierzyste (MSC) po raz pierwszy zidentyfikowano w szpiku kostnym [9]. Wykazano, że MSC mogą działać przeciwzapalnie i immunoregulująco oraz naprawczo w uszkodzeniach płuc
i chorobach serca [10]. Szpik kostny (BM) to główne źródło MSC. Niestety,
liczne badania wykazały, że wraz z wiekiem obniża się liczba MSC w szpiku,
a pobór tych komórek ze szpiku kostnego jest inwazyjny [10, 11].
W 2004 roku naukowiec Wang wraz ze swoim zespołem, wykazali, że
ludzka krew pępowinowa (UCB) jest bogata w MSC [12]. Te komórki
posiadały charakterystyczne dla MSC markery i tak samo jak MSC
z innych tkanek i z BM były zdolne do indukcji różnicowania. Aktualnie
komórki macierzyste MSC są stosowane na szeroka skalę w modelowaniu
doświadczalnym przeróżnych chorób np. neurodegeneracyjnych, urazów
rdzenia kręgowego, uszkodzenia płuc, nadciśnienia płucnego i innych [13, 14].
Próbowano użyć MSCs indukowanych z krwi pępowinowej w celu
leczenia stanów przedrzucawkowych u ciężarnych [15]. W tym celu
ludzkie pępowiny pozbierano ze szpitali położniczych. Wszystko odbywało
się wg odpowiednich procedur etycznych i za zgodą komisji bioetycznej na
te badania oraz za zgodą pisemną darczyńców. Następnie pępowiny były
cięte na kawałki o grubości 3 mm i przenoszone na odpowiednio
przygotowane pożywki, które w swym składzie zawierały 10 % płodowej
surowicy bydlęcej (FBS), penicylinę oraz streptomycynę. Następnie tkanki
były umieszczane w specjalnej mieszaninie z hialuronidazy, kolagenazy
i dyspazy w temperaturze 37 stopni. Potem następowało odwirowywanie
i umieszczenie w pożywce, a następnie komórki trawiono trypsyna
i pasażowano. Komórki od piątej do ósmej generacji poddano cytometrii
przepływowej w celu identyfikacji i wykorzystano je do indukcji oraz
transplantacji.
Badacze w opisywanym doświadczeniu przeprowadzili różnicowanie
osteogenne i adipogenne, używając do tego odpowiednich pożywek. I tak
do osteogenezy używano pożywki DMEM – F12, którą odpowiednio
zmodyfikowano poprzez uzupełnienie 10% PBS i innymi substancjami.
Natomiast do adipogenezy użyto pożywki DMF, także zmodyfikowanej.
Wykonano również próbę kontrolną. Po upływie niecałych 4 tygodni
zauważono, że komórki macierzyste z krwi pępowinowej uległy zarówno
71
Anna Posmysz
osteogenezie, jak i adipogenzie. Zauważono złogi wapnia w osteocytach oraz
wakuole z lipidami w adipocytach. Dodatkowo wykonywano odpowiednie
barwienie indukowanych adipocytów poprzez zastosowanie tzw. oil red O,
natomiast osteocyty wybarwiono czerwienią alizarynową. Dzięki cytometrii
przepływowej autorzy określili obecność bądź brak fenotypowych antygenów
powierzchniowych charakterystycznych dla MSC. Wykazali także przydatną
rolę MSC w leczeniu stanów przedrzucawkowych [15].
Tab. nr 2. Zestawienie antygenów powierzchniowych w komórkach wyhodowanych
w doświadczeniu
aCD105
Antygeny powierzchniowe, których
nie wykryto
CD19
CD73
CD45
CD90
CD11b
Antygeny powierzchniowe obecne
HLA-DR
CD34
Źródło: wyniki Fu L, Liu Y, Zhang D, Xie J, Guan H, Shang T [15]
3.3. 3.3 Badania kliniczne
W Korei wykorzystano krew pępowinową do wykonania doświadczenia
transplantacji komórek macierzystych z krwi pępowinowej i terapii
komórkowej w leczeniu schorzeń u ludzi [16].
W swoim artykule badacz Young-Ho Lee podaje, że w Korei pobieranie
i gromadzenie krwi pępowinowej jest regulowane przez odpowiednie ustawy
i wytyczne. Zebrana krew pępowinowa (CB) jest poddawana obróbce tzn.
wirowaniu w specjalnym, sterylnym urządzeniu [8]. Tak jak i na całym
świecie, w Korei istnieją banki krwi pępowinowej publiczne i prywatne.
Badacze stwierdzają, że CB jest dobrym źródłem do terapii komórkowej
pacjentów cierpiących na różne jednostki chorobowe. Wskazują jednocześnie,
że pomimo coraz większej ilości banków prywatnych i publicznych, wskaźnik
wykorzystania CB pozostaje wciąż niski.
Naukowiec na podstawie analizy różnych publikacji stwierdził, że krew
pępowinowa może być źródłem komórek macierzystych używanych dla
ratowania życia i pomaga ona w regeneracji różnych tkanek. Uważa
jednocześnie, że istnieje potrzeba prowadzenia dalszych badań i informuje, że
krew pępowinowa jest bankowana na całym świecie w prywatnych bankach
krwi, a stosowanie komórek krwi z pępowiny, która właściwie stanowi odpad
medyczny, jest jak najbardziej etyczne. Poniżej zamieszczono schemat
72
Zastosowanie krwi pępowinowej w medycynie
czyli o możliwościach terapeutycznych komórek macierzystych pobranych z krwi pępowinowej
z publikacji Young-Ho Lee, który w klarowny sposób ilustruje możliwości
zastosowania krwi pępowinowej w medycynie [16].
Rys. 2. Możliwości różnicowania HSC i MSC znajdujących się w krwi pępowinowej
Źródło: Clinical utilization of cord blood over human health: experience of stem cell
transplantation and cell therapy using cord blood in Korea [16]
3.4. Polskie jednostki badawcze
Polscy naukowcy wyhodowali ludzkie komórki nerwowe z krwi
pępowinowej w 2002 roku. Wyhodowano trzy różne typy komórek
nerwowych wchodzących w skład ludzkiego mózgu. Mogą się one okazać
przydatne w leczeniu uszkodzeń powstałych po udarze oraz w chorobie
Parkinsona. Dokonał tego zespół badaczy w składzie: Leonora Bużańska,
Barbara Zabłocka, Krystyna Domańska-Janik z Centrum Medycyny
Doświadczalnej i Klinicznej PAN w Warszawie oraz Eugeniusz Machaj,
Zygmunt Pojda z Zakładu Hematologii Eksperymentalnej Centrum
Onkologii w Warszawie [17, 18].
4. Podsumowanie
Badania kliniczne prowadzone na całym świecie, również w Polsce,
potwierdzają zasadność bankowania krwi pępowinowej. Krew ta wraz
z pępowiną stanowi tzw. odpad medyczny. Należałoby informować
zainteresowane osoby o korzyściach płynących z bankowania krwi
pępowinowej i możliwościach jej wykorzystania w przyszłości.
Aktualnie za pomocą terapii komórkami macierzystymi leczy się
kilkadziesiąt jednostek chorobowych. Wśród nich są nowotwory takie jak
np. białaczka, rak piersi i nerki. Choroby neurodegeneracyjne, cukrzycę,
73
Anna Posmysz
choroby krwi, zaburzenia układu odpornościowego i wiele chorób
uwarunkowanych genetycznie także leczy się przy użyciu komórek
macierzystych. Planuje się dalsze badania naukowe nad zastosowaniem
komórek macierzystych z krwi pępowinowej np. w leczeniu choroby
Parkinsona czy Alzheimera.
Istnieje potrzeba informowania społeczeństwa o możliwościach
wykorzystania krwi pępowinowej w przyszłości, jednakże nie powinny to
być informacje przejaskrawione oraz niesprawdzone lecz takie, które
opierają się na badaniach naukowych.
Literatura
1.
Klimanskaya I, Chung Y, Becker S, Lu S. J, Lanza R, 2006, Human
embryonic stem cell lines derived from single blastomeres, Nature 444: 481485
2. Tsonis P. A. 2002, Regenerative biology: the emerging field of tissue repair
and restoration, Differentation 70: 397-409
3. Jezierska-Woźniak K, Nosarzewska D, Tutas A, Mikołajczyk A, Okliński M,
Jurkowski K.,2010, Wykorzystanie tkanki tłuszczowej jako źródła
mezenchymalnych komórek macierzystych, Postepy Hig Med Dosw, 64:326-32
4. Nilson S. K, Simons P. J., 2004, Transplantable stem cells: home to specific
niches.Curr Opin Hmatol, 11: 102-106
5. Li L., Xie T., 2005, Stem cell niche: structure and function. Annu Rev Cell
Dev Biol, 21: 605-631
6. Cohen Y., Nagler A., 2004, Umbilical cord blood transplantation--how, when
and for whom? Blood Rev, Sep;18(3):167-79
7. Pilonis H., 2010, Pępowinowy marketing. Służba Zdrowia, e-book nr 93-100,
13 grudzień
8. Xie L. N., Zhou F., 2015, Unexpected unrelated umbilical cord blood stem
cell engraft in two patients with severe aplastic anemia that received
immunosuppressive treatment: A case report and literature review,
Department of Hematology, The General Hospital of Jinan Military, Jinan,
Shandong 250031, P.R. China
9. Friedenstein A. J, Piatetzky-Shapiro II, Petrakova K. V., Osteogenesis in
transplants of bone marrow cells. 1966. J Embryol Exp Morphol 16:381-390
10. Mueller S. M., Glowacki J., 2001, Age-related decline in the osteogenic
potential of human bone marrow cells cultured in three-dimensional collagen
sponges, J Cell Biochem 82:583-590. doi: 10.1002/jcb.1174
11. Kode J. A., Mukherjee S., Joglekar M. V., Hardikar A. A., 2009,
Mesenchymal stem cells: Immunobiology and role in immunomodulation
and tissue regeneration, Cytotherapy 11:377-391. doi:
10.1080/14653240903080367
12. Wang H. S., Hung S. C., Peng S. T., et al., 2004, Mesenchymal stem cells in
the Wharton's jelly of the human umbilical cord, Stem Cells 22:1330-1337.
doi: 10.1634/stemcells.2004-0013
74
Zastosowanie krwi pępowinowej w medycynie
czyli o możliwościach terapeutycznych komórek macierzystych pobranych z krwi pępowinowej
13. Pullamsetti S. S, Schermuly R., Ghofrani A., et al., 2014, Novel and emerging
therapies for pulmonary hypertension, Am J Respir Crit Care Med 189:394400. doi: 10.1164/rccm.201308-1543PP
14. Moodley Y., Atienza D., Manuelpillai U., et al., Human umbilical cord
mesenchymal stem cells reduce fibrosis of bleomycin-induced lung injury,
Am J Pathol. 2009;175:303-313. doi: 10.2353/ajpath.2009.080629
15. Fu L., Liu Y., Zhang D., Xie J., Guan H., Shang T., 2015, Beneficial effect
of human umbilical cord-derived mesenchymal stem cells on an endotoxininduced rat model of preeclampsia, Exp Ther Med Nov;10(5):1851-1856.
Epub 2015 Sep 11
16. Lee Y.-H., 2014, Clinical utilization of cord blood over human health:
experience of stem cell transplantation and cell therapy using cord blood
in Korea, Korean J Pediatr Mar; 57(3): 110-116. Published online 2014 Mar
31. doi: 10.3345/kjp.2014.57.3.110
17. Bużańska L., Zychowicz M., Sarnowska A., Domańska-Janik K., 2013,
Bioengineering of neural stem cell niche, Postępy Biochem 59 (2): 175-86
Rev. Polish
18. Grabowska I., Streminska W., Janczyk-Ilach K., Machaj E. K., Pojda
Z., Hoser G., Kawiak J., Moraczewski J., Ciemerych M. A., Brzoska E., 2013,
Myogenic potential of mesenchymal stem cells – the case of adhesive fraction
of human umbilical cord blood cells. Curr Stem Cell Res Ther Jan; 8(1): 82-90
Zastosowanie krwi pępowinowej w medycynie czyli o możliwościach
terapeutycznych komórek macierzystych pobranych z krwi
pępowinowej
Dokonano przeglądu najnowszych badań dotyczących użycia komórek macierzystych
pochodzących z krwi pępowinowej. W tym celu posłużono się bazą PubMed oraz informacjami
podawanymi przez Polską Akademię Nauk. Istnieją badania naukowe, które dowodzą, że
przeszczepy komórek macierzystych pochodzących z krwi pępowinowej są bardzo bezpieczne
i prawie nigdy nie atakują komórek biorcy – nawet przy braku pokrewieństwa między biorcą
i dawcą. Komórki macierzyste z krwi pępowinowej nie są nośnikami chorób. Ponadto, pozyskanie ich z krwi pępowinowej nie wiąże się z ryzykiem ani dla płodu ani dla matki. Przemawia to
za bezpieczeństwem ich stosowania i daje im przewagę nad komórkami macierzystymi
uzyskiwanymi z innych źródeł. Zespoły naukowe na całym świecie badają skuteczność terapii
z zastosowaniem komórek macierzystych krwi pępowinowej. Przykładowo, badacze z Chin
wielokrotnie potwierdzili skuteczność leczenia chorych z ciężką niedokrwistością aplastyczną.
Inny zespół zastosował te komórki w leczeniu stanów przedrzucawkowych u ciężarnych.
W Polsce również bada się możliwości terapeutyczne komórek macierzystych z krwi
pępowinowej. Komórki macierzyste są pomocne w terapii wielu chorób np. cukrzycy, białaczki,
nowotworów i chorób neurodegeneracyjnych. Ponieważ krew pępowinowa jest odpadem
medycznym, warto rozważać jej zdeponowanie w tzw. bankach krwi pępowinowej, gdyż
w przyszłości może zostać ona wykorzystana do leczenia.
75
Anna Posmysz
Application of umbilical cord blood in medicine – therapeutic
possibilities of stem cells derived from umbilical cord blood
We made a review of recent studies on the use of stem cells derived from umbilical cord blood.
For this purpose, the PubMed database and some information given by The Polish Academy
of Science were used. There are many scientific publications, which show that transplants of stem
cells derived from umbilical cord blood are very safe, also almost never attack the recipients’
cells, even in the absence of consanguinity between the recipient and the donor. Stem cells from
umbilical cord blood are not disease vehicles. Moreover, their acquisition from umbilical cord
blood is associated neither with problems for child nor for mother. That facts speaks in favor
of the safety of the usage of stem cells and gives them an advantage over stem cells derived from
other sources. Scientific teams all over the world are studying the efficacy of therapy with the use
of stem cells from umbilical cord blood. For example, researchers from China have repeatedly
confirmed the effectiveness of the treatment of patients with severe aplastic anemia. Another
team, applied these cells in the treatment of pre-eclampsia in pregnant women. In Poland, the
therapeutic possibilities of stem cells from umbilical cord blood are also tested. Stem cells are
helpful in therapy of many diseases, for example: diabetes, leukemia, cancer and neurodegenerative diseases. Because cord blood is a medical waste, its deposit should be considered in
the so called umbilical cord blood banks, because it may be used in the future for medical therapy.
76
Małgorzata Waldowska1, Wioleta Kowalska2, Justyna Woś3
Fenotypowe i funkcjonalne zróżnicowanie
populacji komórek NKT
1. Wstęp
Komórki NKT (naturalkiller T cells)stanowią niewielką subpopulację
limfocytów T. Pomimo swojej małej liczebności, odgrywają istotną rolę
w regulacji wrodzonej odpowiedzi immunologicznej, pojawiając się jako
jedne z pierwszych w miejscu infekcji czy zapalenia [1]. W wyniku
odpowiedniej stymulacji antygenem, limfocyty te potrafią szybko uwalniać
cytokiny i wpływać na funkcje komórek dendrytycznych, komórek NK
(naturalkillers), limfocytów B, a także limfocytów T CD4+ i CD8+,
determinując kierunek i jakość odpowiedzi nabytej [2, 3].
Nazwa tej populacji limfocytów nawiązuje do pierwotnie zaobserwowanej, jednoczesnej ekspresji pewnych markerów charakterystycznych dla
komórek NK oraz limfocytów T. Podobnie jak inne subpopulacje
limfocytów T, komórki NKT posiadają na swojej powierzchni receptory
TCR (T cell receptor). Umożliwiają one konwencjonalnym limfocytom
Trozpoznawanie antygenów peptydowych związanych z cząsteczkami
MHC klasy I lub II, zaśkomórkom NKT warunkują odpowiedz wobec
własnych i obcych antygenów o charakterze lipidowym i glikolipidowym
[4, 5].Cechy współdzielone z komórkami NK to obecność typowych dla
nich receptorów, zwłaszcza CD161 (u myszy CD161c znany jako NK1.1)
[6, 7], a także zdolność do udziału w bezpośredniej odpowiedzi cytotoksycznej poprzez wytwarzanie perforyny i granzymów [7]. W świetle
aktualnej wiedzy, powyższa definicja komórek NKT zdaje się być niewystarczająca i niepełna. Obecnie uznaje się, iż ekspresja wspomnianych
markerów komórek NK nie jest warunkiem koniecznym do określenia
komórek jako NKT [4]. Wszakże wiele konwencjonalnych limfocytów T
zwiększa ekspresję tych markerów (włączając CD161/NK1.1) przy
aktywacji. Pewna część komórek NKT w ogóle nie wykazuje ich obecności
na swojej powierzchni [7, 8], podczas gdy na innych ich ekspresja ulega
1
[email protected], Katedra i Zakład immunologii Klinicznej, II Wydział
Lekarski z Oddziałem Anglojęzycznym, Uniwersytet Medyczny w Lublinie, www.umlub.pl,
2
[email protected], Katedra i Zakład immunologii Klinicznej, II Wydział Lekarski
z Oddziałem Anglojęzycznym, Uniwersytet Medyczny w Lublinie, www.umlub.pl
3
[email protected], Katedra i Zakład Immunologii Klinicznej, II Wydział Lekarski
z Oddziałem Anglojęzycznym, Uniwersytet Medyczny w Lublinie, www.umlub.pl
77
Małgorzata Waldowska, Wioleta Kowalska, Justyna Woś
zmianom w zależności od stopnia dojrzałości, aktywacji, a u myszy
również podłoża genetycznego [9, 10]. Sięgając 25 lat wstecz do początkowych doniesień dotyczących limfocytów T rozpoznających lipidy
[11‚13], wiedza na temat biologii i właściwości komórek NKT uległa
znacznemu pogłębieniu. Dlatego konieczne stało się uaktualnienie
i uporządkowanieich nomenklatury.
Przedstawiona w niniejszym artykule klasyfikacja komórek NKT opiera
się na rodzaju używanych łańcuchów TCR, a także rodzaju cząsteczki
prezentującej rozpoznawane antygeny.Biorąc pod uwagę powyższe
kryteria, wśród komórek NKT wyróżniamy trzysubpopulacje przedstawione w tabeli 1. Dwie pierwsze subpopulacje posiadają ‘kanoniczne’
receptory TCR i rozpoznają antygeny prezentowane przez niepolimorficzne
cząsteczki MHC klasy I- podobne. Z historycznego punktu widzenia,
termin kanoniczny lub niezmienny TCR odnosi się do komórek NKT, które
posiadają łańcuch Vα24Jα18 u ludzi (Vα14Jα18 u myszy).Stąd takie
komórki NKT określa się jako invariant NKT (iNKT) [14, 15]. Udowodniono, że rozpoznają one antygeny prezentowane przez cząsteczki CD1d
[16].Na łamach Science, w 1995 roku ukazała się praca o odkryciu nowego
genu powiązanego z cząsteczką MHC, MR1 [17]. Dopiero w 2003 roku
zidentyfikowano grupę komórek, która wiąże się ze wspomnianymi
cząsteczkami. Nazwano jemNKT lubkomórkami MAIT (mucosa-associated
invariant T cells) [13]. Podobnie jakiNKT, ich receptory TCR są częściowo
niezmienne; zawierają łańcuch Vα19 połączony z Jα33 segmentem u ludzi
(Vα7.2Jα33 u myszy) [18, 19]. Zatem iNKT oraz mNKT można zakwalifikować do grupycanonicalcNKT. Trzecia grupa komórek NKT, określana
jako variant NKT (vNKT), obejmuje limfocyty T CD1d-reaktywne, ale
korzystające z heterogennego kanonu łańcuchów tworzących receptory TCR.
2. Komórki cNKT
2.1. KomórkiiNKT
Najlepiej poznaną grupą limfocytów NKT są komórki typu I, znane
również jako invariant NKT [20]. Lepsze zrozumienie biologii tych komórek
stało się możliwe dzięki odkryciu przez zespół Kawano w 1997 roku αgalaktozyloceramidu (α-GalCer) [14].Ten syntetyczny glikolipid otrzymywany
z gąbek morskich Agelasmauritianus, efektywnie aktywuje komórki iNKT.
Tak jak inne antygeny lipidowe czyglikolipidowe, α-GalCer wiążesię
z cząsteczkami CD1d (niepolimorficznymi glikoproteinami strukturalnie
podobnymi do MHC) [21], które są obecne w zwiększonej ilości na
powierzchni komórek APC, takich jak komórki dendrytyczne [22].Dopiero tak
utworzone kompleksy są rozpoznawane przezniezmienne receptory TCR
78
Fenotypowe i funkcjonalne zróżnicowanie populacji komórek NKT
zarównomysich, jak i ludzkich komórekiNKT [23]. Zastosowanie kompleksów
CD1d/α-GalCer związanych z odpowiednim fluorochromem stanowi dobrą
metodę identyfikacji komórek iNKT [24]. Komórki NKT typu I używają
ograniczonej puli genów do rearanżacji swoich receptorów TCR. Ich
wyjątkowy receptor TCR składa się z łańcuchaα (Vα24Jα18 u ludzi,
Vα14Jα18 u myszy) powiązanego z łańcuchem β (Vβ11 u ludzi, Vβ8.2, Vβ7,
Vβ2 u myszy) [9, 25]. Kolejną typową cechą tej populacji komórek jest
ekspresja markerów,które współdzielą z komórkami NK, np. CD161 u ludzi
(NK1.1 homologicznie u myszy) [26] [Tabela 1]. Właściwie większość
limfocytów T NK1.1+ u myszy C57BL/6 stanowią omawianą subpopulację
komórek NKT [8, 27], podczas gdy u ludzi, subpopulacja komórek
Vα24/Vβ11 stanowi mniejszość spośródodsetka limfocytów T CD161+ [28].
Należy zaznaczyć, że większość komórek NKTopuszczając grasicę nie posiada
markera NK1.1 na swojej powierzchni. Zyskują go dopiero na obwodzie,
stając się wówczas w pełni dojrzałe [29]. Komórki iNKT zdają się być wysoce
autoreaktywne nawet w stanie spoczynku; wykazują fenotyp komórek
aktywowanych/pamięciz obecnością na swojej powierzchni charakterystycznych markerów aktywacji: CD69, CD44, CD122, oraz w mniejszym
stopniu CD62L – markera komórek dziewiczych, które przemieszczają się do
węzłów chłonnych [30].
Obecność koreceptorów CD4 i CD8 na powierzchni limfocytówiNKT,
dzieli je na komórki CD4+CD8-występujące w znacznej większości (90%
u myszy), i pozostałe CD4-CD8-doublenegative(DN). Zaobserwowano, iż
tylko u ludzi występuje dodatkowo subpopulacja CD4-CD8+(CD8αα+
i CD8αβ+)[7, 31]. Zarówno CD4+ jak i CD4- iNKTsą odnajdywane u miejscach
występowania innych limfocytów T, jednakże częstość ich występowania
waha się znacznie w różnych tkankach. Najliczniej mysie komórki
Vα14Jα18NKT zasiedlają wątrobę (10-40% limfocytów wątroby), natomiast
są również obecne w szpiku kostnym, płucach, tarczycy, śledzionie, węzłach
chłonnych, jelitach, czy we krwi obwodowej [27, 32].U ludzi,dystrybucja
komórek Vα24Jα18 NKT w tkankach zdaje się być podobna jak u myszy.
Jednakczęstośćich występowania u ludzi jest znacznie obniżona, choć
odnotowuje się znaczne różnice osobnicze. Badania zespołu Kenna wykazały,
że ludzka wątroba zawiera wyraźnie mniej komórek Vα24Jα18 (<1%),
w porównaniu z tą samą tkanką u myszy [33]. Komórki iNKT stanowią
0,01-0,1% ludzkich komórek mononuklearnych krwi obwodowej, chociaż
u pewnych osób obserwowano wartości przewyższające 3% [34, 35].
Ta szczególna populacja limfocytów T, mimo korzystania z ograniczonego
repertuaru receptorów TCR, wykazuje szeroki i zróżnicowany zakres
działania. Uważa się, iż komórki NKT typu I odgrywają kluczową rolę
w rozwoju miejscowej i uogólnionej odpowiedzi immunologicznej.
Potrafią modulować reakcje organizmu w wielu schorzeniach obejmu79
Małgorzata Waldowska, Wioleta Kowalska, Justyna Woś
jących nowotwory, choroby autoimmunizacyjne, infekcje czy alergie
[36‚40]. Za pomocą swoich receptorów TCR, rozpoznają one antygeny
lipidowe zarówno prawidłowych komórek naszego organizmu, jak
i antygeny drobnoustrojów i komórek nowotworowych [14, 41, 42].
Stymulując komórki iNKT antygenem (α-GalCer), zauważono gwałtowny
(w ciągu kilku godzin) wzrost produkcji IL-4 i IFN-γ [9]. Późniejsze
badania wykazały, że tak szybkie uwalnianie wspomnianych cytokin, które
nota bene stały się znakiem rozpoznawczym komórek iNKT, jest związane
ze stałą ekspresją mRNA [43]. Jednak to nie jedyne cytokinyprodukowane
przez komórki iNKT. Dotychczas udowodniono uwalnianie przez nie
również IL-2, IL-5, IL-6, IL-9, IL-10, IL-13, IL-17, IL-21, czynnika
martwicy nowotworów (TNF),transformującego czynnika wzrostu
β(TGFβ), czychemokin, takich jak białko zapalne makrofagów (MIP-1α)
czy RANTES. Komórki iNKT są także źródłem hematopoetycznych
czynników wzrostu, np. czynnika stymulującego tworzenie kolonii
granulocytów i makrofagów (GM-CSF) [9, 44, 45].Wśród wymienionych
cytokin znajdują się te charakterystyczne dla limfocytów Th1, jak i Th2
[14]. Zatem paradoksalnie komórki iNKT mogą uczestniczyć zarówno
w reakcjach prozapalnych jak i przeciwzapalnych [8]. Uwolnione cytokiny
wpływają na szereg komórek uczestniczących w odpowiedzi immunologicznej: komórki dendrytyczne, neutrofile, makrofagi, limfocyty Tγδ,
konwencjonalne komórki T, limfocyty B, komórki NK, czy komórki NKT
typu II. Rola immunoregulacyjna komórek iNKT wydaje się być kluczową
dla ich działania [46]. Wielokierunkowy wpływ tej niezwykłej populacji
limfocytów T, próbuje się tłumaczyć istnieniem subpopulacji, różnych pod
kątem funkcjonalnym i fenotypowym.
2.1.1. Zróżnicowanie komórekiNKT
Ludzkie komórki CD4+ i CD4-iNKTcharakteryzują się różnym profilem
wydzielanych cytokin. DN oraz CD8+CD4- są fenotypowo i funkcjonalnie
zbliżone, wykazując dominującą składową typu Th1 (IFN-γ) wśród
uwalnianych cytokin, podczas gdy komórki CD4+ generują zarówno
cytokiny typu Th1, jak i Th2 (IFN-γ, TNF, IL-4, IL-5, IL-10, IL-13) [47].
Funkcjonalne różnice pomiędzy subpopulacjami CD4+ i DN iNKT
u myszy rysują się mniej wyraźnie [48]. W literaturze znajdują się doniesienia o lokalizacji komórek NKT CD4+ o profilu typu Th2 w płucach i ich
potencjalnej roli w rozwoju astmy [49]. Ponieważ komórki iNKT zasiedlające różne tkanki i narządy, mogą wykazywać różnice w ekspresji
markerów powierzchniowych i profilu wydzielanych cytokin, trudno jest
jednoznacznie określić ich funkcje. Zgodnie z wynikami opublikowanymi
w 2003 roku przez Crowe’a i współpracownikówna modelu mysim,
80
Fenotypowe i funkcjonalne zróżnicowanie populacji komórek NKT
komórki CD4- NKT wątroby promują odrzucanie nowotworu, natomiast
inne subpopulacje komórek NKT wywodzące się z tarczycy, śledziony, czy
komórki CD4+ NKT wątrobynie wykazują podobnych właściwości
ochronnych [50]. Według Kenna i współpracowników, komórki Vα24Jα11
pochodzące z ludzkiej wątroby są źródłem cytokin typu Th1 (IFN i TNF),
ale nie Th2 (IL-4). Wykazali oni także znaczne obniżenie ilości tych
komórek u pacjentów z nowotworem wątroby, co sugeruje ich potencjalne
działanie przeciwnowotworowe in vivo [33].
W oparciu o preferencję do produkcji poszczególnych cytokin oraz
ekspresję określonych czynników transkrypcyjnych, komórki iNKT zostały
podzielone na subpopulacje, które przywodzą na myśl podział
obserwowany wśród konwencjonalnych limfocytów T. Odnosi się to
zwłaszcza do komórek NKT1, NKT2 i NKT17, wykazujących ekspresję
czynników transkrypcyjnych regulujących linie limfocytów Th1, Th2 oraz
Th17 (odpowiednio T-bet, GATA3 i RORγt) [9, 51] [Rys.1]. Wymienione
subpopulacje powstają naturalnie i znajdują się w grasicy. Dodatkowe
subpopulacje NKTfh oraz FoxP3+iNKT, różnicują się pod wpływem
ekspozycji na antygen[44, 45, 52]. Niedawno odkryto również komórki
iNKT obdarzone funkcją regulatorową, nazwane komórkami NKT10 [53, 54]
[Rys.1]. Wobec takich doniesień, zamiast klasycznego modelu ‘0-1-2-3’
rozwoju komórek iNKT opartego na ekspresji markerów powierzchniowych,
zaproponowano alternatywny model różnicowania ich linii, uwzględniający
ekspresję czynników transkrypcyjnych. Zaobserwowano, iż komórki Tbethigh NKT1 są zdolne do produkcji dużych ilości IFN-γ, kluczowego dla
ich zaangażowania w odpowiedź przeciwwirusową czy przeciwnowotworową [51]. Stanowią dominującą subpopulację komórek iNKT wątroby
i śledziony modelu C57BL/6 myszy [55]. Subpopulacje GATA3high NKT2
i RORγt+ NKT17 są rzadkie w modelu B6 myszy, ale dominują w innych
szczepach [56]. NKT2 przeważają w płucach; zdają się odgrywać istotną
rolę w schorzeniach, których patogeneza związana jest z przewagą
limfocytów typu Th2 poprzez wydzielane cytokiny: IL-4, IL-9, IL-10 czy
IL-13 [52]. Aktualnie duże zainteresowanie wzbudzają komórki NKT17,
będące źródłem IL-17A. Cytokina ta posiada silne właściwości prozapalne,
indukując uwalnianie IL-6 oraz TNF-α; rekrutuje także neutrofile do
miejsca rozwijającej się reakcji zapalnej.Komórki NKT17 są przede
wszystkim odnajdywane w obwodowych węzłach chłonnych, skórze
i płucach [44, 45]. Zaobserwowano również występowanie komórek iNKT
z ekspresją czynnika transkrypcyjnego FoxP3+, które zachowują się
podobnie do regulatorowych limfocytów T, hamując proliferację innych
limfocytów T [57].Dwie prace, opublikowane w Nature Immunology [58]
oraz w Journal of Immunology [59] w 2012 roku wskazują na niewielką
subpopulację komórek iNKT, która tworzy stabilne i długotrwałeinterakcje
81
Małgorzata Waldowska, Wioleta Kowalska, Justyna Woś
z limfocytami B i indukuje powstawanie wczesnych ośrodków rozmnażania. W realizacji tego celu, ludzkie i mysie komórki NKTfh wydzielają
IL-21. Do ich powstania niezbędna jest ekspresja czynnika transkrypcyjnego Bcl-6 [58]. Niedawno pojawiły się również doniesienia o istnieniu
komórek NKT10, wykazujących ekspresję czynnika E4BP4. Poprzez
uwalnianie IL-10, subpopulacja ta może osłabiać odpowiedź przeciwnowotworową, a także chronić przed rozwojem chorób autoimmunologicznych (wykazano na mysim modelu stwardnienia rozsianego EAE
– experimental autoimmune encephalomyelitis) [53, 54, 60].
2.2. Komórki mNKT
Druga populacja kanonicznych komórek NKT została znacznie słabiej
poznana. Komórki mNKT (mucosal NKT), bo o nich mowa, wykazują
ekspresję niezmiennego łańcucha α receptora TCR, wykorzystując
najczęściej rearanżacjeVα19Jα33 (u myszy) lub Vα7.2Jα33 (u ludzi).
Łańcuch ten jest sparowany z łańcuchem β, powstającym w wyniku
rearanżacji ograniczonej puli genów (Vβ13, Vβ2 u ludzi, Vβ8.2, Vβ6
u myszy) [Tabela 1] [61, 62].Obserwacja, że komórki MAIT w ogóle nie
występują w obwodowych tkankach myszy wolnych od zarazków,
zasugerowała wpływ mikroflory na utrzymanie i rozwój tych komórek na
obwodzie [13]. Chociaż preferencyjnie komórki te gromadzą się w błonach
śluzowych jelit czy płuc [63], zlokalizowano je również we krwi, węzłach
chłonnych, wątrobie, śledzionie czy szpiku kostnym [19, 61]. Stąd komórki
mNKT zwykło się też nazywać komórkami MAIT (mucosal-associated
invariant T cells).
Komórki mNKT powstają w grasicy, gdzie podobnie do limfocytów
iNKT, przechodzą selekcję pozytywną. Ten etapdojrzewania, wiąże się
z ekspresjącząsteczek MR1 (MHC-related protein 1) [64]. W przeciwieństwie do komórek iNKT, komórki MAIT dojrzewają całkowicie
dopiero na obwodzie,zyskując profil komórek pamięci i funkcje efektorowe
[64, 65]. Udowodniono, iż myszy pozbawione ekspresji MR1 nie posiadają
komórek MAIT [13]. MR1 stanowi niepolimorficzną cząsteczkę MHC
klasy I, o wysokim stopniu homologii pomiędzy ludźmi a myszami [66].
Uważa się, że działa ona jako cząsteczka prezentująca antygeny [67].
Większość limfocytów mNKT jest podwójnie ujemnych (CD4-CD8-).
Chociaż u myszy nie występują populacje CD8α+, niektóre komórki Vα7.2
NKT posiadają ekspresję CD8[ 61]. Komórki te wykazują również obecność
markerów komórek NK, NK1.1 u myszy i CD161 u ludzi [19].
Podobnie jak iNKT, komórki mNKTsą zdolne do gwałtownego
uwalniania różnych cytokin, takich jak IL-4, IL-5, IL-10, IL-17 czy IFN-γ
[13, 19, 68]. Potrafią migrować do miejsc rozwoju reakcji zapalnej, gdzie
82
Fenotypowe i funkcjonalne zróżnicowanie populacji komórek NKT
poprzez wspomniane cytokiny wpływają na jej przebieg. Zaobserwowano
gromadzenie się ich w obrębie centralnego układu nerwowego oraz
w płynie mózgowo-rdzeniowym u pacjentów ze stwardnieniem rozsianym
[69]. W 2006 roku ten sam zespół przedstawił wyniki dokumentujące
ochronną rolę komórek Vα19Jα33 NKT w przebiegu EAE. Ich przewaga
łagodziła chorobę, natomiast niedobór pogarszał [70]. W badaniach
obserwowano również nasilenie aktywności komórek mNKT w odpowiedzi na zakażenia bakteryjne i grzybicze. Niewątpliwe znaczenie odgrywa
tutaj ich preferencyjna lokalizacja w obrębie błon śluzowych [71, 72].
Jednak przez długi czas, identyfikacja konkretnych antygenów prezentowanych przez cząsteczki MR1, nastręczała trudności. Dopiero publikacja
zespołu Kjer-Nielsen’az2012 roku, wskazująca na metabolity witaminy B2
pełniące rolę antygenów komórek MAIT, okazała się przełomową.
Zaobserwowano, że drobnoustroje pozbawione możliwości produkowania
ryboflawiny (np. Streptococcus pyogenes czy Enterococcus faecalis) nie
indukują aktywacji komórek mNKT w sposób zależny od MR1 [73].Jako
że stymulacja komórek mNKT może zachodzić również bez pośrednictwa
TCR/MR1 poprzez IL-12 oraz IL-18, zakłada się immunoregulatorowe
działanie komórek mNKT również wobec bakterii i wirusów niesyntetyzujących ryboflawiny [74].
3. NKT typ II
Komórki NKT typu II należą do CD1d-zależnych limfocytów T, jednak
w odróżnieniu od komórek typu I, nie odpowiadają na α-GalCer. Dlatego
bliższe poznanie tej subpopulacji stało się znacznie trudniejsze w porównaniu z iNKT. Ostatnie badania ukazują reaktywność tych komórek wobec
sulfatydu. Jednak zastosowanie tetrametrów sulfatyd/CD1d do identyfikacji
komórek NKT typu II nie jest powszechne, z uwagi na małą stabilność
wspomnianych tetramerów i wysokie barwienie tła [75].Wiedza zdobywana
o tych komórkach, opiera się przede wszystkim na badaniachprowadzonych na
mysich modelach modyfikowanych genetycznie. Myszy CD1d-nie posiadają
komórek NKT typu I i II, podczas gdy myszy Jα18-mają jedynie NKT typu I
[76]. Informacja o istnieniu omawianej populacji pojawiła się w literaturze po
raz pierwszy w 1995 roku [77], charakteryzując ją jako nieposiadającą
ekspresji niezmiennego łańcucha Vα14Jα18. Repertuar receptorów TCR
z których korzystają komórki NKT typu II jest zróżnicowany, stąd nazywane
są one także variant albo diverse NKT (vNKT lub dNKT) (Tabela 1). Należy
zaznaczyć, żeniektóre subpopulacje mysich dNKTwykazujączęsto ekspresję
Vα3.2Jα9 i Vα8 [78].Podobnie jak komórki NKT typu I, typ II obejmuje
populacje NK1.1+ i NK1.1- [79].Wiele z nich wykazuje fenotyp komórek
83
Małgorzata Waldowska, Wioleta Kowalska, Justyna Woś
aktywowanych lub pamięci z obecnością CD44high, CD69+, CD122+ na
swojej powierzchni [80].
Wydaje się, że komórki NKT typu II reagują głównie z własnymi
antygenami lipidowymi, choć mogą również rozpoznawać podobne
strukturalnie lipidy pochodzące z mikroorganizmów.Rozpoznanie przez ich
receptory TCR kompleksu ligand/CD1d, jest główną drogą prowadzącą do ich
aktywacji. Komórki NKT typu I dodatkowo mogą być pobudzane cytokinami,
obecnymi w podwyższonych stężeniach np. w czasie zapalenia [81]. Badania
wykazały, że stymulacja komórek NKT typu II, prowadzi do produkcji szeregu
cytokin, włącznie z IFN-γ, IL-2, IL-4, IL-10, IL-17, GM-CSF, a także
perforyny. Cecha ta pozwala im pełnić funkcje immunoregulatorowe.
Podobieństwa do komórek iNKT dotyczą także stałej ekspresji mRNA dla IL-4,
autoreaktywności, czy ekspresji czynnika transkrypcji PLZF [82]. Ponadto,
podobnie jak komórki NKT typu I, typ II może również posiadać
funkcjonalnie różne subpopulacje, a zatem niezwykle ważne jest określenie
korelacji stopnia funkcjonalnego zróżnicowania ze specyfiką rozpoznawanych
antygenów [55].
4. Rysunki
Rysunek 1. Model subpopulacji wyodrębnionych w ramach komórek iNKT, uwzgledniający
ekspresję odpowiednich czynników transkrypcyjnych i uwalniane cytokiny
Źródło: Opracowanie własne na podstawie [51, 54]
84
Fenotypowe i funkcjonalne zróżnicowanie populacji komórek NKT
5. Tabele
Tabela 1. Populacja komórek NKT i ich subpopulacje
mNKT (Vα19i
NKT,
Vα7.2i NKT,lub
komórki MAIT)
iNKT (Vα14i NKT,
Vα24iNKT, NKT
typ I, lub klasyczne
NKT)
Komórki vNKT
(NKT typ
II,dNKT, lub
nieklasyczne
NKT)
Vα19Jα33 (M)
Vα14-Jα18 (M)
Różne, niekiedy
Vα8, Vα3.2Jα9
(M)
Vα7.2Jα33 (H)
Vα24-Jα18 (H)
TCRα
Różne (H)
Vβ8.2, Vβ7, lub
Vβ2 (M)
Vβ8.1/8.2, Vβ6 (M)
TCRβ
Vβ13, Vβ2 (H)
Różne, niekiedy
Vβ8 (M)
Vβ11 (H)
Restrykcja
MR1
CD1d
CD1d
Reaktywność
αManCer
αGalCer
sulfatyd
DN, CD4+ (M)
CD4+, DN (M)
DN, CD4+, CD8α+
(H)
CD4+, DN, CD8α+
(H)
NK1.1 (M)
NK1.1 (M)
CD161 (H)
CD161 (H)
Komórek
aktywowanych/
pamięci
Komórek
aktywowanych/
pamięci
Obecność
koreceptorów
Obecność
receptora
komórek NK
Fenotyp na
obwodzie
CD4+, DN
NK1.1
85
Komórek
aktywowanych/
pamięci
Małgorzata Waldowska, Wioleta Kowalska, Justyna Woś
Lokalizacja
w stanie
spoczynku
Śledziona, wątroba,
tarczyca, szpik
kostny, węzły
chłonne, krew
obwodowa, tk.
tłuszczowa, skóra,
błona śluzowa jelit
i płuc
Blaszka właściwa
płuc, wątroba
Wątroba,
śledziona
Źródło: Opracowanie własne na podstawie [13,55, 61, 68, 83] Skróty: cNKT (canonical natural
killer T), iNKT (invariant NKT), mNKT (mucosal NKT), vNKT (variant NKT), dNKT (diverse
NKT), MAIT (mucosal associated invariant T cells), DN (double negative), αManCer(αmannosylceramide), αGal-Cer (α-galactosylceramide), MHC (major histocompatibility complex),
TCR (T cell antigen receptor)
6. Podsumowanie
Komórki NKT stanowią niezwykłą populację limfocytów T, występującą
zarówno u myszy, jak i u ludzi. Ich immunologiczny potencjał, pozwala
patrzeć z optymizmem na wykorzystanie ich w przyszłości jako efektywnych
narzędzi we wzmacnianiu odpowiedzi przeciwnowotworowej. Kroki, jakie
zostały poczynione w sferze bliższego poznania populacji komórek NKT,
pozwoliły na wyodrębnienie różnych subpopulacji tych komórek,
przedstawionych w tej pracy. Niemniej niezbędne są dalsze badania,
poświęcone głębszemu poznaniu subpopulacji komórek NKT typu I (NKT1,
NKT2, NKT17, NKT10, NKTreg, NKTfh), komórek mNKT, czy NKT typu
II, oraz ich interakcji z innymi komórkami naszego układu immunologicznego.
Literatura
1.
2.
3.
4.
5.
Godfrey D. I., Hammond K. J., Poulton L. D., Smyth M. J., Baxter A. G., NKT
cells: facts, functions and fallacies, Immunology Today, 21 (2000), s.573-583
Taniguchi M., Seino K., Nakayama T., The NKT cell system: bridging innate
and acquired immunity, NatureImmunology, 4 (2003), s. 1164-1165
Kitamura H., Iwakabe K., Yahata T., Nishimura S., Ohta A., Ohmi Y., Sato
M., Takeda K., Okumura K., Van Kaer L.,The natural killer T (NKT) cell
ligand alpha-galactosylceramide demonstrates its immunopotentiating effect
by inducing interleukin (IL)-12 production by dendritic cells and IL-12
receptor expression on NKTcells, The Journal of experimentalmedicine,
189 (1999), s.1121-1128
Terabe M., BerzofskyJ. A., The Role of NKT Cells in Tumor Immunity,
Advances in cancer research, 101 (2008), s. 277-348
Beckman E. M., Porcelli S. A., Morita C. T., Behar S. M., Furlong S. T.,
Brenner M. B., Recognition of a lipid antigen by CD1-restricted alpha beta+
T cells, Nature, 372 (1994), s. 691-694.
86
Fenotypowe i funkcjonalne zróżnicowanie populacji komórek NKT
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
Bendelac A., Rivera M. N., Park S., Roark J. H., Mouse CD1-specific NK1 T
cells: development, specificity, and function, Annual Review of Immunology,
15 (1997), s. 535-562
Godfrey D. I., MacDonald H. R., Kronenberg M., Smyth M. J., Van Kaer L., NKT
cells: what‘s in a name?, Nature Reviews Immunology, 4 (2004), s. 231-237
Godfrey D. I., Kronenberg M., Going both ways: Immune regulation via
CD1d-dependent NKT cells, The Journal of Clinical Investigation, 114 (2004),
s. 1379-1388
Matsuda J. L., Mallevaey T., Scott-Browne J., Gapin L., CD1d-restricted
iNKT cells, the ―Swiss-Army knife‖ of the immune system, Current Opinion
in Immunology, 20(2008), s. 358-368
Terabe M., Berzofsky J. A., NKT cells in immunoregulation of tumor immunity:
a new immunoregulatory axis, Trends in Immunology, 28(2007), s. 491-496
Porcelli S., Brenner M. B., Greenstein J. L., Balk S. P., Terhorst C., Bleicher
P. A., Recognition of cluster of differentiation 1 antigens by human CD4-CD8cytolytic T lymphocytes, Nature,341(1989), s. 447-50
Porcelli S., Morita C. T., Brenner M. B., CD1b restricts the response of human
CD4-8- T lymphocytes to a microbial antigen, Nature,360 (1992), s. 593-597
Treiner E., Duban L., Bahram S., Radosavljevic M., Wanner V., Tilloy F.,
Affaticati P., Gilfillan S., Lantz O., Selection of evolutionarily conserved
mucosal-associated invariant T cells by MR1,Nature, 422(2003), s. 164-9
Kawano T., Cui J., Koezuka Y., Toura I., Kaneko Y., Motoki K., Ueno H.,
Nakagawa R., Sato H., Kondo E., Koseki H., Taniguchiet M., CD1d-restricted
and TCR-mediated activation of valpha14 NKT cells by glycosylceramides,
Science, 278 (1997), s. 1626-1629
Dellabona P., Casorati G., Friedli B., Angman L., Sallusto F., Tunnacliffe A.,
Roosneek E., Lanzavecchia A., In vivo persistence of expanded clones specific
for bacterial antigens within the human T cell receptor alpha/beta CD4-8subset, The Journal of Experimental Medicine, 177 (1993), s. 1763-1771
Bendelac A., Lantz O., Quimby M. E., Yewdell J. W., Bennink J. R.,
Brutkiewicz R. R., CD1 recognition by mouse NK1+ T lymphocytes, Science,
268 (1995), s. 863-865
Hashimoto K., Hirai M., Kurosawa Y., A gene outside the human MHC
related to classical HLA class I genes, Science, 269 (1995), s. 693-695
Treiner E., Lantz O., CD1d- and MR1-restricted invariant T cells: of mice
and men, Current Opinion in Immunology,18 (2006), s.519-526
Kawachi I., Maldonado J., Strader C., Gilfillan S., MR1-restricted Vα19i
mucosal-associated invariant T cells are innate T cells in the gut lamina
propria that provide a rapid and diverse cytokine response, The Journal
of Immunology,176 (2006), s.1618-1627
Mallevaey T., Selvanantham T., Strategy of lipid recognition by invariant natural
killer T cells: ‗one for all and all for one‘, Immunology, 136 (2012), s. 273-282
Porcelli S. A., Segelke B. W., Sugita M., Wilson I. A., Brenner M. B., The
CD1 family of lipid antigen-presenting molecules, Immunology Today, 19
(1998), s. 362-368
87
Małgorzata Waldowska, Wioleta Kowalska, Justyna Woś
22. Nieda M., Nicol A., Koezuka Y., Kikuchi A., Takahashi T., Nakamura H.,
Furukawa H., Yabe T., Ishikawa Y., Tadokoro K., Juji T., Activation
of humanVα24 NKT cells by alpha-glycosylceramide in a CD1d-restricted
and Vα24 TCR-mediated manner, HumanImmunology, 60 (1999), s. 10-19
23. Sidobre S., Naidenko O. V., Sim B. C., Gascoigne N. R., Garcia K. C.,
Kronenberg M., The V alpha 14 NKT cell TCR exhibits high-affinity binding
to a glycolipid/CD1d complex, The Journal of Immunology, 169 (2002),
s. 1340-1348
24. Benlagha K., Weiss A., Beavis A., Teyton L., Bendelac A., In vivo
identification of glycolipid antigen-specific T cells using fluorescent CD1d
tetramers, The Journal of Experimental Medicine,191 (2000), s. 1895-1903
25. Lantz O., Bendelac A., An invariant T cell receptor alpha chain is used by
a unique subset of major histocompatibility complex class I-specific CD4+
and CD4-8- T cells in mice and humans, The Journal of Experimental
Medicine, 180 (1994), s. 1097-1106
26. Kronenberg M., Toward an understanding of NKT cell biology: progress and
paradoxes, Annual Review of Immunology, 23 (2005), s. 877-900
27. Eberl G., Lees R., Smiley S. T., Taniguchi M., Grusby M. J., MacDonald H.
R., Tissue-specific segregation of CD1d-dependent and CD1d-independent
NKT cells,The Journal of Immunology, 162(1999), s. 6410-6419
28. IshihiraS., Nieda M., Kitayama J., Osada T., Yabe T., Ishikawa Y., Nagawa
H., Muto T., Juji T., CD8+NKR-P1A+ T cells preferentially accumulate in
human liver, European Journal of Immunology, 29 (1999), s. 2406-2413
29. McNab F. W., Pellicci D. G., Filed K., Besra G., Smyth M. J., Godfrey D. I.,
Berzins S. P., Peripheral NK1.1 NKT cells are mature and functionally
distinct from their thymic counterparts, Journal of Immunology, 179 (2007),
s. 6630-6637
30. Bendelac A., Matzinger P., Seder R. A., Paul W. E., Schwartz R. H.,
Activation events during thymic selection, The Journal of Experimental
Medicine, 175 (1992), s. 731-742
31. Gadola S. D., Dulphy N., Salio M., Cerundolo V., Valpha24-Jalpha Cindependent, Cd1d-restricted recognition of alpha-galactosylceramide
by human CD4(+) an CD8alpha(+) T lymphocytes, Journal of Immunology,
168 (2002), s. 5514-5520
32. Bendelac A., Rivera M. N., Park S. H., Roark J. H., Mouse CD1-specific NK1
T cells: development, specificity, and function, Annual Review of
Immunology, 15 (1997), s. 535-562
33. Kenna T., Mason L. G., Porcelli S. A., Koezuka Y., Hegarty J. E., O’Farrelly
C., Doherty D. G., NKT cells from normal and tumor-bearing human livers
are phenotypically and functionally distinct from murine NKT cells, The
Journal of Immunology, 171 (2003), s. 1775-1779
34. Lee P. T., Putnam A., Benlagha K., Teyton L., Gottlieb P. A., Bendelac A.,
Testing the NKT cell hypothesis of human IDDM pathogenesis, The Journal
of Clinical Investigation, 110 (2002), s. 793-800
35. Slauenwhite D., Johnston B., Regulation of NKT cell localization
in homeostasis and infection, Frontiers in Immunology, 6 (2015), 255
88
Fenotypowe i funkcjonalne zróżnicowanie populacji komórek NKT
36. Bendelac A., Savage P. B., Teyton L., The biology of NKT cells, Annual
Review of Immunology, 25 (2007), s. 297-336
37. Umetsu D. T., Dekruyff R. H., Natural killer T cells are important in the
pathogenesis of asthma: the many pathways to asthma, The Journal of Allergy
and Clinical Immunology, 125 (2010), s. 975-979
38. Tupin E., Kinjo Y., Kronenberg M., The unique role of natural killer T cells
in the response to microorganisms, Nature reviewsImmunology, 5 (2007), s.
405-417
39. Smyth M. J., Crowe N. Y., Pellicci D. G., Kyparissoudis K., Kelly J. M.,
Takeda K., Yagita H., Godfrey D. I., Sequentialproduction of interferongamma by NK1.1(+) T cells and natural killer cells is essential for the
antimetastatic effect of alpha-galactosylceramide, Blood, 99 (2002), s. 12591266
40. Paget C., Trottein F., Role of type 1 natural killer T cells in pulmonary
immunity, Mucosal Immunology, 6 (2013), s. 1054-1067
41. Fais F., Tenca C., Cimino G., Coletti V., Zanardi S., Bagnara D., Saverino D.,
Zarcone D., De Rossi G., Ciccone E., Grossi C. E., CD1d expression on Bprecursor acute lymphoblastic leukemia subsets with poor prognosis,
Leukemia, 19 (2005), s. 551-556
42. Song L., Asgharzadeh S., Salo J., Engell K., Wu H., Sposto R., Ara T.,
Silverman A. M., DeClerck Y. A., Seeger R. C., MetelitsaL. S., Vα24invariant NKT cells mediate antitumor activity via killing of tumor-associated
macrophages, The Journal of clinical investigation, 119 (2009), s. 1524-1536
43. Stetson D. B., Mohrs M., Reinhardt R. L., Baron J. L., Wang Z. E., Gapin
L., Kronenberg M., Locksley R. M., Constitutive cytokine mRNAs mark
natural killer (NK) and NK T cells poised for rapid effector function, The
Journal of Experimental Medicine, 198 (2003), s.1069-1076
44. Coquet J. M., Chakravart S., Kyparissoudis K., McNab F. W., Pitt L. A.,
McKenzie B. S., Berzins S. P., Smyth M. J., Godfrey D. I., Diverse cytokine
production by NKT cell subsets and identification of an IL-17–producing
CD4−NK1.1− NKT cell population, Proceedings of the National Academy
of Sciences of the United States of America, 105 (2008), s. 11287-11292
45. Michel M. L., Keller A. C., Paget C., Fujio M., Trottein F., Savage P. B.,
Wong C. H., Schneider E., Dy M., Leite-de-Moraes M. C., Identification
of an IL-17-producing NK1.1-iNKT cell population involved in airway
neutrophilia, The Journal of Experimental Medicine, 204 (2007), s. 995-1001
46. Smyth M. J., Godfrey D. I., NKT cells and tumor immunity – a double-edged
sword,Nature Immunology, 1 (2000), s. 459-460
47. Gumperz J. E., Miyake S., Yamamura T., Brenner M. B., Functionally distinct
subsets of CD1d-restricted natural killer T cells revealed by CD1d tetramer
staining, The Journal of Experimental Medicine, 195 (2002), s. 625-36
48. Godfrey D. I., Stankovic S., Baxter A. G.Rasing the NKT cell family, Nature
Immunology, 11 (2010), s. 533-555
49. Akbari O., Stock P., Meyer E., Kronenberg M., Sidobre S., Nakayama
T.,Grusby M. J., DeKruyff R. H., Umetsu D.T., Essential role of NKT cells
89
Małgorzata Waldowska, Wioleta Kowalska, Justyna Woś
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
producing IL-4 and IL-13 in the development of allergen-induced airway
hyperreactivity, Nature Medicine, 9 (2003), s. 582-588
Crowe N. Y., Coquet J. M., Berzins S. P., Kyparissoudis K., Keating R.,
Pellicci D. G., Hayakawa Y., Godfrey D. I., Smyth M. J., Differential
antitumor immunity mediated by NKT cell subsets in vivo,The Journal
of Experimental Medicine,202(2005), s. 1279-1288
Lee Y. J., Holzapfel K. L., Zhu J., Jameson S. C., Hogquist K. A., Steady state
production of IL-4 modulates immunity in different strains and is determined
by lineage diversity of iNKT cells, Nature Immunology, 14(2013),
10.1038/ni.2731
Watarai H., Sekine-Kondo E., Shigeura T., Motomura Y., Yasuda T., Satoh
R., Yoshida H., Kubo M., Kawamoto H., Koseki H., Taniguchi M.,
Development and function of invariantnaturalkiller T cells producing T(h)2and T(h)17-cytokines, PLoS Biology, 10(2012), e1001255
Sag D., Krause P., Hedrick C. C., Kronenberg M., Wingender G., IL-10producing NKT10 cells are a distinct regulatory invariant NKT cell subset,
The Journal of Clinical Investigation, 124 (2014), s. 3725-40
Wingender G., Sag D.,Kronenberg M., NKT10 cells: a novel iNKT cell
subset,Oncotarget, 6 (2015), s. 26552-26553
Macho-Fernandez E., Brigl M., The extended family of CD1drestricted NKT
cells: sifting through a mixed bag of TCRs, antigens, and functions, Frontiers
in Immunology, 6 (2015), 362
Constantinides M. G., Bendelac A., Transcriptional regulation of the NKT cell
lineage, Current Opinion in Immunology, 25 (2013), s. 161-167
Moreira-Teixeira L., Resende M., Devergne O., Herbeuval J. P., Hermine O.,
Schneider E., Dy M., Cordeiro-da-Silva A., Leite-de-Moraes M. C., Rapamycin
combined with TGF-beta converts human invariant NKT cells into suppressive
Foxp3+ regulatory cells, Journal of Immunology, 188 (2012), s. 624-631
Chang P. P., Barral P., Fitch J., Pratama A., Ma C. S., Kallies A., Hogan J. J.,
Cerundolo V., Tangye S. G., Bittman R., Nutt S. L., Brink R., Godfrey D. I.,
Batista F. D., Vinuesa C. G., Identification of Bcl-6-dependent follicular
helper NKT cells that provide cognate help for B cell responses,Nature
Immunology, 13 (2012), s. 35-43
Tonti E., Fedeli M., Napolitano A., Iannacone M., von Andrian U. H., Guidotti
L. G., Abrignani S., Casorati G., Dellabona P., Follicular helper NKT cells
induce limited B cell responses and germinal center formation in the absence
of CD4(+) T cell help,Journal of Immunology, 188 (2012), s. 3217-3222
Lynch L., Michelet X., Zhang S., Brennan P. J., Moseman A., Lester C.,
Regulatory iNKT cells lack expression of the transcription factor PLZF and
control the homeostasis of T cells and macrophages in adipose tissue, Nature
Immunology, 16 (2014), s. 85-95
Tilloy F., Treiner E., Park S. H., Garcia C., Lemonnier F., de la Salle H.,
Bendelac A., Bonneville M., Lantz O., An invariant T cell receptor α chain
defines a novel TAP-independent major histocompatibility complex class
Ib-restricted α/β T cell subpopulation in mammals,The Journal
of Experimental Medicine, 189 (1999), s. 1907-1921
90
Fenotypowe i funkcjonalne zróżnicowanie populacji komórek NKT
62. Reantragoon R., Kjer-Nielsen L., Patel O., Chen Z., Illing P.T., Bhati M.,
Kostenko L., Bharadwaj M., Meehan B., Hansen T. H., Godfrey D. I.,
Rossjohn J., McCluskey J., Structural insight into MR1-mediated recognition
of the mucosal associated invariant T cell receptor,The Journal of
Experimental Medicine,209 (2012), s. 761-774
63. Dusseaux M., Martin E., Serriari N., Peguillet I., Premel V., Louis D.,Milder
M., Le Bourhis L., Soudais C., Treiner E., Lantz O., Human MAIT cells are
xenobiotic-resistant, tissue-targeted, CD161hi IL-17-secreting T cells, Blood,
117 (2011), s. 1250-1259
64. Seach N., Guerri L., Le Bourhis L., Mburu Y., Cui Y., Bessoles S., Soudais
C., Lantz O., Double-positive thymocytes select mucosal-associated invariant
T cells,Journal of Immunology, 191(2013), s. 6002-6009
65. UssherJ. E., Klenerman P., Willberg C. B., Mucosal-Associated Invariant
T-Cells: New Players in Anti-Bacterial Immunity, Frontiers Immunology,
5 (2014), 450
66. Szabo P. A., Anantha R. V., Shaler C. R., McCormick J. K., Haeryfar S. M.
M., CD1d- and MR1-restricted T cells in sepsis, Frontiers in Immunology,
6 (2015), 401
67. Miley M. J., Truscott S. M., Yu Y. Y., Gilfillan S., Fremont D. H., Hansen T. H.,
Lybarger L., Biochemical features of the MHC-related protein 1 consistent with
an immunological function, Journal of Immunology, 170 (2003), s. 6090-6098
68. Wingender G., Kronenberg M., Role of NKT cells in the digestive system. IV.
The role of canonical natural killer T cells in mucosal immunity and
inflammation, American Journal of Physiology- Gastrointestinal and Liver
Physiology, 294 (2008), G1-G8
69. Illes Z., Shimamura M., Newcombe J., Oka N., Yamamura T., Accumulation
of Vα7.2-Jα33 invariant T cells in human autoimmune inflammatory lesions
in the nervous system, International Immunology, 16 (2004), s. 223-230
70. Croxford J. L., Miyake S., Huang Y. Y., Shimamura M., Yamamura T.,
Invariant V(α)19i T cells regulate autoimmune inflammation, Nature
Immunology, 7 (2006), s. 987-994
71. Gold M. C., Cerri S., Smyk-Pearson S., Cansler M. E., Vogt T. M., Delepine
J., Winata E., Swarbrick G. M., Chua W. J., Yu Y. Y., Lantz O., Cook M. S.,
Null M. D., Jacoby D. B., Harriff M. J., Lewinsohn D. A., Hansen T. H.,
Lewinsohn D. M., Human mucosal associated invariant T cells detect
bacterially infected cells,PLoS Biology,8 (2010), e1000407
72. Chua W. J., Truscott S. M., Eickhoff C. S., Blazevic A., Hoft D. F., Hansen T.
H., Polyclonal mucosa-associated invariant T cells have unique innate functions
in bacterial infection, Infection and Immunity, 80 (2012), s. 3256-3267
73. Kjer-Nielsen L., Patel O., Corbett A. J., Le Nours J., Meehan B., Liu L., Bhati
M., Chen Z., Kostenko L., Reantragoon R., Williamson N. A., Purcell A. W.,
Dudek N. L., McConville M. J., O'Hair R. A., Khairallah G. N., Godfrey D. I.,
Fairlie D. P., Rossjohn J., McCluskey J., MR1 presents microbial vitamin B
metabolites to MAIT cells, Nature, 491 (2012), s. 717-723
91
Małgorzata Waldowska, Wioleta Kowalska, Justyna Woś
74. Salio M., Cerundolo V., Regulation of Lipid Specific and Vitamin Specific
Non-MHC Restricted T Cells by Antigen Presenting Cells and Their
Therapeutic Potentials, Frontiers in Immunology, 6 (2015), 388
75. Blomqvist M., Rhost S., Teneberg S.,Löfbom L., Osterbye T., Brigl M.,
Månsson J. E., Cardell S. L., Multiple tissue-specific isoforms of sulfatide
activate CD1d-restricted type II NKT cells, European Journal of Immunology,
39(2009), s. 1726-1735
76. Chen Y. H., Chiu N. M., Mandal M., Wang N., Wang C. R., Impaired NK1+ T
cell development and early IL-4 production in CD1- deficient mice, Immunity,
6 (1997), s. 459-467
77. Cardell S., Tangri S., Chan S., Kronenberg M., Benoist C., Mathis D., CD1restricted CD4+ T cells in major histocompatibility complex class II-deficient
mice, The Journal of Experimental Medicine, 182 (1995), s. 993-1004
78. Park S. H., Weiss A., BenlaghaK., Kyin T., Teyton L., Bendelac A., The
mouse CD1d-restricted repertoire is dominated by a few autoreactive T cell
receptor families,The Journal of Experimental Medicine, 193(2001), s. 893-904
79. Chiu Y. H., Jayawardena J., Weiss A., Lee D., Park S. H., Dautry-Varsat A.,
Bendelac A., Distinct subsets of CD1d-restricted T cells recognize selfantigens loaded in different cellular compartments, The Journal of
Experimental Medicine, 189(1999), s. 103-10
80. Weng X., Liao C. M., Bagchi S., Cardell S. L., Stein P. L., Wang C. R.,
The adaptor protein SAP regulates Type II NKT cell development, cytokine
production and cytotoxicity against lymphoma, European Journal
of Immunology, 44 (2014), s. 3646-3657
81. Marrero I., Ware R., Kumar V., Type II NKT cells in inflammation,
autoimmunity, microbial immunity, and cancer,Frontiers in Immunology,
6 (2015), 00316
82. Zhao J., Weng X., Bagchi S., Wang C. R., Polyclonal type II natural killer
T cells require PLZF and SAP for their development and contribute to CpGmediated antitumor response, Proceedings in the National Academy
of Sciences U S A, 111 (2014), s. 2674-2679
83. Takahashi T., Chiba S., Nieda M., Azuma T., Ishihara S., Shibata Y., Juji T.,
Hirai H., Cutting edge: analysis of human V alpha 24+CD8+ NK T cells
activated by alpha-galactosylceramide-pulsed monocyte-derived dendritic
cells, The Journal of Immunology, 168 (2002), s. 3140-3144
92
Fenotypowe i funkcjonalne zróżnicowanie populacji komórek NKT
Fenotypowe i funkcjonalne zróżnicowanie populacji komórek NKT
Komórki NKT stanowią istotną grupę komórek uczestniczących w modulowaniu odpowiedzi
immunologicznej. Łączą cechy komórek NK (naturalkiller) oraz limfocytów T. Tak jak komórki
NK, z łatwością odpowiadają na stymulację antygenem i uwalniają liczne cytokiny i chemokiny,
wpływając w ten sposób na inne komórki układu immunologicznego. Ponadto, wykazują one
również cechy konwencjonalnych limfocytów T, posiadając na swojej powierzchni receptory
TCR. Klasycznie komórki NKT dzieli się na dwie główne grupy: komórki NKT typu I i typu II.
Jednak ostatnie badania wskazują na głębszą kompleksowość w tej materii i istnienie różnych
subpopulacji w obrębie komórek NKT, z ekspresją odpowiednich czynników transkrypcyjnych
iunikalnym profilem uwalnianych cytokin. Pozwala to na częściowe wyjaśnienie funkcjonalnych
różnic przypisywanych komórkom NKT. W artykule dokonujemy podsumowania aktualnej
wiedzy dotyczącej subpopulacji komórek NKT.
Phenotypic and functional heterogeneity of NKT population
Natural killer T (NKT) cells are an important mediator of immune responses. They possess
features of NK (natural killer) cells and T lymphocytes. Like innately functioning NK cells, they
swiftly respond to antigen stimulation and produce multiple cytokines and chemokines, to
influence other elements of the immune system. But they also share features with conventional
T lymphocytes by expressing T cell receptors (TCR). NKT cells have been divided into two
major subsets, including type I and type II. However, recent studies revealed the existence
of distinct lineages of NKT cells with a unique profile of secreted cytokines and transcription
factors. It can therefore explain the remarkable versatility of functions, assigned NKT cells. Here,
we summarize the actual knowledge concerning NKT subpopulations.
93
Martyna Bednarczyk1, Urszula Mazurek2, Małgorzata Muc-Wierzgoń1
Profil ekspresji genów
zaangażowanych w autofagię
w różnicowaniu komórek raka jelita grubego
1. Wstęp
Autofagia, inaczej samotrawienie, oznacza wysoce zachowawczy
filogenetycznie mechanizm, dzięki któremu degradowane są wszystkie
uszkodzone białka oraz organelle komórkowe. Występuje u wszystkich
organizmów eukariotycznych. Istniejące dowody wskazują, że autofagia
odpowiada za regulację różnych funkcji komórkowych, obejmujących
wzrost, różnicowanie, odpowiedź na niedobór składników odżywczych
oraz stres oksydacyjny, a także śmierć komórki [1, 2, 3, 4]. Cechą
charakterystyczną tego procesu jest to, że nie jest jedynie synonimem
śmierci komórki, w przeciwieństwie do apoptozy. Niedawno podkreślono,
że może również być mechanizmem adaptacyjnym, umożliwiającym
przeżycie komórki w niekorzystnych warunkach, na przykład podczas
niedotlenienia lub niedoboru składników odżywczych [2, 5]. Uważa się, że
wadliwy szlak autofagii lub błędy w genach związanych z autofagią leżą
u podstaw patogenezy wielu chorób, w tym chorób neurodegeneracyjnych,
chorób płuc lub nowotworów [6, 7].
W zależności od sposobu dostarczenia białka do lizosomu, wyróżniamy
cztery rodzaje autofagii: swoistą (na przykład mitofagię, lipofagię,
peksofagię, rybofagię), mikroautfagię, makroautofagię oraz autofagię
zależną od białek opiekuńczych (chaperonów) [2, 8]. Mikroautofagia jest
nieselektywnym procesem, podczas którego białko przeznaczone do
degradacji zostaje bezpośrednio wchłonięte do lizosomu, gdzie dochodzi do
jego hydrolizy. Jest to najmniej popularny rodzaj autofagii, który do końca
jeszcze nie został poznany, a jego rola w procesie nowotworzenia do tej
pory jest niewyjaśniona [2, 9, 10]. Autofagia zależno od chaperonów różni
się od pozostałych rodzajów obecnością w białkach substratowych
pentapeptydu Lys – Phe – Glu – Arg – Gln (KFERQ), pełniącego funkcję
sekwencji kierującej do lizosomy [11]. Motyw ten obecny jest w około
1
[email protected], Katedra i Oddział Kliniczny Chorób Wewnętrznych,
Wydział Zdrowia Publicznego w Bytomiu, Śląski Uniwersytet Medyczny
2
[email protected], Katedra i Zakład Biologii Molekularnej, Wydział Farmaceutyczny
z Oddziałem Medycyny Laboratoryjnej w Sosnowcu, Śląski Uniwersytet Medyczny
94
Profil ekspresji genów zaangażowanych w autofagię
w różnicowaniu komórek raka jelita grubego
30% białek cytozolowych. Białko szoku cieplnego HSP70 wiąże się
z substratem, następnie sekwencja KFERQ rozpoznawana jest przez
receptor LAMP2A obecny w błonie lizosomalnej. Białko substratowe
dostaje się do wnętrza lizosomu, gdzie ulega degradacji [2, 6, 12, 13].
Podczas makroautofagii zniszczeniu ulegają znacznie większe struktury niż
w przypadku poprzednich procesów. Jest to najczęściej występująca forma
autofagii. Degradacja białek zachodzi za pośrednictwem specjalnej
struktury, autofagosomu. Proces regulowany jest przez produkty genów
Atg, zidentyfikowanych po raz pierwszy u drożdży. Najważniejszymi
białkami uczestniczącymi w tym procesie są: kompleks kinazy ULK1/2,
białko błonowe Atg9, kompleks kinazy PI3K – III oraz ubikwitynopodobne
systemy sprzęgania Atg12 i Atg9 [2,9, 10, 14].
W procesie autofagii wyróżniamy cztery podstawowe fazy: inicjację,
elongację fagoforu, dojrzewanie autofagosomu, jego fuzję z lizosomem
oraz degradację zawartości. W przebieg tych faz zaangażowanych jest
ponad 30 genów [4].
Autofagia indukowana jest przede wszystkim niedoborem składników
odżywczych lub podczas niedotlenienia [15]. W inicjacji tego procesu
uczestniczy kinaza ULK1, białko FIP200, mAtg13 (nośnik sygnału do
rozpoczęcia autofagii) oraz Atg101. Ten etap kontrolowany jest przede
wszystkim aktywnością kinazy mTOR (ssaczy cel dla rapamycyny).
Podczas aktywacji mTOR autofagia ulega zahamowaniu [8, 12, 16].
Mechanizm autofagii rozpoczyna się od wstępnego formowania
fagoforu (nukleacja) oraz jego stopniowego wydłużania na kształt litery C.
Fagofor powstaje w wyniku fuzji wielu pęcherzyków pochodzących
z retikulum endoplazmatycznego. W ten etap zaangażowana jest kinaza 3fosfatydyloinozytolu (PI3K-III), Beklina 1 oraz kinaza serynowa p150.
Ważną rolę odgrywa tu również białko Atg9, dostarczające składników
lipidowych koniecznych do powstania błony fagosomu. Atg9 oddziałuje
z białkiem Atg2, dzięki czemu możliwe jest utworzenie błony izolującej [2,
8, 16]. Białka antyapoptotyczne BCL-2 oraz BCL-XL hamują aktywność
kompleksu Beklina1 : PI3K : p150 [4].
Dalszym etapem jest elongacja (wydłużanie fagoforu), gdzie
uczestniczą dwa ubikwitynopodobne kompleksy białek: Atg12-Atg5 oraz
LC3-II-fostatydyloetanoloamina (LC3-II-PE). W tworzenie pierwszego
systemu koniugacyjnego (Atg12-Atg5) zaangażowane są cztery białka:
Atg5, 7, 10 i 12. Białko Atg12 wiąże się kowalencyjnie z Atg5. W
następnym etapie powstały kompleks Atg12-Atg5 wiąże się z białkiem
Atg16L, zachodzi multimeryzacja i utworzony zostaje tetramer Atg12Atg5-Atg16L uczestniczący w elongacji fagoforu. Naukowcy twierdzą, że
ten kompleks bierze udział w jego zakrzywieniu. W momencie powstania
dojrzałego autofagosomu, białko Atg16L oddysocjowuje, co świadczy
95
Martyna Bednarczyk, Urszula Mazurek, Małgorzata Muc-Wierzgoń
o tym, że nie może stanowić markera procesu autofagii. Następie dochodzi
do aktywacji drugiego ubikwitynopodobnego kompleksu LC3-II-PE. LC3
jest białkiem związanym z mikrotubulami, znajduje się w cytozolu
i syntetyzowane jest jako prekursor pro-LC3. Forma pro-LC3 w wyniku
cięcia przez Atg4 ulega przemianie do LC3-I, do którego przyłącza się
białko Atg7, Atg3 oraz powstały niedawno kompleks Atg12-Atg5-Atg16L.
W kolejnym etapie LC3-I przyłącza lipofilną fosfatydyloetanoloaminę (PE)
i przekształca się w formę LC3-II. W następstwie tych zdarzeń z fagoforu
powstaje autofagosom. LC3-II uznaje się za wiarygodny marker autofagii,
ponieważ jego stężenie jest proporcjonalne do liczby powstałych
autofagosomów. W ostatnim etapie błona autofagosomu ulega fuzji
z lizosomom, powstaje autofagolizosom, w którym dochodzi do trawienia
białek przeznaczonych do degradacji, dzięki obecności enzymów
lizosomalnych [2, 8, 12].
Rysunek 1 przedstawia schemat przebiegu autofagii.
Rysunek 1. Przebieg autofagii [2]
Od dawna wiadomo, że autofagia bierze udział w patogenezie chorób
nowotworowych, w tym raka jelita grubego [5]. W warunkach fizjologicznych, jeśli występuje odpowiedni poziom składników odżywczych, jest
obecna w większości tkanek, wpływając na utrzymanie homeostazy komórkowej. Uszkodzone białka i organelle ulegają degradacji. W przypadku,
kiedy zmniejsza się poziom autofagii, komórki tracą zdolność do usuwania
materiałów i zaczynają akumulować cytotoksyczne składniki, co w efekcie
może prowadzić do onkogenezy [2].
Uważa się, że ma dwojaki wpływ na rozwój choroby nowotworowej,
korzystny, jak i niekorzystny. Pozytywnym skutkiem jest to, że działa
supresorowo na guz ograniczając wielkość komórek rakowych i usuwając
uszkodzone białka mogące wzmagać proces mutagenny. Natomiast za
negatywne działanie uznaje się to, że autofagia może przyczyniać się do
96
Profil ekspresji genów zaangażowanych w autofagię
w różnicowaniu komórek raka jelita grubego
przeżycia komórek rakowych nawet w środowisku ubogim w składniki
odżywcze [17].
Rola autofagii w kancerogenezie nie została jeszcze dokładnie poznana
i może zależeć od wielu czynników, na przykład od stopnia zaawansowania
choroby lub od mutacji genów obecnych w określonym typie nowotworu
[4, 18]. Poza tym niektórzy badacze donoszą, że zahamowanie autofagii
hamuje rozwój nowotworów, a co za tym idzie może być skutecznym
sposobem leczenia raka jelita grubego. Drugim istotnym faktem jest to, że
lizosomy przyczyniają się do rozwoju lekooporności komórek nowotworowych i blokują proces autofagii [5, 19]. Ponadto we wczesnym
stadium choroby autofagia może przyczyniać się do hamowania
przerzutów, dzięki indukcji reakcji zapalnej. Zapobiega również inicjacji
nowotworu. Natomiast w późnym stadium sprzyja progresji lub
powstawaniu przerzutów, poprzez zwiększenie przeżywalności komórek
w warunkach niedotlenienia lub braku składników odżywczych [2, 20].
Aktualne metody leczenia raka jelita grubego obejmują chirurgię,
radioterapię oraz chemioterapię. Rodzaj leczenia zależy od stopnia
zaawansowania choroby. Prowadzone są nadal badania nad opracowaniem
nowych metod leczenia, z naciskiem na metody molekularne [21]. Jednym
z najbardziej obiecujących celów terapeutycznych ostatnich lat, wydaje się
być proces autofagii. Chociaż rola autofagii w rozwoju nowotworów jest
tematem kontrowersyjnym, wiadomo, że w przypadku raka jelita grubego,
wzrasta jej aktywność. Zaobserwowano wzrost ekspresji genów LC3
i BECN1 w komórkach guzów w porównaniu z tkankami niezmienionymi
chorobowo [22]. Wstępne badania genetyczne sugerują, że Beclina 1 działa
jako supresor guzów, a jej delecja prowadzi do powstawania
spontanicznych nowotworów. Chociaż Beclina 1 i LC3 są ważnymi
mediatorami autofagii, inne cząsteczki oraz szlaki sygnalizacyjne, również
wymagają zbadania w celu określenia ich roli w procesie autofagii (np.
p53, PI3K / Akt / mTOR) [17].
2. Cel pracy
Celem niniejszego badania było zbadanie ekspresji genów zaangażowanych w autofagię w różnicowaniu komórek raka jelita grubego z wykorzystanie mikromacierzy oligonukleotydowych HGU-133A.
3. Materiały i metody
Aktywność transkrypcyjną genów związanych z autofagią wyznaczano
w wycinkach raka jelita grubego oraz jelita prawidłowego. Podczas zabiegu
operacyjnego uzyskano materiał obejmujący tkankę guza oraz margines
wynoszący 5 cm. Margines był oceniony makroskopowo i histopatolo-
97
Martyna Bednarczyk, Urszula Mazurek, Małgorzata Muc-Wierzgoń
gicznie jako jelito zdrowe. Do analizy molekularnej typowano 123 wycinki
jelita grubego, z czego 40 na podstawie analizy histopatologicznej oceniono
jako jelito prawidłowe (kontrola), a pozostałe jako gruczolakoraka w różnych
stopniach zaawansowania (CSI – 11, CSII – 25, CSIII – 32, CSIV – 15).
3.1. Ekstrakcja RNA
Pierwszym etapem badania było przeprowadzenie ekstrakcji całkowitego
RNA. Dostarczony materiał poddano homogenizacji z wykorzystaniem
homogenizatora Polytron (Kinematyka, AG, Szwajcaria). Następnie
wyizolowanao całkowite RNA za pomocą odczynnika TRIzol® (Invitrogen
Life Technologies, Kalifornia, USA), zgodnie instrukcją producenta.
Ostatnim etapem było oczyszczenie wyizolowanego RNA na kolumienkach zestawu RNeasy Mini Kit firmy Qiagen w połączeniu z trawieniem
DNazą I.
3.2. Ocena jakościowa i ilościowa całkowitego RNA
Po wyizolowaniu RNA, jednym z pierwszych wykonywanych etapów
jest analiza ilościowa, czyli określenie stężenia RNA. W tym celu
wykorzystano spektrofotometr GeneQuant II. Stężenie RNA wyznacza się
na podstawie pomiaru absorbancji światła UV przy długości fali 260 nm.
Analiza ilościowa polega na przeprowadzeniu elektroforezy w 1% żelu
agarozowym wybarwionym bromkiem etydyny.
3.3. Mikromacierze oligonukleotydowe
Aktywność transkrypcyjna genów związanych z autofagią została
wyznaczona techniką mikromacierzy HG-U133A (Affymetrix).
Do zsyntetyzowania dwuniciowego cDNA, wykorzystano jako matrycę
8 μg RNA (SuperScript Choice system; Invitrogen Life Technologies, CA,
USA). Syntezę biotynylowanego cRNA przeprowadzono z użyciem
BioArray HighYield RNA Transcript Labeling Kit (Enzo Life Sciences,
New York, USA). W celu przeprowadzenia fragmentacji cRNA
zastosowano Sample Cleanup Module Kit (Qiagen GmbH, Germany).
Płukanie, barwienie kompleksem streptawidyna-fikoerytryna i skanowanie
mikromacierzy w skanerze GeneArray (Agilent) wykonywano zgodnie
z zaleceniami Affymetrix Gene Expression Analysis Technical Manual.
3.4. Analiza statystyczna
Analiza otrzymanych wyników prowadzona jest z wykorzystaniem
Infrastruktury PL-Grid (http://www.plgrid.pl/). W analizie statystycznej
zastosowano poziom istotności statystycznej wynoszący p(α) < 0,05. Dla
każdego analizowanego parametru wyznaczono najważniejsze elementy
98
Profil ekspresji genów zaangażowanych w autofagię
w różnicowaniu komórek raka jelita grubego
statystyki opisowej: średnią, medianę, wartość minimalną i maksymalną,
odchylenie standardowe oraz kwartyl górny (75%) i dolny (25%).
Zróżnicowanie ekspresji genów określono za pomocą testu jednoczynnikowej ANOVA. Następnie wykonano test bardziej precyzyjny, post
hoc TUKEYA.
4. Wyniki
4.1. Grupowanie hierarchiczne transkryptomów
Ocenę stopnia zróżnicowania transkryptomów rozpoczęto od porównania
zgodności grupowania wycinków w zależności od stopnia zaawansowania raka
jelita grubego wyznaczonego na podstawie analizy histopatologicznej,
klinicznej oraz molekularnej. W tym celu przeprowadzono grupowanie
hierarchiczne, z miarą Czebyszewa.
Transkryptomy zostały podzielone na cztery grupy, dwie charakterystyczne
dla raka jelita grubego – w niskim stopniu zaawansowania (NSZ) oraz
w wysokim stopniu zaawansowania (WSZ) oraz dwie grupy kontrolne
(K i K2). Grupa K2 wykazuje podobieństwo do raka w wysokim stopniu
zaawansowania, chociaż jest to wycinek jelita oceniony histopatologicznie
i makroskopowo jako tkanka prawidłowa.
Rysunek 2. Dendrogram obrazujący wyniki grupowania hierarchicznego profili
znormalizowanego poziomu sygnałów fluorescencji 22283 ID mRNA w transkryptomach
wyznaczonych metodą mikromacierzy oligonukleotydowych HGU 133A [opracowanie własne]
99
Martyna Bednarczyk, Urszula Mazurek, Małgorzata Muc-Wierzgoń
4.2. Ocena stopnia zróżnicowania pomiędzy grupami
transkryptomów genów związanych z autofagią
Analizę stopnia zróżnicowania transkryptomów rozpoczęto od statystyki
opisowej rozkładu sygnału fluorescencji mRNA transkryptów w poszczególnych grupach (rys. 3). Na osi x zaznaczono dwie kontrole (K i K2) oraz
hodowlę komórek raka jelita grubego o wysokim stopniu zaawansowania
(WSZ) i niskim stopniu zaawansowania (NSZ). Na tej podstawie można
stwierdzić, że kontrola jest zbliżona do próbek badanych. We wszystkich
grupach wartości mediany występują na zbliżonym poziomie, lecz są
zauważalne różnice w wartościach rozstępu kwartylowego oraz wartościach oddalonych.
Rysunek 3. Statystyki opisowe przedstawiające rozkład sygnału fluorescencji mRNA w grupach
transkryptomów kontroli [K i K2] oraz komórek raka jelita grubego o niskim stopniu
zaawansowania [NSZ] i wysokim stopniu zaawansowania [WSZ] [opracowanie własne]
4.3. „Mapa gorąca” trankryptów genów związanych z autofagią
Kolejnym etapem było wyznaczenie za pomocą Infrastruktury PL-Grid
(http://www.plgrid.pl/) „map gorąca” (heatmap). „Mapy gorąca” umożliwiają porównanie aktywności transkrypcyjnej badanych genów w odniesieniu do średniej aktywności transkrypcyjnej komórek jelita grubego
(barwa żółta). Poniższa rycina przedstawia „mapę gorącą” obrazującą
100
Profil ekspresji genów zaangażowanych w autofagię
w różnicowaniu komórek raka jelita grubego
zróżnicowanie profilu stężeń mRNA genów związanych z autofagią
ulegających nadekspresji w raku jelita grubego. Wzrost ekspresji danego
genu koreluje ze zmianą barwy w kierunku odcieni czerwieni, natomiast
spadek aktywności transkrypcyjnej oznacza zmianę barwy w kierunku
odcieni niebieskiego. Na podstawie poniższej „mapy gorąca” stwierdzono,
że poziom mRNA badanego białka jest wyższy w wycinkach raka
w porównaniu do kontroli, natomiast nie zależy od stopnia zaawansowania
klinicznego.
Rysunek 4. Mapa intensywności sygnałów fluorescencji 26 ID mRNA genów związanych
z autofagią w grupach tran skryptów jelita grubego (kolor niebieski – najniższe wartości, kolor
czerwony najwyższe wartości sygnałów fluorescencji rejestrowanych w analizowanych
mikromacierzach [opracowanie własne]
101
Martyna Bednarczyk, Urszula Mazurek, Małgorzata Muc-Wierzgoń
4.4. Ocena stopnia zróżnicowania ilościowego pomiędzy grupami
transkryptomów genów związanych z autofagią testem
jednoczynnikowej ANOVA
Kolejnym etapem było przeprowadzenie dalszej analizy wyników,
w celu oceny statystycznej znamienności obserwowanych zmian na
poziomie profilu stężeń ID mRNA genów związanych z autofagią
w zależności od stopnia zaawansowania gruczolakoraka jelita grubego.
Przeprowadzono test jednoczynnikowej ANOVA z korekcją BenjaminiHochberga, który miał na celu jednoczesne porównanie wszystkich
analizowanych grup transkryptomów w odniesieniu do prób kontrolnych K
i K2 (tab. 1).
Tabela 1. Test jednoczynnikowej ANOVA przedstawiający liczbę ID mRNA genow związanych
z autofagią różnicujących transkryptomy gruczolakoraka jelita grubego w wysokim oraz niskim
stopniu zaawansowania [opracowanie własne]
Liczba mRNA różnicujących K vs NSZ vs WSZ
wartość p
różnicujące
207
p < 0,05
p < 0,02
p < 0,01
p < 0,005
p <0,001
26
20
13
11
3
Z przedstawionej analizy statystycznej ANOVA wynika, że spośród grupy
207 mRNA genów związanych z autofagią, w przypadku 26 ID mRNA
występują znaczne różnice w intensywności fluorescencji dla wartości
p < 0,05. Z czego wynika, ze 26 mRNA różnicuje wycinki gruczolakoraka od
kontroli K1. Podczas zaostrzenia kryteriów różnicowania, zwiększono siłę
różnicowania poprzez zmianę wartości p z 0,05 na 0,001, obserwowano
stopniowe zmniejszanie liczby mRNA różnicujących poszczególne grupy
transkryptów.
Test ANOVA wykonuje się celem określenia różnic poziomu ID mRNA
w analizowanych grupach transkryptomów. Pierwszą częścią są różnice
między porównywanymi grupami mRNA: NSZ, WSZ, K 2 w porównaniu do
K1, natomiast drugą grupę stanowią różnice między wynikami wewnątrz
analizowanych grup mRNA (błąd losowy).
Dlatego w kolejnym etapie analizy statystycznej przeprowadzono test
wielokrotnych porównań post – hoc (po fakcie) – test Tukeya z poprawką
Benjamini-Hochberga (tab. 2). Wykonuje się go jako kolejny krok analizy
wariancji. Jest on bardziej precyzyjny niż test ANOVA. Jego zadaniem jest
określenie, jaka liczba ID mRNA różnicuje analizowane grupy transkryptomów między sobą. Test ten jest wykorzystywany tylko dla wybranej
grupy ID mRNA dopiero, jeśli na podstawie testu ANOVA zostanie
stwierdzony brak równości między średnimi.
102
Profil ekspresji genów zaangażowanych w autofagię
w różnicowaniu komórek raka jelita grubego
Tabela 2. Test post – hoc Tukeya, który wskazuje liczbę reprezentatywnych ID mRNA
różnicujących poszczególne grupy transkryptomów. Kolorem czarnym jest zaznaczona liczba 26
ID mRNA wyznaczona za pomocą testu ANOVA, które różnicowały analizowane grupy
transkryptomów. Kolorem czerwonym – liczbę ID mRNA reprezentatywnych dla różnicowania
badanych grup transkryptomów przy założeniu, p < 0,05. Kolorem niebieskim – liczbę ID mRNA
niereprezentatywnych w różnicowaniu porównywanych grup [opracowanie własne]
Grupa
transkryptomów
K2
K
NSZ
WSZ
K2
K
26
22
13
8
NSZ
4
26
21
14
WSZ
13
5
26
19
18
12
7
26
Podczas analizy średnich sygnałów fluorescencji w grupach K2, NSZ
i WSZ w porównaniu do K1, stwierdzono, że z grupy 26 ID mRNA
wytypowano przy wartości p < 0,05, dla K2 vs K1 – 4 ID mRNA, dla NSZ
vs K1 – 5 ID mRNA oraz dla WSZ vs K1 – 12 ID mRNA.
Kolejnym etapem była ocena specyficzności ID mRNA w różnicowaniu
grup transkryptomów gruczolakoraka jelita grubego o niskim i wysokim
stopniu zaawansowania w odniesieniu do kontroli K1. W tym celu
posłużono się diagramem VENNA (ryc. 5). Uzyskane wyniki świadczą
o tym, że z grupy 26 ID mRNA wytypowanych jako różnicujące wycinki
raka jelita grubego o niskim stopniu zaawansowania od kontroli, nie ma
żadnych genów specyficznych tylko dla NSZ. W przypadku różnicowania
raka jelita grubego o wysokim stopniu zaawansowania od kontroli,
specyficznych jest 8 genów: dwa ID dla receptora BECN1 oraz po jednym
dla TMEM59, NBR1, PSEN1, VTI1B, DRAM1 i SH3BP4.
Rysunek 5. Diagram Venna grupujący mRNA wytypowane testem post-hoc – Tukeya
z poprawką Benjamini-Hochberga – po teście jednoczynnikowym ANOVA, w zależności od
specyficzności różnicowania grup transkryptomów jelita grubego [opracowanie własne]
103
Martyna Bednarczyk, Urszula Mazurek, Małgorzata Muc-Wierzgoń
Tabela 3. Legenda do diagramu Venna wskazującego specyficzność ID mRNA w różnicowaniu
grup transkryptomów K2, NSZ i WSZ w odniesieniu do kontroli K1, wyznaczonych na
podstawie analizy wariancji i testu post-hoc – Tukeya z poprawką Benjamini-Hochberga
[opracowanie własne]
Grupy
porównywanych
transkryptomów
mRNA różnicujące
Liczba
ID
Symbol
Wartość p
NSZ vs K1 – 5 ID mRNA
NSZ vs K1
NSZ vs K1NSZ
vs WSZ
0
3
NSZ vs K1WSZ
vs K1
2
NSZ vs K1WSZ
vs K1NSZ vs
WSZ
0
201471_s_at
SQSTM1
0.0013664293
202723_s_at
FOXO1
4.2396536E-5
207829_s_at
BNIP1
7.935236E-5
209018_s_at
PINK1
3.3543853E-5
209019_s_at
PINK1
7.000239E-8
WSZ vs K1 – 12 ID mRNA
WSZ vs K1
8
WSZ vs K1NSZ
vs K1
2
WSZ vs K1NSZ
vs WSZ
2
NSZ vs
K1WSZvs
K1NSZ vs WSZ
0
200620_at
TMEM59
0.0026670145
201383_s_at
NBR1
0.0012132392
207782_s_at
PSEN1
4.188373E-4
208945_s_at
BECN1
4.977536E-7
208946_s_at
BECN1
7.3220895E-4
209452_s_at
VTI1B
2.458908E-4
218627_at
DRAM1
9.152737E-5
222258_s_at
SH3BP4
2.3106563E-4
209018_s_at
PINK1
3.3543853E-5
209019_s_at
PINK1
7.000239E-8
201553_s_at
LAMP1
2.6293748E-4
212312_at
BCL2L1
2.975771E-6
104
Profil ekspresji genów zaangażowanych w autofagię
w różnicowaniu komórek raka jelita grubego
NSZ vs WSZ – 7 ID mRNA
NSZ vs WSZ
NSZ vs WSZ
WSZ vs K1
NSZ vs WZS
NSZ vs K1
NSZ vs
K1WSZvs
K1NSZ vs WSZ
2
2
3
201552_at
LAMP1
0.006088007
221874_at
KIAA1324
0.0020695326
201553_s_at
LAMP1
2.6293748E-4
212312_at
BCL2L1
2.975771E-6
201471_s_at
SQSTM1
0.0013664293
202723_s_at
FOXO1
4.2396536E-5
207829_s_at
BNIP1
7.935236E-5
0
Grupa NSZ różni się od grupy WSZ 7 IDmRNA, mimo tego, że
obydwie grupy w ocenie histopatologicznej stanowią wycinki raka jelita
grubego. Wynik analizy Tukeya wskazuje również, że obydwie kontrole
z pośród 26 ID mRNA wytypowanych jednoczynnikowym testem
ANOVA, różnią się istotnie od siebie 4 ID mRNA.
5. Dyskusja
Nowotwór jelita grubego jest jedną z najczęstszych przyczyn śmierci na
świecie [23]. Najnowsze badania wykazały, że jest to wieloetapowa
choroba genetyczna. Jednak czynniki środowiskowe mogą również
wspierać rozwój tej choroby [24, 25]. Pomimo postępu w diagnostyce,
badaniach oraz leczeniu, przyczyny choroby nie zostały jeszcze dokładnie
poznane [26]. Rak jelita grubego jest wynikiem postępujących
genetycznych i epigenetycznych zmian, które powodują przekształcenie
prawidłowego nabłonka okrężnicy w gruczolakoraka jelita grubego [27].
Badania z ostatnich lat w dużej mierze koncentrują się na biologii
molekularnej choroby. Podstawowym celem prowadzonych badań jest nie
tylko szukanie sposobów zapobiegania nowotworom oraz wczesne
wykrywanie, ale również poznanie skutecznych metod walki z chorobą.
Celem naukowców jest wprowadzenie terapii działającej bezpośrednio na
guz. Jednak brakuje wciąż wiedzy na temat kancerogenezy na poziomie
molekularnym [26].
Najnowszym stosowanym sposobem leczenia przerzutów raka jelita
grubego jest hamowanie szlaku EGFR w celu zablokowania wzrostu guza
i proliferacji komórek. Jednak naukowcy nadal poszukują alternatywnych
metod leczenia. Ostatnio uważa się, że autofagia może być odpowiednim
celem terapeutycznym w leczeniu nowotworów, ponieważ powoduje
105
Martyna Bednarczyk, Urszula Mazurek, Małgorzata Muc-Wierzgoń
oporność guzów na chemioterapię [23]. Wśród czynników zaangażowanych w etiologię tej choroby, duże znaczenie ma autofagia. Dokładny
mechanizm prowadzący do autofagii w raku nie jest jeszcze dokładnie
poznany. Wiadomo tylko, że proces ten pełni podwójną rolę w nowotworach. Z jednej strony może chronić komórki przed transformacją
nowotworową poprzez usunięcie uszkodzonych organelli, zagregowanych
białek czy zmniejszenie reaktywnych form tlenu. Z drugiej strony autofagia
powoduje przeżycie komórek guza ułatwiając im dostęp do składników
odżywczych, hamuje śmierć komórek oraz zwiększa odporność na leki [20].
Nowotwór jest wynikiem zmian zachodzących w materiale genetycznym, czego następstwem są zaburzenia w ścieżkach metabolicznych.
Białkowe produkty zmienionych genów wpływają na procesy zachodzące
w komórkach nowotworowych, takie jak proliferacja, różnicowanie,
apoptoza i angiogeneza. Te białka mogą być markerami nowotworowymi,
przydatnymi w przypadku diagnostyki choroby. W celu oznaczania
obecności markerów nowotworowych konieczne jest wykonanie badań
molekularnych [28].
Mikromacierze oligonukleotydowe stanowią ostatnio bardzo popularną
technikę analizy ekspresji genów [29]. Dzięki nim można ocenić jednorazowo dużą ilość genów oraz istnieje możliwość określenia ich profilu
ekspresji genów charakterystycznego dla danego typu nowotworu [30].
W tym przypadku badano profil ekspresji genów związanych z autofagią.
Wytypowanie genów, które zmieniają swoją aktywność w gruczolakoraku jelita grubego w porównaniu do jelita zdrowego, może mieć
zastosowanie w diagnostyce klinicznej oraz terapii tego nowotworu
(opracowanie nowych, skutecznych leków). Brak zmian w ekspresji genów
w stosunku do kontroli może oznaczać, że te geny nie uczestniczą
w rozwoju choroby [31].
W niniejszym baniu wykorzystano mikromacierze oligonukleotydowe
HG-U133A (Affymetrix), dzięki którym oceniono profil ekspresji genów
charakterystycznych dla autofagii. Metodę tę cechuje bardzo wysoka
czułość i dokładność. W bazie danych Affymetrix znajduje się 207 sond dla
mRNA genów związanych z autofagią.
Do przeprowadzenia niniejszego badania wyselekcjonowano 26 ID
mRNA genów związanych z autofagią a kolejnym krokiem było wykonanie
analizy porównawczej K2, NSZ i WSZ w odniesieniu do kontroli K1.
Wstępną ocenę zróżnicowania poszczególnych grup transkryptomów
przeprowadzono na podstawie intensywności sygnałów fluorescencji
w postaci „map gorąca”. Następnie znamienność statystyczną obserwowanych różnic oceniono wykonując jednoczynnikowy test ANOVA oraz
test post hoc Tukeya wskazującego ID mRNA różnicujące K2, NSZ i WSZ
od kontroli K1.
106
Profil ekspresji genów zaangażowanych w autofagię
w różnicowaniu komórek raka jelita grubego
Przeprowadzono analizę porównawczą transkryptomów genów (207 ID
mRNA) biorących udział w autofagii i uzyskano wynik, wskazujący, że
profil stężenia mRNA w wycinkach jelita grubego zmienia się w zależności
od stopnia zaawansowania gruczolakoraka jelita grubego. Próbując
odnaleźć geny uczestniczące w autofagii nie wykryto żadnych genów
specyficznie różnicujących wycinki raka w grupie NSZ od K. W przypadku
pacjentów z rakiem jelita grubego w wysokim stopniu zaawansowania
(WSZ) proces chorobowy uległ znacznemu postępowi. Zmiany, które
zaobserwowano w NSZ są już nieobecne, natomiast obserwujemy 8 genów
specyficznie różnicujących WSZ: TMEM59, NBR1, PSEN1, VTI1B,
DRAM1, SH3BP4 oraz 2 ID dla BECN1.
Dokładna funkcja białka TMEM59 nie jest poznana, wiadomo, że
uczestniczy w makroautofagii. Znajduje się w błonie aparatu Golgiego
i hamuje glikozylację białka APP w aparacie Golgiego (ang. amyloid
precursor protein) oraz zmniejsza poziom APP na powierzchni komórki.
Ponadto TMEM59 powoduje aktywację LC3, co potwierdza jego
proapoptotyczne zdolności [32, 33]. Z kolei białko NBR1 zaangażowane
jest w autofagię, głównie mitofagię [34]. Głównym zadaniem PSEN1 jest
udział w produkcji β-amyloidu, co przyczynia się do rozwoju choroby
Alzheimera. Bierze również udział w rozwoju nowotworów oraz oporności
na chemioterapię, jednak proces ten nie jest do końca poznany [35]. Duże
znaczenie w powstawaniu nowotworów ma białko DRAM1, które bierze
udział w indukcji autofagii i apoptozy zależnej od TP53 [36]. Białko
SH3BP4 pełni funkcję hamowania GTPazy Rag i jest również negatywnym
regulatorem szlaku sygnalizacyjnego mTORC1, co przyczynia się do rozwoju wielu typów nowotworów [37]. Z pośród wymienionych genów
największe znaczenie w autofagii ma białko BECN1 (Beclina 1).
Uczestniczy w początkowej fazie autofagii – w formowaniu fagoforu [2].
Ponadto bierze udział w oporności na chemioterapię [38]. Na temat roli
genu VTI1B w rozwoju nowotworów, nie znaleziono informacji
w piśmiennictwie. Udowodniono w niniejszym badaniu, jak ważną rolę
odgrywa autofagia w procesie nowotworzenia.
Podsumowując, badania na poziomie molekularnym przyczynią się do
opracowania nowych metod diagnostyki, terapii oraz nieinwazyjnych
metod wykrywania wczesnych postaci nowotworów jelita grubego.
Poznanie genów zaangażowanych w autofagię oraz ścieżek sygnałowych
biorących udział w najwcześniejszych etapach choroby, może przyczynić
się do opracowania leków kontrolujących lub zapobiegających dalszemu
rozwojowi choroby [39]. Obecnie prowadzone są intensywne badania nad
opracowaniem nowych metod terapii, polegające na aktywacji autofagii,
np. w wyniku indukcji stresu ER, hamowana szlaku mTOR lub aktywacji
AMPK w różnych typach nowotworu [18].
107
Martyna Bednarczyk, Urszula Mazurek, Małgorzata Muc-Wierzgoń
6. Wnioski
Badanie ekspresji genów techniką mikromacierzy oligonukleotydowych
w gruczolakoraku jelita grubego, stanowi cenną metodę uzupełniającą
diagnostykę wczesnej postaci nowotworu.
Zmiany molekularne wyprzedzają zmiany fenotypowe. Świadczy o tym
fakt, że w grupie kontrolnej K2 mogą znajdować się już komórki
nowotworowe.
Zaobserwowane różnice ekspresji genów związanych z autofagią
w badanej grupie chorych z gruczolakorakiem jelita grubego w porównaniu
z wycinkami jelita zdrowego, mogą wskazywać na istotną rolę wyodrębnionych genów w patogenezie tego nowotworu.
Literatura
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
Badadani M., Autophagy Mechanism, Regulation, Functions, and Disorders,
Cell Biology, (2012), s. 1-11
Dereń-Wagemann I., Kiełbiński M., Kuliczkowski K., Autofagia – proces
o dwóch obliczach, Acta Hematologica Polonica, 44 (2013), s. 383-391
Kost A., Kasprowska D., Łabuzek K. i in., Autofagia w niedokrwieniu mózgu,
Postępy Higieny i Medycyny Doświadczalnej, 65 (2011), s. 524-533
Świderek E., Strządał L., Autofagia i białko BNIP3 w nowotworach, Postępy
Higieny i Medycyny Doświadczalnej., 67 (2013), s. 363-370
Niedźwiedzka-Rystwej P. Deptuła W., Autofagia – ważne zjawisko
odpornościowe, Postępy Biologii Komórki, 36 (3) (2009), s. 455-464
Ghavami S., Shojaei S., Yeganeh B. et al., Autophagy and apoptosis
dysfunction in neurodegenerative disorders, Progress in Neurobiology,
112 (2014), s. 24-49
Fujita Y., Araya J., Ito S. et al., Suppression of autophagy by extracellular
vesicles promotes myofibroblast differentiation in COPD pathogenesis,
Journal of Extracellular Vesicles, 4 (2015), s. 1-12
Lisak N., Totoń E., Rybczyńska M., Autofagia, nowe perspektywy w terapii
przeciwnowotworowej, Postępy Medycyny i Higieny Doświadczalnej,
68 (2014), s. 925-935
Dumit V., Dengjel J., Autophagosomal Protein Dynamics and Influenza Virus
Infection, Frontiers in Immunology, 3 (43) (2012), s. 1-10
Zielniok K., Gajewska M., Znaczenie autofagii w procesie nowotworzenia,
Życie Weterynaryjne, 90 (9) (2015), s. 565-569
Qi L., Zhang XD., Wu Ch. et al., The role of chaperone-mediated autophagy
in huntingtin degradation, PLoS ONE, 7 (10) (2012), s. 1-16
Polewska J., Autofagia – mechanism molekularny, apoptoza i nowotwory,
Postępy Higieny i Medycyny Doświadczalnej, 66 (2012), s. 921-936
Kiffin R., Christian Ch., Knecht E. et al., Activation of chaperone-mediated
autophagy during oxidative stress, Molecular Biology of the Cells, 15 (2004),
4829-4840
108
Profil ekspresji genów zaangażowanych w autofagię
w różnicowaniu komórek raka jelita grubego
14. Muntz Ch., Antigen processing by macroautophagy for MHC presentation,
Frontiers in Immunology, 2 (42) (2011), s. 1-7
15. Eskelinen E. Saftig P., Autophagy A lysosomal degradation pathway with
a central role in health and disease, Biochemica et Biophysica Acta, 1793
(2009), s. 664-6
16. Yang Z., Klionsky D., Mammalian autophagy core molecular machinery and
signaling regulation, Current Opinion in Cell Biology., 22 (2) (2010), s. 1-14
17. Hasima N., Ozpolat B., Regulation of autophagy by polyphenolic compounds
as a potential therapeutic strategy for cancer, Cell Death and Disease, 509
(2014), s. 1-13
18. Kania E., Pająk B., Orzechowski A., Calcium homeostasis and ER stress
in control of autophagy in cancer cells, BioMed Research International,
(2015), s. 1-12
19. Sakitani K., Hirata Y., Hikiba Y. et al., Inhibition of autophagy exerts anticolon cancer effects via apoptosis induced by p53 activation and ER stress,
BMC Cancer, 15 (795) 2015, s. 1-14
20. Burada F., Nicoli E. R., Ciurea M. E. et al., Autophagy in colorectal cancer
An important switch from physiology to pathology, World Journal of
Gastrointestinal Oncology, 7 (11) (2015), s. 271-284
21. Grossi A., Peserico A., Tezil T. et al., p38α MAPK pathway a key factor
in colorectal cancer therapy and chemoresistance, World Journal
of Gastroenterology, 20 (29) 2014, s. 9744-9758
22. Groulx J. F., Khalfaoui T., Benoit Y. D., Autophagy is active in normal colon
mucosa, Autophagy, 8 (6) (2012), 893-902
23. Alvces S., Castro L., Fernandes M. S. et al., Colorectal cancer-related mutant
KRAS alleles function as positive regulators of autophagy, Oncotarget, 6 (31)
2015, s. 30787-30802
24. Arnold C. N., Goel A., Blum H. E., Molecular pathogenesis of colorectal cancer
implications for molecular diagnosis, Cancer, 104 (10) 2005, s. 2035-2047
25. Tye H., Jenkins B. J., Tying the knot between cytokine and toll – like receptor
signaling in gastrointestinal tract cancer, Cancer Science, 104 (9) 2013,
s. 1139-1145
26. Grande-Pulido E., Riquelme-Oliveira A., Ballesteros-Bargues J. et. al., Molecular
Biology of colorectal cancer, Research Signpost. 2 (2011), s. 569-579
27. Kheirelseid E., Miller N., Chang K. H. et al., Clinical applications of gene
expression in colorectal cancer, Journal of Gastrointestinal Oncology, 4 (2)
(2013), s. 144-157
28. Siedlecki J., Diagnostyka molekularna nowotworów, Postępy Nauk
medycznych, 2 (2011), s. 88-93
29. Wang M., Crager M., Pugazhenthi S., Modulation of apoptosis pathways
by oxidative stress and autophagy in β cells, Experimental Diabetes Research,
(2012), s. 1-14
30. Jęda A., Witek A., Janikowska G. i in., Profil ekspresji genów związanych
z układem histaminergicznym wyznaczony techniką mikromacierzy
oligonukleotydowych HG-U133A u kobiet z gluczorakorakiem endometrium,
Ginekologia Polska, 85 (2014), s. 172-179
31. Kazula A., Wykorzystanie mikromacierzy DNA w terapii i diagnostyce,
Genetyka, 65 (3) (2009), s. 229-238
109
Martyna Bednarczyk, Urszula Mazurek, Małgorzata Muc-Wierzgoń
32. Zhang L., Ju X., Cheng Y. et al., Identifying Tmem59 related gene regulatory
network of mouse neural stem cell from a compendium of expression profiles,
BMC System Biology, 5 (152) (2011), s. 1 -12
33. Boada-Romero E., Letek M., Fleischer A., et al., TMEM59 defines a novel
ATG16L1-binding motif that promotes local activation of LC3, The EMBO
Journal, 32 (2013), s. 566-582
34. Shi J., Fung G., Zhang J., et al., NBR1 is dispensable for PARK2-mediated
mitophagy regardless of the presence or absence of SQSTM1, Cell Death and
Disease, 6 (2015), s. 1-9
35. Sassi C., Guerreiro R., Gibbs R., et al., Investigating the role of rare coding
variability in Mendelian dementia genes (APP, PSEN1, PSEN2, GRN, MAPT,
and PRNP) in late-onset Alzheimer's disease, Neurobiology of Aging, 35 (12)
(2014), s. 2881-2887
36. Guan JJ., Zhang XD., Sun W., et al., DRAM1 regulates apoptosis through
increasing protein levels and lysosomal localization of BAX, Cell Death and
Disease, 6 (2015), s. 1-12
37. Kim Y., Stone M., Hwang TH., et al., SH3BP4 is a negative regulator
of amino acid-Rag GTPase-mTORC1 signaling, Molecular Cell., 46 (6)
(2012), s. 1-25
38. Ying H., Qu D., Liu Ch., et al., Chemoresistance is associated with Beclin-1
and PTEN expression in epithelial ovarian cancers, Oncology Letters,
9 (2015), s. 1759-1763
39. Markowitz S., Bertagnolli M., Molecular origins of cancer: Molecular basis
of colorectal cancer, The New England Journal of medicine, 361 (25) (2009),
s. 2449-2460
Profil ekspresji genów zaangażowanych w autofagię w różnicowaniu
komórek raka jelita grubego
Autofagocytoza, to proces biologiczny polegający na kontrolowanym rozkładzie cząsteczek,
fragmentów komórki, organelli komórkowych w celu pozyskania dodatkowego źródła energii.
Wyróżniamy trzy rodzaje autofagii: mikroautofagię, autofagię związaną z chaperonami (białkami
opiekuńczymi) oraz makroautofagię.
Celem badania było zbadanie profilu ekspresji genów związanych z autofagią w różnicowaniu komórek raka jelita grubego.
Analiza profilu ekspresji genów była wykonywana przy użyciu mikromacierzy of HG-U133A
(Affymetrix, Santa Clara, CA). Wyznaczanie genów różnicujących przeprowadzono
z wykorzystaniem Infrastruktury PL-Grid (http://www.plgrid.pl/).
Podczas analizy średnich sygnałów fluorescencji w grupach K2, NSZ i WSZ w porównaniu do
K1, stwierdzono, że z grupy 26 ID mRNA wytypowano przy wartości p < 0,05, dla K2 vs K1 – 4 ID
mRNA, dla NSZ vs K1 – 5 ID mRNA oraz dla WSZ vs K1 – 12 ID mRNA.
Z analizy diagramu Venna wynika, że z grupy 26 ID mRNA wytypowanych jako różnicujące
wycinki raka jelita grubego o niskim stopniu zaawansowania od kontroli, nie ma żadnych genów
specyficznych tylko dla NSZ. W przypadku różnicowania raka jelita grubego o wysokim stopniu
zaawansowania od kontroli, specyficznych jest 8 genów: dwa ID dla receptora BECN1 oraz po
jednym dla TMEM59, NBR1, PSEN1, VTI1B, DRAM1 i SH3BP4.
Wnioski: Zmiany molekularne wyprzedzają zmiany fenotypowe. Ekspresja genów związanych
z autofagią zależy od stopnia zaawansowania gruczolakoraka
110
Profil ekspresji genów zaangażowanych w autofagię
w różnicowaniu komórek raka jelita grubego
The expression profile of genes involved in autophagy in the
differentiation of colon adenocarcinoma
Autophagy is a biological process which plays role in cellular homeostasis by eliminating aged,
damaged or malfunctioning organelles and damaged or misfolded proteins. There are three types
of autophagy: microautophagy, macroautophagy and chaperone – related autophagy.
The aim of this study was to compare the expression profile of genes involved in autophagy in the
differentiation of colon adenocarcinoma.
The analysis of the expression profile of genes was performed using oligonucleotide microarrays
of HG-U133A (Affymetrix, Santa Clara, CA). Appointment of differentiating genes was
performed with the use of PL-Grid Infrastructure (http://www.plgrid.pl/).
The results showed that of the group 26 ID mRNA were chosen at p <0.05 for C2 vs C1 – 4 ID
mRNA, for LCS vs C1 – 5 ID mRNA and for HCS vs C1 – 12 ID mRNA.
The analysis of a Venn diagram shows that from 26 ID mRNA selected as a differential
of colorectal cancer LCS vs C1, there is no specific genes only LCS. In the case of the
differentiation of colorectal cancer HCS vs C1 – specific genes is 8, two ID for BECN1 receptor
and one for TMEM59, NBR1, PSEN1, VTI1B, DRAM1 and SH3BP4.
Conclusions: Molecular changes occur before phenotypic changes. Expression of genes involved
in autophagy depend on the clinical stage of adenocarcinoma.
111
Dominika Lach1
Terapie przeciwzapalne – nowy cel
w leczeniu ostrych zespołów wieńcowych
1. Wstęp
Według danych Światowej Organizacji Zdrowia (WHO, ang. World
Health Organization) choroby układu krążenia, w tym choroba
niedokrwienna serca, stanowią najczęstszą przyczynę zgonów na świecie.
Co więcej, z powodu zwiększającego się wraz z wiekiem ryzyka wystąpienia tych zespołów chorobowych i starzenia się populacji na świecie,
odnotowuje się ciągły wzrost liczby zgonów [1, 2]. Choroba niedokrwienna
serca jest zespołem objawów, a ostry zespół wieńcowy (OZW) jej
szczególnie niebezpieczną konsekwencją. W zależności od obserwowanych
objawów klinicznych, zmian elektrokardiograficznych i badań biochemicznych OZW dzielimy na: ostry zespół wieńcowy z uniesieniem odcinka
ST (STEMI, ang. ST-segment Elevation Myocardial Infarction) – ostry
zawał mięśnia sercowego z uniesieniem odcinka ST lub ostry zespół
wieńcowy bez uniesienia odcinka ST (NSTE-ACS, ang. non-ST-Segment
Elevation Acute Coronary Syndromes). Ponadto wśród NSTE-ACS
wyróżnia się: zawał mięśnia sercowego bez uniesienia odcinka ST
(NSTEMI, ang. non-ST-segment Elevation Myocardial Infarction) oraz
niestabilną dławicę piersiową (UA, ang. Unstable Angina) [3]. Patofizjologia OZW, niezależnie od szerokiego spectrum manifestacji klinicznej,
związana jest zawsze z erozją i/lub pęknięciem blaszki miażdżycowej,
która prowadzi do zakrzepicy wewnątrz tętnicy wieńcowej, nagle
zmniejszającej lub całkowicie uniemożliwiającej prawidłowy przepływ
krwi, m. in. w wyniku aktywacji kaskady krzepnięcia i aktywacji płytek
krwi. Pomimo ciągłego unowocześniania standardów leczenia interwencyjnego i farmakologicznego w OZW, nawracające niedokrwienia mięśnia
sercowego i śmiertelność pacjentów z powodu powikłań niedokrwiennych
pozostają na wysokim poziomie [4]. Z tego względu nadal potrzebne jest
opracowywanie bardziej skutecznych metod zapobiegania i leczenia OZW.
W tym celu konieczne jest lepsze poznanie molekularnych mechanizmów
OZW. Najnowsze badania wskazują na istotną rolę aktywnych procesów
zapalnych w patofizjologii OZW [5, 6]. Celem niniejszej pracy jest przed-
[email protected], Katedra Biochemii Ogólnej, Wydział Biologii i Ochrony
Środowiska, Uniwersytet Łódzki, www.biol.uni.lodz.pl
112
Terapie przeciwzapalne – nowy cel w leczeniu ostrych zespołów wieńcowych
stawienie najnowszych danych na temat potencjalnych terapii przeciwzapalnych u pacjentów z OZW.
2. Procesy zapalne w OZW
W obrębie zmian miażdżycowych, których erozja lub pęknięcie
prowadzące do niedotlenienia mięśnia sercowego, skutkuje wystąpieniem
OZW, toczy się przewlekły stan zapalny. W tętnicach wieńcowych objętych
zmianami miażdżycowymi dochodzi do zaburzeń interakcji międzykomórkowych pomiędzy śródbłonkiem naczyń, komórkami zapalnymi
i chemokinami [7]. Zaburzenia te doprowadzają do destabilizacji, erozji
i ostatecznie pęknięcia blaszki miażdżycowej. Do głównych czynników
inicjujących i nasilających stan zapalny w tętnicach wieńcowych pacjentów
z OZW należą mediatory zapalenia, takie jak: interleukiny (IL-1 i IL-6), białko
C-reaktywne (CRP, ang. C Reactive Protein), cząsteczki adhezyjne, czynnik
martwicy nowotworu (TNF-α, ang. Tumor Necrosis Factor-α) oraz metaloproteinazy [7]. Ponadto, spowodowane działaniem mediatorów prozapalnych,
nagromadzenie i aktywacja makrofagów, leukocytów oraz płytek krwi
w miejscu powstania blaszki miażdżycowej również istotnie wpływa na proces
jej destabilizacji, erozji i pękania [8]. W tabeli 1. przedstawiono udział
mediatorów prozapalnych w rozwoju zmian miażdżycowych doprowadzających do rozwoju OZW.
Tab. 1 Udział wybranych mediatorów stanu zapalnego w rozwoju zmian miażdżycowych [7, 8]
Mediator
prozapalny
VCAM-1
Miejsce
wytwarzania
śródbłonek
ICAM-1
śródbłonek,
limfocyty T i B,
komórki
dendrytyczne
monocyty,
makrofagi
IL-6
Funkcja
Rola
ligand integryny
VLA-4
ligand integryny
LFA-1
adhezja leukocytów,
rekrutacja monocytów
adhezja leukocytów,
rekrutacja monocytów
cytokina, ligand
CD126
aktywacja limfocytów
T, stymulacja
transformacji
limfocytów B,
hamowanie
wydzielania TNF-α
stymulacja
makrofagów,
rekrutacja neutrofilów
destabilizacja blaszki
miażdżycowej,
synteza cytokin
prozapalnych
TNF-α
głównie
makrofagi
cytokina, ligand
TNF-R
Metalo proteinazy
m.in. śródbłonek,
płytki krwi,
makrofagi
enzymy
degradujące
kolagen
113
Dominika Lach
W wyniku pęknięcia blaszki miażdżycowej przebiegającego pod postacią
odczynu zapalnego, również dochodzi do zaburzeń interakcji międzykomórkowych. Istotne znaczenie dla zaangażowania się mechanizmów
immunologicznych w obszarze zawału ma uszkodzenie błony komórkowej
kardiomiocytów spowodowane niedokrwieniem. Ponadto do zwiększenia
przepuszczalności sarkolemy przyczynia się podwyższona ilość wolnych
rodników (nadtlenkowego i wodorotlenowego) gromadzących się w niedokrwionym mięśniu sercowym przy równoczesnym zmniejszeniu poziomu ich
inaktywatorów. Powierzchnia komórek mięśnia sercowego zmienia się
również poprzez ekspresję cząsteczek adhezyjnych, co skutkuje reakcją
komórek immunologicznie kompetentnych odpowiedzialnych za rozwój
i utrzymanie procesu zapalnego [9].
Na komórkach endotelium dochodzi do ekspresji m.in. cząsteczki adhezji
komórkowej płytkowo-śródbłonkowej 1 (PECAM-1, ang. Platelet Endothelial
Cell Adhesion Molecule-1), która umożliwia przechodzenie leukocytów
pomiędzy komórkami śródbłonka. Zablokowanie powierzchniowej ekspozycji
PECAM-1 może zapobiec pozawałowemu uszkodzeniu mięśnia sercowego
poprzez potencjalne zahamowanie migracji neutrofili [10]. W następstwie
niedokrwienia dochodzi również do zmiany stężeń cząstek adhezyjnych
rozpuszczalnych w osoczu. Zwiększa się ekspresja rozpuszczalnych form
cząsteczek adhezji komórkowej naczyń 1 (VCAM-1, ang. Vascular Adhesion
Molecule-1) oraz cząsteczek adhezji międzykomórkowej 1 (ICAM-1, ang.
Intercellular Adhesion Molecule-1), a u pacjentów z UA rośnie stężenie
cząsteczki biorącej udział w adhezji m.in. neutrofili do śródbłonka naczyń
– selektyny – E (CD62E) [10, 11].
Powstanie nacieku zapalnego w niedokrwiennym miokardium i aktywacja
wędrujących komórek zapalnych związana jest z pobudzeniem sieci
cytokinowej, która pomimo licznych publikacji nie jest do końca poznana.
U pacjentów po przebytym zawale mięśnia sercowego dochodzi do
zwiększenia stężenia w osoczu cytokin prozapalnych (IL-1, IL-6, TNF-α).
Działanie prozapalne cytokin w OZW związane jest z aktywacją cząsteczek
adhezyjnych, wpływem na zwiększenie przepuszczalność śródbłonka,
mobilizacją komórek monocytów i leukocytów oraz odkładaniem w ścianach
naczyń cząsteczek lipidów [12].
Naciek komórek zapalnych w obrębie zawału aktywowany jest również
przez chemotaktyczne oddziaływania składowych układu dopełniacza
skierowane na te komórki [13]. Zaburzenia interakcji międzykomórkowych w
postaci odczynu zapalnego wywołanego niedokrwieniem są istotą procesów
zachodzących podczas zawału mięśnia sercowego [14].
114
Terapie przeciwzapalne – nowy cel w leczeniu ostrych zespołów wieńcowych
3. Terapie przeciwzapalne w OZW
Stosowane obecnie leki przeciwzapalne należące do niespecyficznych
inhibitorów zapalenia prowadzą do niepożądanych zmian w obrębie zawału
mięśnia sercowego, takich jak powiększenie obszaru zawału oraz powikłania spowodowane niedostatecznym uformowaniem blizny pozawałowej
[15]. Postęp w terapii przeciwzapalnej OZW mogłoby stanowić specyficzne hamowanie procesów zapalnych. Lepsze poznanie udziału procesów
pro – i przeciwzapalnych w patomechanizmie OZW zaowocowało w ostatnim czasie wzrostem liczby badań nad potencjalnymi terapiami przeciwzapalnymi. Zachodzące u pacjentów z OZW procesy zapalne mogą
stanowić cel działania dla nowych kierunków terapii. Nowe leki
przeciwzapalne stanowiące potencjalny efekt poszukiwań skutecznej terapii
OZW różnią się zarówno mechanizmem, jak i obszarem działania i mogą
wykazywać działanie uogólnione lub też działać bardziej specyficznie [16].
W tabeli 2. przedstawiono zestawienie potencjalnych leków przeciwzapalnych, będących przedmiotem szczegółowych badań u pacjentów
z OZW.
Tab. 2 Potencjalne cele terapii przeciwzaplnych w OZW [16]
Lek
Mechanizm
działania
Faza badań
klinicznych
Kolchicyna
uogólnione
działanie
przeciwzapalne
II
VT-111a
inhibitor proteazy
serynowej
I
Losmapimod
inhibitor kinazy
p38 MAPK
Wyniki
Zmniejsza ryzyko
wystąpienia
ponownego zawału;
wpływa na
zmniejszenie obszaru
zawału mięśnia
sercowego
Obniżenie poziomu
troponiny
w porównaniu do
placebo; dopuszczony
do dalszych badań
III
Ocena wpływu na
poziom troponiny
Daraplapid
inhibitor
fosfolipazy A2
III
Brak istotnych różnic
w porównaniu do
placebo
Gevokizumab
inhibitor IL-1β
Badania
przedkliniczne
W trakcie badań
Kanakinumab
inhibitor IL-1β
W trakcie II
W trakcie badań
115
Dominika Lach
3.1. Kolchicyna
Do leków wykazujących uogólnione działanie na układ immunologiczny należy kolchicyna, która jest stosowana od lat głównie u osób
z dną moczanową. Kolchicyna jest alkaloidem wykazującym szereg
właściwości przeciwzapalnych. Poprzez wiązanie się z mikrotubulami
tworzącymi wrzeciono kariokinetyczne, hamuje podziały komórkowe.
Ponadto modyfikuje funkcje komórek układu immunologicznego
wpływając na ich zdolność do fagocytozy, mobilizacji, degranulacji
zawartości wewnątrzkomórkowych lizosomów oraz adhezji do śródbłonka
naczyń krwionośnych [17]. Lek ten obecnie poddawany jest II fazie badań
klinicznych (LoDoCo, ang. Low Dose Colchicine for Secondary Prevention
of Cardiovascular Disease) w grupie pacjentów z OZW. Podczas tych 3letnich randomizowanych badań wykazano, że jej przyjmowanie w dawce
0,5 g na dobę zmniejsza ryzyko wystąpienia ponownego zawału mięśnia
sercowego i powikłań OZW w porównaniu z placebo i może również
wpływać na zmniejszenie obszaru zawału mięśnia sercowego [18].
3.2. Inhibitor proteazy serynowej – VT-111a
Inhibitor proteazy serynowej, – VT-111a działa poprzez wiązanie się
z receptorem urokinazowego aktywatora plazminogenu (uPAR, ang.
urokinase-type Plasminogen Activator Receptor), który uczestniczy w procesach zapalnych. Ten potencjalny lek w terapii przeciwzapalnej OZW
powoduje obniżenie poziomu troponiny we krwi po 24 godzinach w porównaniu do placebo. Pozytywne wyniki I fazy badań pozwoliły na
dopuszczenie go do dalszych testów klinicznych [19].
3.3. Inhibitor kinazy p38 MAPK – losmapimod
Losmapimod, będący inhibitorem kinazy p38 aktywowanej mitogenami
(MAPK, ang. Mitogen Activated Kinases), która jest zaangażowana
w regulację odpowiedzi zapalnej, cyklu komórkowego, apoptozy i różnicowanie się komórek, został poddany ocenie w badaniach klinicznych II fazy
u pacjentów z OZW. Badania nad losmapimodem prowadzono w porównaniu
z grupą kontrolną przyjmującą placebo. Wykazano, że stężenie białka Creaktywnego w 72 godzinie po podaniu leku było mniejsze w grupie pacjentów
przyjmujących losmapimod w porównaniu z placebo, a po 12 tygodniach na
porównywalnym poziomie [20]. Obecnie trwają zakrojone na szeroką skalę
badania kliniczne III fazy mające ocenić wpływ losmapimodu na stężenie
troponiny u pacjentów z OZW w porównaniu z chorymi przyjmującymi
placebo [21].
116
Terapie przeciwzapalne – nowy cel w leczeniu ostrych zespołów wieńcowych
3.4. Inhibitor fosfolipazy A2 – darapladip
Fosfolipaza A2 jest enzymem hydrolizującym cząsteczki fosfolipidów.
Darapladip to lipoproteina wiążąca się z fosfolipazą A2, która jest
zaangażowana w rozwój blaszki miażdżycowej ponieważ procesy hydrolizy
fosfolipidów prowadzą m. in. do powstania potencjalnie aterogennych
frakcji lipidów oraz do zwiększenia ekspozycji śródbłonka naczyń
krwionośnych na działanie stresu oksydacyjnego [22]. Jednakże randomizowane badania kliniczne pacjentów z OZW nie wykazały istotnych różnic
w porównaniu z placebo [23].
3.5. Inhibitory interleukiny IL-1β – gevokizumab i kanakinumab
Gevokizumab i kanakinumab są przeciwciałami monoklonalnymi
skierowanymi przeciwko IL-1 beta (IL-1β), która odrywa dużą rolę w procesach prozapalnych w OZW, patogenezie miażdżycy, a także wielu innych
chorobach o podłożu zapalnym. Cytokina ta obok TNF-α i IL-6 odgrywa
istotną rolę w kluczowej ścieżce sygnałowej procesów zapalnych [24, 25]
Gevokizumab poddawano ocenie w badaniach przedklinicznych na
modelu szczurzym miażdżycy. Wykazano, iż może on istotnie hamować
procesy zapalne toczące się w obrębie zmian miażdżycowych. W celu
sprawdzenia jego potencjalnych możliwości hamowania procesów
zapalnych w tętnicach wieńcowych u pacjentów z OZW postanowiono
przeprowadzić pilotażowe badania kliniczne II fazy [26].
Natomiast kanakinumab, zatwierdzony w leczeniu rzadkich schorzeń
o podłożu zapalnym, został poddany badaniom klinicznym II fazy (The
CANTOS trial) na grupie pacjentów z OZW również w celu sprawdzenia
wpływu na zmniejszenie stanu zapalnego w obrębie zmian miażdżycowych
tętnic wieńcowych [27].
4. Podsumowanie
Ostry zespół wieńcowy stanowi jedną z najczęstszych przyczyn zgonów
na świecie. Pomimo ciągłego unowocześniania standardów leczenia OZW,
nawracające epizody niedokrwienia mięśnia sercowego i śmiertelność
pacjentów są nadal bardzo częste. Z tego względu potrzebne jest
opracowanie bardziej skutecznych metod zapobiegania i leczenia OZW.
W tym celu konieczne jest dokładniejsze poznanie molekularnych
mechanizmów prowadzących do rozwoju OZW. Patofizjologia OZW
polega na erozji i/lub pęknięciu blaszki miażdżycowej, co prowadzi do
zaczopowania tętnicy wieńcowej. Najnowsze badania wskazują również na
istotną rolę aktywnych procesów zapalnych w patomechanizmach OZW.
Lepsze poznanie udziału procesów pro – i przeciwzapalnych w patomechanizmie OZW zaowocowało w ostatnich latach wzrostem liczby
117
Dominika Lach
badań nad potencjalnymi terapiami przeciwzapalnymi. Prowadzone
aktualnie duże wieloośrodkowe badania klinicznie pozwolą zweryfikować
skuteczność i bezpieczeństwo potencjalnych terapii przeciwzapalnych.
Literatura
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
http://www.who.int
Centres for Disease Control and Prevention. Deaths: Final Data for 2013,
Natl Vital Stat Rep 2013
Kumar A., Cannon C. P., Acute Coronary Syndromes: Diagnosis and
Management, Part I., Mayo Clinical Proc 2009; 84, s. 917-938
Smolina K., Wright F. L., Rayner M., Goldacre M. J., Long-term survival and
recurrence after acute myocardial infarction in England 2004 to 2010, Circ
Cardiovasc Qual Outcomes 2012; 5, s. 532-40
Libby P., Tabas I., Fredman G., Fisher E. A., Inflammation and its resolution
as determinants of acute coronary syndromes, Circ Res 2014; 114, s.1867-79
Falk E., Nakano M., Bentzon J. F., Finn A. V., Virmani R., Update on acute
coronary syndromes: the pathologists view, European Heart of Journal 2013;
34, s.719-28
Pasqui A. L., Di Renzo M., Pro-inflammatory/anti-inflammatory cytokine
imbalance in acute coronary syndromes, Clin Exp Med 2006; 6, s. 3844
Bonetti P. O., Lerman L. O., Endothelian dysfunction – a marker of
atherosclerotic risk, Arterioscler Thromb Vasc Biol 2003; 23, s. 168-175
Ishibashi T., Kijama M., Yokoyama K., Expresion of cytokine and adhesion
molecule mRNA in atherectomy specimens from patients with coronary artery
disease, Jpn Circ J 1999; 63, s. 249-254
Murohara T., Delyani J. A., Albelda S. M., Lefer A. M., Blockade of endothelial
cell adhesion molecule-1 protects against myocardial ischemia and reperfusion
injury in cats, Journal of Immunology 1996; 156, s. 3550-1557
Wallen N.H., Elevated serum intercellular adhesion molecule-1 and vascular
adhesion molecule-1 among patients with stable angina pectoris who suffer
cardiovascular death or nonfatal myocardial infarction, European Heart
of Journal 1999; s. 20: 1039-1043
Marciniak A., Rokownicze znaczenie osoczowego stężenia Il-1, Il-6, Il-8 oraz
CRP w zawale serca, Pol Arch Med Wewn 2003; 109, s. 15-22
Lucchesi B. R., Kilgore K. S., Complements inhibitors in myocardial
ischemia/reperfusion injury, Immunopharmacology 1997; 38, s. 27-42
Niessen H. W., Lagrand W. K., Visser C. A., Meijer C. J., Hack C. E.,
Upregulation of ICAM-1 on cardiomyocytes in jeopardized human
myocardium during infraction, Cardiovascular Research 1999; 41, s. 603-610
Young M. J., Rickard A. J., Mineralocorticoid receptors in the heart: lessons
from cell selective transgenic animals, Journal of Endocrinology, 2015; 224,
s.1-13
Ridker P. M., Luscher T. F., Anti-inflammatory therapies for cardiovascular
disease, Eur Heart J 2014; 35, s. 1782-91
118
Terapie przeciwzapalne – nowy cel w leczeniu ostrych zespołów wieńcowych
17. Nuki G., Colchicine: its mechanism of action and efficacy in crystal-induced
inflammation, Current Rheumatology Rep 2008; 10, s. 218-27
18. Nidorf S. M., Eikelboom J. W., Budgeon C. A., Thompson P. L., Low-dose
colchicine for secondary prevention of cardiovascular disease, Journal of the
American College of Cardiology 2013; 61, s. 404-10
19. Tardif J. C., L’Allier P. L., Gregoire J., Ibrahim R., McFadden G., Kostuk W.,
Knudtson M., Labinaz M., Waksman R., Pepine C. J., Macaulay C., Guertin
M. C., A randomized controlled, phase 2 trial of the viral serpin Serp-1 in
patients with acute coronary syndromes undergoing percutaneous coronary
intervention, Circulation Cardiovascular Interventions 2010; 3, s. 543-8
20. Newby L. K., Marber M. S., Melloni C., Sarov-Blat L., Aberle L. H., Aylward
P. E., Cai G., de Winter R. J., Hamm C. W., Heitner J. F., Kim R., Lerman A.,
Patel M. R., Tanguay J. F., Lepore J. J., Al-Khalidi H. R., Sprecher D. L., Granger
C. B.; SOLSTICE Investigators., Losmapimod, a novel p38 mitogen activated
protein kinase inhibitor, in non-ST-segment elevation myocardial infarction:
a randomized phase 2 trial, The Lancet 2014; 384 (9949) s. 1187-95
21. GlaxoSmithKline. A Phase 3 clinical outcomes study to compare the incidence
of major adverse cardiovascular events in subjects presenting with acute
coronary syndrome treated with losmapimod compared to placebo
(LATITUDE-TIMI 60), ClinicalTrials.gov Identifier: NCT02145468
22. Rosenson R. S., Stafforini D. M., Modulation of oxidative stress,
inflammation, and atherosclerosis by lipoprotein-associated phospholipase
A2, J Lipid Res, 2012; 53, s. 1767-82
23. O’Donoghue M. L., Braunwald E., White H. D., Lukas M. A., Tarka E., Steg
P. G., Hochman J. S., Bode C., Maggioni A. P., Im K., Shannon J. B., Davies
R. Y., Murphy S. A., Crugnale S. E., Wiviott S. D., Bonaca M. P., Watson D.
F., Weaver W. D., Serruys P. W., Cannon C. P,, SOLID-TIMI 52
Investigators, Steen D. L., Effect of darapladib on major coronary events after
an acute coronary syndrome: the SOLID-TIMI 52 randomized clinical trial,
JAMA 2014; 312, s. 1006-15
24. Dinarello C. A., Interleukin-1 in the pathogenesis and treatment
of inflammatory diseases, Blood 2011; 117, s. 3720-32
25. Ridker P.M., Howard C.P., Walter V., Everett B., Libby P., Hensen J., Thuren
T., Effects of interleukin-1b inhibition with canakinumab on IL-6, fibrinogen,
and hsCRP: A Randomized placebo controlled trial, Journal of American
College of Cardiology 2012; 59(13s1):E1539
26. Roubille F., Busseuil D., Shi Y., Nachar W., Mihalache-Avram T., Mecteau
M., Gillis M. A., Brand G., Theberge-Julien G., Brodeur M. R., Kernaleguen
A. E., Gombos M., Rheaume E., The interleukin-1beta modulator
gevokizumab reduces neointimal proliferation and improves
reendothelialization in a rat carotid denudation model, Atherosclerosis 2014;
236, s. 277-85
27. Novartis Pharmaceuticals. Cardiovascular risk reduction study (reduction
in recurrent major CV disease events) (CANTOS), ClinicalTrials.gov
Identifier: NCT01327846; 2011
119
Dominika Lach
Terapie przeciwzapalne – nowy cel w leczeniu ostrych zespołów
wieńcowych
Choroba niedokrwienna serca jest zespołem objawów chorobowych stanowiących najczęstszą
przyczynę zgonów na świecie. Szczególnie niebezpieczną jej konsekwencją jest ostry zespół
wieńcowy (OZW) charakteryzujący się znacznym ograniczeniem lub ustaniem przepływu krwi w
tętnicach wieńcowych. Pomimo ciągłego unowocześniania standardów leczenia interwencyjnego
i farmakologicznego, nawracające niedokrwienia mięśnia sercowego i śmiertelność pacjentów
pozostają na wysokim poziomie. Z tego względu potrzebne jest opracowanie bardziej skutecznych metod zapobiegania i leczenia OZW. W tym celu konieczne jest lepsze poznanie
molekularnych mechanizmów OZW. Patofizjologia OZW najczęściej polega na erozji i pękaniu
blaszki miażdżycowej, co prowadzi do zaczopowania tętnicy wieńcowej. Najnowsze badania
wskazują na istotną rolę aktywnych procesów zapalnych w patofizjologii OZW. Leki przeciwzapalne stanowiące potencjalny efekt poszukiwania terapii OZW różnią się zarówno mechanizmem, jak i obszarem działania i mogą wykazywać działanie uogólnione (kolchicyna) lub też
działać bardziej specyficznie (VT-111a, losmapimod, daraplapid, gevokizumab, kanakinumab).
Celem niniejszej pracy jest przedstawienie najnowszych danych na temat potencjalnych terapii
przeciwzapalnych u pacjentów z OZW.
Anti-inflammatory therapies – a new target for the treatment of acute
coronary syndromes
Ischemic heart disease (IHS) is a syndrome of symptoms which are the most common cause of
death in the world. The especially dangerous consequence of IHS is acute coronary syndrome
(ACS) that is characterized by a significant reduction or cessation of blood flow in the coronary
arteries. Despite the continuous upgrading of standards of interventional and pharmacological
treatment in ACS, recurrent myocardial ischemia and mortality of patients remain at a high level.
For this reason, there is still a need to develop more effective methods of prevention and
treatment of ACS. For this purpose, a better understanding of the molecular mechanisms of ACS
is necessary. Pathophysiology of ACS usually consists of erosion and rupture of atherosclerotic
plaques, leading to coronary artery obstruction. Recent studies point to the important role of
active inflammatory processes in the pathophysiology of ACS. Anti-inflammatory drugs, which
are being searched for effective therapy of ACS, are different due to the mechanism or activity
area, and may have general (colchicine) or specific (VT-111a, losmapimod, daraplapid,
gevokizumab and canacinumab) action. The aim of this study is to present the latest data on the
potential anti-inflammatory therapy in patients with ACS.
120
Karolina Kątska1, Jan Ostrowski2, Ewa Kosior-Jarecka3
Zaburzenia ze strony narządu wzroku
w przebiegu oponiaków
1. Wstęp
Oponiaki należą do najczęstszych guzów mózgu, które stwierdza się
u osób dorosłych. Stanowią około 20% pierwotnych nowotworów
wewnątrzczaszkowych, wykazują zazwyczaj łagodny charakter. Obserwowane są zwykle u pacjentów w 4. i 5. dekadzie życia, dwukrotnie częściej
u kobiet niż u mężczyzn. Oponiaki są guzami pochodzenia łącznotkankowego, rozwijającymi się z komórek kosmków pajęczynówki. Guzy
te są wyraźnie odgraniczone od otaczającej je tkanki mózgowej, nie
powodują jej naciekania, lecz jedynie ucisk [1]. Zaburzenia ze strony
narządu wzroku stanowią częstą i niejednokrotnie pierwszą manifestację
kliniczną oponiaków. Objawy oczne są najbardziej wyrażone w oponiakach
wywodzących się z następujących struktur tj. osłonek nerwu wzrokowego,
rynienki węchowej, guzka siodła tureckiego (oponiaki nadsiodłowe) oraz
skrzydła kości klinowej. Guzy te mogą powodować ucisk nerwu
wzrokowego i w konsekwencji jego zanik. Do częstych objawów
oponiaków należą m.in. zaburzenia ostrości wzroku, ubytki w polu
widzenia ale także dwojenie, wytrzeszcz czy zaburzenia widzenia barw.
2. Cel pracy
Celem niniejszej pracy było omówienie wybranych rodzajów oponiaków wykazujących istotne klinicznie objawy oczne na podstawie
przeglądu aktualnego piśmiennictwa. Z uwagi na możliwość penetracji tej
grupy oponiaków w obręb tkanek oczodołowych u pacjentów dotkniętych
tymi schorzeniami może dochodzić do zaburzeń widzenia i innych
objawów dotyczących narządu wzroku. Z tego względu zasadne wydało się
zwrócenie uwagi na te, nie tak rzadkie, patologie wewnątrzczaszkowe.
1
[email protected], Studenckie Koło Naukowe przy Katedrze Okulistyki Uniwersytetu
Medycznego w Lublinie
2
) [email protected], Studenckie Koło Naukowe przy Katedrze Okulistyki Uniwersytetu
Medycznego w Lublinie
3
[email protected], Klinika Diagnostyki i Mikrochirurgii Jaskry Katedry Okulistyki
Uniwersyetu Medycznego w Lublinie
121
Karolina Kątska, Jan Ostrowski, Ewa Kosior-Jarecka
3. Charakterystyka wybranych oponiaków
Niektóre guzy wewnątrzczaszkowe powodują postępujące deficyty
widzenia oraz ubytki w polu widzenia w ciągu tygodni lub miesięcy zanim
zostanie postawiona ostateczna diagnoza [2]. Początkowe objawy są często
niewłaściwie interpretowane zarówno przez samych pacjentów jak
i lekarzy, co powoduje opóźnienie w rozpoczęciu odpowiednich badań [3].
Należy zwrócić uwagę na fakt, że w wielu przypadkach okulista jest
pierwszym lekarzem, do którego zgłasza sie pacjent, zanim trafi do
właściwego specjalisty [3].
3.1. Oponiak osłonek nerwu wzrokowego
Oponiak osłonek nerwu wzrokowego (ONSM – Optic Nerve Sheath
Meningioma) jest łagodnym guzem występującym w obrębie oczodołu,
czasem wrastającym do przestrzeni wewnątrzczaszkowej. Stanowi 1-2%
wszystkich oponiaków. Zachorowania są częstsze u kobiet (5:1) w średnim
wieku (30-40 lat), rzadziej dzieci [4]. ONSM jest rzadkim nowotworem
wywodzącym się z komórek pajęczynówki nerwu wzrokowego (II). Opona
pajęcza otacza nerw II w odcinku wewnątrzoczodołowym i w kanale
wzrokowym, występowanie ONSM stwierdza się częściej w pierwszej
lokalizacji (92%). Pierwotnie zlokalizowane w przednim dole czaszki
oponiaki naciekające odcinek wewnątrzczaszkowy nerwu i wkraczające do
oczodołu określane są niekiedy jako wtórne ONSM [6]. OSNMs są to guzy
które wywodzą się z komórek kosmków pajęczynówki i mogą rozwinąć się
w każdej lokalizacji wzdłuż całego przebiegu osłonki nerwu. Guzy te
wykazują charakter wzrostu typowy dla oponiaków, następujący drogą
najmniejszego oporu. Zajęcie przez oponiaki otaczającej opony twardej,
tkanek, mięśni i kości oczodołu jest rzadkie aczkolwiek takie przypadki
były notowane. Wraz ze swoim rozwojem, nowotwór ten upośledza funkcje
nerwu wzrokowego, głównie poprzez wywoływanie efektu masy na
naczynia zaopatrujące oponę miękką, co wywołuje zmiany o charakterze
niedokrwiennym oraz zaburza transport aksonalny. Ponadto ONSMs rosną
otaczając nerw II na jego obwodzie co powoduje oddzielenie struktur
nerwu od jego zaopatrzenia w krew. Ten charakter wzrostu sprawia, że
guzy te stają się często niemożliwe do usunięcia bez istotnego naruszenia
struktury nerwu II [7]. Klasyczna triada objawów obejmuje: zanik nerwu
wzrokowego, spadek ostrości widzenia i obecność naczynia wzrokoworzęskowego krążenia obocznego [4, 7]. Jednakże jednoczesne wystąpienie
wszystkich trzech objawów u jednego pacjenta jest rzadkie [9]. Najczęstszym objawem występującym u pacjentów z ONSM (obecny w około
96% przypadkach) jest bezbolesny, przewlekły spadek ostrości widzenia
lub ubytki w polu widzenia które mogą utrzymywać się przez okres od
122
Zaburzenia ze strony narządu wzroku w przebiegu oponiaków
1-5 lat zanim pacjent zgłosi się do lekarza. Spośród rzadziej spotykanych
objawów obserwuje się wytrzeszcz, dwojenie, względny defekt aferentnej
drogi odruchu źrenicznego oraz zaburzenie widzenia barw [4]. Do innych
niespecyficznych dolegliwości należą ból zlokalizowany w oczodole i bóle
głowy, które to objawy były obserwowane u 2-50% pacjentów z ONSM
[7]. Badanie dna oka praktycznie zawsze ukazuje patologiczny wygląd
tarczy nerwu wzrokowego, na który może się składać jej obrzęk i różnego
stopnia zanik nerwu wzrokowego, co może wskazywać na neuropatię
uciskową nerwu II [8]. Do obrzęku tarczy nerwu wzrokowego dochodzi
zazwyczaj gdy guz otacza lub powoduje ucisk odcinka wewnątrzoczodołowego nerwu [8]. Trudności diagnostyczne polegają na różnicowaniu ONSM z glejakami n.II. Diagnostyki różnicowej wymagają również
sarkoidoza, chłoniak, hemangiopericytoma, oczodołowa schwannoma,
demielinizacyjne zapalenie nerwu II, przerzuty nowotworowe [4].
Rysunek 1. Oponiak nerwu wzrokowego. U góry: wczesny ucisk nerwu wzrokowego; u dołu:
wytrzeszcz jako późny objaw (rycina zaadaptowana z [9])
Najważniejszym badaniem, które pozwala na rozpoznanie oponiaka jest
tomografia komputerowa (TK) oczodołów, która wykazuje cylindryczne
pogrubienie nerwu wzrokowego, a w 20% przypadków także obecność
patologicznych zwapnień w obrębie guza. Patognomoniczną cechą jest
obecność zwapnień w TK, które mogą dawać obraz „szyn tramwajowych”,
tzn. cewkowatego wzmocnienia echogennego zwapnień w pochewkach n.
II. Alternatywnym badaniem jest rezonans magnetyczny (MR), który jest
szczególnie przydatny w ocenie wewnątrzczaszkowej ekspansji guza [4,
10]. Postępowanie w przypadku oponiaków nerwu wzrokowego powinno
być indywidualnie dobrane dla każdego pacjenta. U osób w średnim wieku,
z powoli rosnącym guzem, gdzie rokowanie jest dobre, wystarczy obser123
Karolina Kątska, Jan Ostrowski, Ewa Kosior-Jarecka
wacja. Jeśli stwierdza się postęp zmian, przy zachowanej zadowalającej
ostrości wzroku, postępowaniem z wyboru jest nowoczesna trójwymiarowa
radioterapia, polegająca na stosowaniu odpowiednio dawkowanej wiązki
promieni, celowanej na pochewki nerwu wzrokowego. U młodszych
pacjentów, z tendencją do rozrostu zmiany, należy usunąć ją chirurgicznie,
oszczędzając gałkę oczną. W przypadku bardziej agresywnego przebiegu,
najpierw usuwa się dostępną masę guza, a następnie stosuje się
radioterapię. Oponiak nerwu wzrokowego to zmiana łagodna, rośnie
powoli i rokowanie jest zazwyczaj dobre. Duży odsetek oponiaków można
bezpiecznie obserwować przez wiele lat. Guzy o ciężkim przebiegu,
penetrujące wewnątrzczaszkowo, mogą stanowić zagrożenie nawet dla
życia chorego, na szczęście są to zmiany niezwykle rzadkie. Rokowanie
w przypadku oponiaka nerwu wzrokowego jest dużo gorsze u dzieci niż
u dorosłych [10].
3.2. Oponiaki wewnątrzczaszkowe
Oponiaki podstawy przedniego dołu czaszki są guzami wewnątrzczaszkowymi powodującymi istotne zaburzenia ze strony narządu wzroku.
Jest to niejednorodna grupa, obejmująca guzy szeroko rozmieszczone na
podstawie przedniego dołu czaszki, począwszy od oponiaków rynienki
węchowej, poprzez oponiaki mające swój przyczep na łęku klinowym, aż
do oponiaków okolicy guzka siodła tureckiego. Ta grupa nowotworów,
z uwagi na różnorodność miejsca przyczepu oponowego, cechuje się
różnym charakterem wzrostu w stosunku do nerwów wzrokowych i naczyń
podstawy czaszki, a przez to odmiennością objawów i różnym przebiegiem
choroby u chorych z oponiakami zlokalizowanymi odpowiednio w przedniej i tylnej części podstawy przedniego dołu czaszki. Niezależnie jednak
od ścisłej lokalizacji oponiaki podstawy przedniego dołu czaszki mogą
powodować zaburzenia widzenia, które często są głównym objawem
klinicznym i których ustąpienie po leczeniu operacyjnym w pierwszym
rzędzie decyduje o powrocie pacjenta do pełni zdrowia [13].
124
Zaburzenia ze strony narządu wzroku w przebiegu oponiaków
Rysunek 1. Ucisk wewnątrzczaszkowy odcinka nerwu wzrokowego przez oponiaki oraz
ubytki w polu widzenia spowodowane uciskiem oponiaka guzka siodła tureckiego (rycina
zaadaptowana z [11])
3.2.1. Oponiaki rynienki węchowej
Oponiak rynienki węchowej należy do grupy oponiaków wewnątrzczaszkowych. Częstość występowania tego nowotworu sięga 8-14%
wszystkich guzów pochodzenia oponowego. Oponiaki te są najczęściej
obustronne i asymetryczne. Rozrastają się zazwyczaj w obrębie środkowej
części przedniego dołu czaszki, między grzebieniem kogucim, znajdującym
się w centralnej części kości sitowej, a szwem czołowo-klinowym [1]. Jest
to anatomicznie najsłabsza część pokrywy czaszki, dlatego nowotwór
szybko penetruje do podstawy czaszki oraz oczodółu, zatok przynosowych
i jamy nosa. Oponiaki rynienki węchowej rosną wolno i, zanim pojawią się
pierwsze cechy wzrostu ciśnienia wewnątrzczaszkowego, osiągają zazwyczaj dość duże rozmiary. Przez większość czasu pozostają nieme
klinicznie [12]. Zaburzenia ze strony narządu wzroku pod postacią
pogorszenia ostrości wzroku oraz ubytków w polu widzenia stanowią
istotny i często pierwszy zauważalny przez pacjentów objaw rozwijającego
się guza. Objawy oczne występują najczęściej w zaawansowanych
postaciach nowotworu, gdy masa guza uciska od góry i spycha ku tyłowi
skrzyżowanie nerwów wzrokowych lub też na skutek nadciśnienia
wewnątrzczaszkowego powstaje obrzęk tarcz nerwów wzrokowych i cechy
ich wtórnego zaniku. Triada objawów charakterystycznych dla oponiaka
rynienki węchowej określana jest jako zespół Fostera-Kennedy’ego.
W jego skład wchodzą zaburzenia węchu po stronie nowotworu, zanik
125
Karolina Kątska, Jan Ostrowski, Ewa Kosior-Jarecka
tarczy n.II po tej samej stronie i tarcza zastoinowa po stronie przeciwnej.
W czasie powolnego rozwoju nowotwory te stopniowo uciskają płaty
czołowe, powoduje to zaburzenia osobowości i funkcji poznawczych,
związane z uszkodzeniem tej okolicy mózgu [1]. Według wielu
retrospektywnie opisywanych przypadków, najczęstszym objawem okazuje
się być ból głowy. Dolegliwość ta jest zazwyczaj zgłaszana wówczas gdy
guz osiągnie duże rozmiary. Natomiast osłabienie węchu, często
stwierdzane w badaniu neurologicznym juz po przyjęciu chorego do
szpitala, rzadko bywa objawem zwracającym uwagę pacjenta i prowadzącym do postawienia właściwego rozpoznania [3].
3.2.2. Oponiaki nadsiodłowe
Oponiaki nadsiodłowe wyrastają najczęściej z okolicy guzka siodła
tureckiego i płaszczyzny klinowej- mogą również mieć swój początek
w przeponie siodła tureckiego, rosnąc zarówno do wnętrza siodła jak i ku
górze [14]. Stanowią one około 3-10% oponiaków wewnątrzczaszkowych
[15]. Pierwszym objawem klinicznym w przypadku guzów o tej lokalizacji
są zaburzenia wzrokowe, rozpoczynające się ograniczeniem pola widzenia
[14]. Wynika to z faktu, że oponiaki wyrastające z guzka siodła tureckiego
już we wczesnym etapie wzrostu wnikają pod skrzyżowanie nerwów
wzrokowych i unosząc je ku górze, powodują krytyczne napięcie zarówno
skrzyżowania jak i nerwów wzrokowych. Wielu autorów podkreśla
dominującą w obrazie klinicznym tych oponiaków stosunkowo szybką,
często niezauważalną dla pacjenta utratę widzenia [13]. Najczęściej
postępująca utrata widzenia ma charakter niesymetryczny, czasem
rozpoczyna się od niedowidzenia połowiczego dwuskroniowego, pierwotnego lub wtórnego zaniku tarcz nn. wzrokowych, czasem zespołu
Foster-Kennedy’ego. Oponiaki nadsiodłowe uciskają jeden bądź oba nn.
wzrokowe wraz ze skrzyżowaniem ku tyłowi, najczęściej nie naciekając
tętnicy szyjnej wewnętrznej. Duże guzy mogą przemieszczać skrzyżowanie
nn. wzrokowych zarówno ku dołowi, jak i ku górze, rozpychając na boki
tętnice szyjne i odsuwając od skrzyżowania kompleks obu tętnic przednich.
Rzadziej występujące objawy stanowią bóle głowy, a w dalszej kolejności
zaburzenia psychiczne, zniesienie węchu, napady padaczkowe, podwójne
widzenie, ból oka i zaburzenia hormonalne [15].
3.2.3. Oponiaki skrzydła kości klinowej
Oponiaki położone wzdłuż skrzydła kości klinowej stanowią około
18%. Guzy te są zlokalizowane w pobliżu istotnych struktur nerwowych
i naczyniowych tj. nerw wzrokowy, zatoka jamista, tętnica szyjna
wewnętrzna oraz tętnice środkowe mózgu. W skutek tego, odpowiadają one
126
Zaburzenia ze strony narządu wzroku w przebiegu oponiaków
za wysoki odsetek zachorowań i przypadków śmiertelnych. Wśród
objawów tych nowotworów wymienia się bóle głowy, utratę widzenia,
epizody niedokrwienne oraz podwójne widzenie wynikające z porażenia
jednego lub więcej mięśni zewnętrznych gałki ocznej [16]. Oponiaki
skrzydła kości klinowej, w zależności od kształtu, sklasyfikowano na
nowotwory typu „guzowatego”, przybierające kulisty kształt oraz oponiaki
typu pełzającego „en plaque”. Oponiaki kuliste to guzy obrastające
i przemieszczające w różnym stopniu tętnice wewnątrzczaszkowe i nerwy
czaszkowe, mające swój przyczep oponowy. Guzy rosnące w sposób
pełzający, płaskie, wnikają do kości przez kanały Haversa, powodując jej
przebudowę. Oponiaki „en plaque” naciekają kości podstawy czaszki
i części twarzowej czaszki, nierzadko doprowadzając do znacznego
zniekształcenia twarzy, przez przebudowę kości i zaburzenia w odpływie
żylnym [14]. Spośród oponiaków o guzowatym typie wzrostu, ze względu
na miejsce przyczepu i odmienną symptomatologię, wyodrębniono
oponiaki przyśrodkowej, środkowej i zewnętrznej części skrzydła
mniejszego kości klinowej. Oponiaki 1/3 przyśrodkowej części najczęściej
poza jednostronną utratą wzroku powodują powoli narastającą
oftalmoplegię, połączoną z wytrzeszczem gałki ocznej (spowodowanym
utrudnieniem odpływu żylnego z oczodołu), a w końcu zajęcie I gałęzi
nerwu trójdzielnego, spowodowane uciskiem bocznej ściany zatoki.
Oponiaki zlokalizowane w części środkowej często rozrastają się do
znacznych rozmiarów, powodując dominujące objawy wzmożonego
ciśnienia śródczaszkowego w postaci bólów głowy, wymiotów i obrzęku
tarcz nn. wzrokowych. Zaburzenia w polu widzenia, zniesienie węchu po
stronie guza i napady padaczkowe z aurą wzrokową i węchową pojawiają
się zazwyczaj w późnym okresie choroby. Kuliste oponiaki zewnętrznej
części skrzydła mniejszego kości klinowej powodują objawy patologicznej
masy w okolicy skroniowej bądź czołowej w przeciwieństwie do
oponiaków „en plaque”. Te ostatnie objawiają się najczęściej zniekształceniem okolicy skroniowej, powolnym narastaniem wytrzeszczu gałki
ocznej, spowodowanym pogrubieniem kości, wrastaniem guza do wnętrza
oczodołu, utrudnieniem odpływu żylnego czy odpływu chłonki z oczodołu
i wreszcie narastającymi zaburzeniami w polu widzenia [14].
4. Diagnostyka i leczenie
Rozpoznanie oponiaka ustala się na podstawie obrazu klinicznego oraz
charakterystycznych zmian widocznych w tomografii komputerowej
i rezonansie magnetycznym. Objawy okulistyczne mogą stanowić
niejednokrotnie pierwsze symptomy obecności guza a zaobserwowanie
szybkiej progresji spadku ostrości widzenia i dołączanie się objawów
127
Karolina Kątska, Jan Ostrowski, Ewa Kosior-Jarecka
dodatkowych powinno skłonić lekarza okulistę do uwzględnienia patologii
wewnątrzczaszkowej w diagnostyce różnicowej.
Najskuteczniejszym sposobem leczenia oponiaków jest ich całkowita
resekcja chirurgiczna. Często jest ona jednak trudna do wykonania ze
względu na naciekanie przez komórki nowotworowe naczyń tętniczych
mózgu, nerwów wzrokowych oraz kości przedniego dołu czaszki. Coraz
częściej więc wykorzystuje się techniki mikrochirurgiczne. Leczenie
oponiaków bywa wspomagane radioterapią oraz embolizacją patologicznych naczyń guza. Decyzja o podjęciu interwencji chirurgicznej zależy
od wielu czynników, między innymi od stopnia wizualizacji guza, jego
rozmiarów i zachowania okolicznych struktur nerwowych i naczyniowych
oraz ryzyka rozwoju powikłań. O skuteczności leczenia oponiaków świadczy
brak nawrotu choroby. Częstość nawrotów zależy przede wszystkim od tego,
jak szybko dokonano resekcji i czy była ona kompletna [10].
Istnieje zgodność, że decydującymi czynnikami wpływającymi na
wyniki leczenia są przede wszystkim wielkość guza oraz ostrość widzenia
przed operacją. W sposób znamienny poprawę widzenia rokują także brak
zaniku nerwu wzrokowego na dnie oka i zachowana ostrość wzroku
powyżej 0,3. Nawet w przypadkach śladowo zachowanej funkcji wzroku
i obecności zaniku nerwu wzrokowego na dnie oka w ok. 20% przypadków
można liczyć na istotną poprawę widzenia po leczeniu operacyjnym.
Stwierdzenie ślepoty przed operacją nie rokuje poprawy po leczeniu
operacyjnym [13].
5. Podsumowanie
Oponiaki należą do jednych z najczęściej występujących guzów mózgu,
stwierdzanych u osób dorosłych. Zaburzenia ze strony narządu wzroku są
istotne klinicznie i niejednokrotnie stanowią pierwsze objawy rozrastającego się guza. Objawy oczne są najczęściej stwierdzane w oponiakach
osłonek nerwu wzrokowego oraz oponiakach wewnątrzczaszkowych
tj. rynienki węchowej, guzka siodła tureckiego (oponiaki nadsiodłowe) oraz
skrzydła kości klinowej. Należy zwrócić uwagę, iż okulista może być
lekarzem do którego w pierwszej kolejności zgłosi się pacjent z oponiakiem manifestującym się objawami zarówno neurologicznymi jak
i okulistycznymi. Zaburzenia neurookulistyczne powinny być uważnie
monitorowane ażeby uniknąć opóźnienia w kwestii postawienia diagnozy
patologii wewnątrzczaszkowej [3]. Najbardziej przydatne w diagnostyce
oponiaków, oprócz obrazu klinicznego są badania obrazowe, głównie TK
i MR. Całkowita chirurgiczna resekcja guza stanowi w większości
przypadków jedyną trwale skuteczną metodę leczenia.
128
Zaburzenia ze strony narządu wzroku w przebiegu oponiaków
Literatura
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
Napora K. J., Obuchowska I., Mariak Z., Objawy okulistyczne w przebiegu
oponiaka rynienki węchowej, OKULISTYKA, 4 (2011), s. 105-107
Aui-aree N., Phruanchroen C., Oearsakul T., Hirunpat S., Sangthong R., Three
years experience of suprasellar tumors in neuro-ophthalmology clinic, Journal
of the Medical Association of Thailand, 7 (2010), s. 818-23
Jung J. J., Warren F. A., Kahanowicz R., Bilateral visual loss due to a giant
olfactory meningioma, Clinical Ophthalmology, 6 (2012), s. 339-342
Chipczyńska B., Grałek M., Trzebicka A., Hautz W., Kanigowska K.,
Klimczak-Ślączka D., Obustronny oponiak osłonek nerwu wzrokowego (ONSM)problemy diagnostyczne i lecznicze, Klinika Oczna, 4-6 (2006), s. 202-205
Sefi-Yurdakul N., Visual findings as primary manifestations in patients with
intracranial tumors, International Journal of Ophthalmology 8 (2015), s. 800-803
Dutton J. J., Optic nerve sheath meningiomas, Survey of Ophthalmology,
37 (1992), s. 167-183
Eddleman C. S., Liu J. K., Optic nerve sheath meningioma: current diagnosis
and treatment, Neurosurgical Focus, 23 (2007), s. 1-7
Miller N. R., Primary tumours of the optic nerve and its sheath, Eye 18
(2004), s. 1026-1037
Kański J. J., red. wyd. pol. Zagórski Z. Okulistyka Kliniczna, 1 (1997), s.50
http://okulistyka.mp.pl/chorobyoczu/neurookulistykaizez/83020,oponiaknerwu-wzrokowego
Kański J. J., Bowling B., red. wyd. pol.: Szaflik J., Izdebska J. Okulistyka
kliniczna, 4 (2013), s.106-107
Tuna H., Bozkurt M., Ayten M., Erdogan A., Deda H., Olfactory groove
meningiomas, Journal of Clinical Neuroscience, 6 (2005), s. 664-8
Nowak A., Marchel A., Leczenie operacyjne oponiaków podstawy przedniego
dołu czaszki, Neurologia I Neurochirurgia Polska, 40 (2006), s. 484-492
Ząbek M., Zarys neurochirurgii, Wydawnictwo Lekarskie PZWL, 1 (1999),
s. 56-70
Chi J. H., Mcdermott M. W., Tuberculum SellaeMeningiomas, Neurosurgical
Focus, 14 (2003)
Chaichana K. L., Jackson C., Patel A., Miller N. R., Subramanian P., Lim M.,
Gallia G., Olivi A., Weingart J., Brem H., Quiones-Hinojosa A., Predictors
of Visual Outcome Following Surgical Resection of Medial Sphenoid Wing
Meningiomas, Journal of Neurological Surgery, 73 (2012), s. 321-326
Lindsay K. W, Bone I., Neurologia i Neurochirurgia. Elsevier Urban&Partner,
Wrocław, 1 (2004), s. 321-323
129
Karolina Kątska, Jan Ostrowski, Ewa Kosior-Jarecka
Zaburzenia ze strony narządu wzroku w przebiegu oponiaków
Oponiaki należą do najczęstszych guzów mózgu, które stwierdza się u osób dorosłych.
Zachorowania są częstsze u kobiet w średnim wieku. W wielu przypadkach objawy oponiaków
pochodzące z narządu wzroku pojawiają się jako pierwsze, co może być przydatne w postawieniu
właściwej diagnozy. Manifestacja oczna stanowi istotny element obrazu klinicznego wielu
spośród tych chorób, a w szczególności oponiaka osłonek nerwu wzrokowego oraz oponiaków
przedniego dołu czaszki tj. oponiak rynienki węchowej, guzka siodła tureckiego oraz skrzydła
kości klinowej. Do najczęstszych objawów należą zaburzenia ostrości wzroku, ubytki w polu
widzenia, dwojenie czy też wytrzeszcz. Guzy te mogą powodować ucisk nerwu wzrokowego
a nawet jego zanik. Diagnostyka opiera się na obrazie klinicznym oraz badaniach obrazowych.
Najskuteczniejszym sposobem leczenia oponiaków jest ich całkowita resekcja chirurgiczna.
Ocular disorders in the course of meningiomas
Meningiomas are the most common tumors of the brain that are found in adults. The disease most
often develops in middle-aged women. In many cases, ocular symptoms of meningiomas appear
first, which might be useful for a diagnosis. Ocular manifestation is an important part of the
clinical picture of many of these diseases, especially optic nerve sheath meningioma and anterior
cranial fossa meningiomas, ie. olfactory groove meningioma, tuberculum sella and sphenoid
wing. The most common symptoms include deterioration of vision acuity, visual field defects,
diplopia or proptosis. These tumors can cause compression of the optic nerve and even its
atrophy. Diagnosis is based on clinical presentation and imaging studies. The most effective
treatment for meningiomas is their complete surgical resection.
130
Anna Łabejszo1, Tomasz Wandtke2, Maciej Gawroński3
Alergiczne zapalenie pęcherzyków płucnych
– immunopatogeneza i leczenie
1. Wprowadzenie, pojęcia wstępne
Niniejsza praca ma na celu przegląd informacji o obecnym stanie
wiedzy dotyczącej alergicznego zapalenia pęcherzyków płucnych, a także
prezentację metod leczenia tejże choroby oraz przybliżenie nowych
perspektyw terapeutycznych.
Alergiczne zapalenie pęcherzyków płucnych (AZPP, HP – hypersensitivity
pneumonitis) to choroba, rozwijająca się u osób wcześniej narażonych
ekspozycją na antygen, u których doprowadziło to do rozwoju uczulenia. Jest
to schorzenie o charakterze ziarniniakowym, a skłonności do zapadania na tę
chorobę są indywidualną predyspozycją [1, 2]. Nie istnieją jednoznaczne
kryteria do rozpoznania choroby. Uważa się, że u osób narażonych na
ekspozycję na czynniki środowiskowe, warunki klimatyczne, pyły pochodzące
z przemysłu rolno-spożywczego, a także pora roku mają wpływ na częstsze
występowanie tego schorzenia [3, 4]. W związku z różnorodnością czynników
uczulających wyróżniamy wiele rodzajów alergicznego zapalenia
pęcherzyków płucnych, m.in.:
 płuco farmera – charakteryzujące się występowaniem w organizmie
pacjenta precypityn, czyli rodzaju przeciwciał surowicy krwi
powodujących wytrącanie się (tzw. precypitację) z roztworu
rozpuszczalnego antygenu, w tym przypadku są nim termofilne
promieniowce. Na podstawie badańimmunofluorescencyjnych
wycinków płuc stwierdza się obecność precypityn w przegrodach
międzypęcherzykowych i w ścianie oskrzeli. Choroba ta najczęściej
występuje u mężczyzn w wieku 40-50 lat. U osób z ostrą postacią
choroby okresem, w którym odnotowuje się szczyt zachorowań to
koniec lata i zimy, czyli najbardziej intensywne okresy pracy
w rolnictwie. Diagnozę schorzenia często utrudniają podobne objawy
1
[email protected], Zakład Genoterapii, Wydział Lekarski, Uniwersytet Mikołaja
Kopernika Collegium Medicum im. Ludwika Rydgiera w Bydgoszczy
2
[email protected], Zakład Genoterapii, Wydział Lekarski, Uniwersytet Mikołaja
Kopernika Collegium Medicum im. Ludwika Rydgiera w Bydgoszczy
3
[email protected]
131
Anna Łabejszo, Tomasz Wandtke, Maciej Gawroński
jak w przypadku innych chorób układu oddechowego: astmy,
przewlekłej obturacyjnej choroby płuc [5, 19];
 płuco hodowców ptaków – w przypadku tej choroby jednym z antygenów jest mucyna, wydzielana do przewodu pokarmowego zwierząt
i wydalana z odchodami. Schorzenie dotyka najczęściej hodowców
gołębi, kur, kaczek, papug, gęsi oraz ptaków dzikich. Istotnym
czynnikiem rozwoju choroby jest bezpośredni kontakt z ptactwem.
Badacze stwierdzili, iż progresja choroby jest skorelowana ze
stężeniem przeciwciał IgG1 oraz IgG3, a jak wiadomo IgG to klasa
immunoglobulin o istotnym znaczeniu w walce z patogenami
wnikającymi do organizmu. Ich stężenie w surowicy jest największe
w porównaniu z przeciwciałami innych klas [6, 7, 20];
 choroba hodowców grzybów – reakcję alergiczną mogą wywoływać
tak jak w przypadku płuca farmera promieniowce termofilne.
Wysoka temperatura i wilgotność to warunki, w jakich hoduje się
grzyby, a to sprzyja rozwojowi promieniowców. Pyły unoszące się
przy uprawie wywołują u osób wrażliwych reakcję alergiczną
prowadzącą do rozwinięcia stanu chorobowego;
 płuco robotników produkujących środki piorące – przyczyną schorzenia jest reakcja alergiczna, jaką wywołują antygeny laseczki
siennej (Bacillus subtilis). Mimo doniesień naukowych wskazujących na związek między bakterią, a występowaniem choroby nie
udało się wyizolować swoistych przeciwciał;
 izocyjanianowe HP – przyczyną schorzenia jest reakcja na pełnowartościowy antygen powstały z połączenia izocyjanianu (haptenu)
i białek wydzieliny dróg oddechowych [2, 6].
Według najnowszych danych można wyróżnić około 200 antygenów
powodujących HP. W tabeli zestawiono najczęstsze antygeny i odpowiadające im typy alergicznego zapalenia pęcherzyków płucnych [9].
132
Alergiczne zapalenie pęcherzyków płucnych – immunopatogeneza i leczenie
Tabela 1. Czynniki wywołujące AZPP [9]
Antygen
Micropolysporafaeni
Źródło
Systemy nawilżające
powietrze,
klimatyzatory
Izocyjaniany, cynk
Farby, plastik
Pyrethrum
Pestycydy
Białko sierści zwierząt
futerkowych
Białka surowicy, skóry,
sierści, odchodów
zwierząt laboratoryjnych
Zwierzęta laboratoryjne
Płuco pracowników
laboratoriów
Trichosporoncutaneus
Środowisko domowe
Promieniowce
termofilne,
Saccharopolyspora
Spleśniałe siano
Mycobacteriumavium
Płuco pracowników
przemysłu chemicznego
AZPP wywołane
środkami
owadobójczymi
Płuco kuśnierzy
Penicillium sp.
Mycobacteriumspecies
Płuco nawilżaczowe
Futra
Surowica, pióra,
odchody gołębi, papug,
kaczek, indyków
Płyny stosowane do
chłodzenia metalu
w przemyśle
metalowym
Woda w basenach,
jaccuzi, itp.
Sery
Białka surowicy, piór,
odchodów ptaków
Choroba
Płuco hodowcy ptaków
Płuco pracowników
przemysłu
metalowego
hot tub lung
Płuco serowarów
Japońskie letnie
zapalenie pęcherzyków
płucnych
Płuco farmera
Źródło: [9]
Podział AZPP na postać ostrą, podostrą i przewlekłą, poddaje się
dyskusji dlatego obecnie przyjmuje się wyróżnienie typów:
 ostry postępujący – charakterystyczne są objawy wymagające
hospita-lizacji, które występują niedługo po ekspozycji na antygen
(2-9 godzin);
 ostry przerywany – objawy pojawiają się po ekspozycji, ale nie są
tak nasilone jak w postaci ostrej postępującej, pomiędzy epizodami
wyniki badań chorego są w normie i nie pojawiają się objawy;
 subkliniczny – charakteryzuje się obecnością przeciwciał skierowanych przeciw antygenom, nie występują objawy, natomiast przy
133
Anna Łabejszo, Tomasz Wandtke, Maciej Gawroński
ciągłej ekspozycji na czynnik uczulający może dojść do rozwoju
postaci przewlekłej;
 przewlekły postępujący – może przebiegać z początku w utajeniu,
lub rozwija się z nawracających ostrych epizodów, charakterystyczna
jest zwiększająca się duszność wysiłkowa, kaszel, co może
doprowadzić do włóknienia płuc [18].
Częstość zachorowań w Polsce na alergiczne zapalenie pęcherzyków
płucnych wynosi 10/100 tys. i jest trzecią pod tym względem chorobą
śródmiąższową w Polsce [8].
2. Immunopatogeneza
Przyczyną alergicznego zapalenia pęcherzyków płucnych jest powtarzająca
się ekspozycja na daną cząstkę immunologiczną, która wywołuje reakcję
alergiczną. Istotnym jest fakt, że cząstki te mają wielkość poniżej 5 µm
przedostają się do dolnych dróg oddechowych, a konkretnie wnikają do
pęcherzyków płucnych i organizm nie jest w stanie ich usunąć. Czy rozwinie
się dalej choroba decydują o tym czynniki takie, jak: predyspozycja osobnicza,
odpowiednie stężenie alergenów czy też współistnienie kofaktorów, którymi
mogą być infekcje grzybicze, wirusowe. W HP mamy do czynienia z typem III
i IV reakcji immunologicznej. Typ III wiąże się z produkcją przeciwciał klasy
IgG oraz IgM. Precypityny (przeciwciała) tworzą z antygenami, które
przedostały się z pęcherzyków płucnych do krwi kompleksy immunologiczne
[10]. Ich obecność nie została potwierdzona wynikami badań, biopsja płuc
wykazuje tylko nacieki granulocytów i limfocytów [11]. Powstałe kompleksy
immunologiczne uruchamiają układ dopełniacza. Ten natomiast stymuluje
aktywację makrofagów (komórek żernych), stanowiących znaczący element
w obronie organizmu. Makrofagi zaczynają wydzielać szereg chemokin
i cytokin: interleukinę 8 (IL-8),czynnik martwicy guza α (TNF-α) oraz
interleukinę 6 (IL-6),makrofagowe białko hamujące (MIP-1). Ich zadaniem
jest wzmaganie procesu zapalnego, a dodatkowo powodują napływ
makrofagów i neutrofili do śródmiąższu. Makrofagi wydzielają też
w większych ilościach czynnik tworzenia kolonii granulocytów i makrofagów
(GM-CSF) oraz lizozym, kolagenzę, elastazę i rodniki tlenowe odpowiedzialne
za uszkodzenia pęcherzyków płucnych. Jest to pierwszy etap odpowiedzi na
antygen [12]. Jednak ważniejszą rolę w immunopatogenezie alergicznego
zapalenia pęcherzyków płucnych odgrywa reakcja typu późnego (typ IV),
w której zaangażowane są limfocyty T. Liczba aktywnych limfocytów wzrasta
i może osiągnąć nawet do 70% ogólnej liczby komórek odzyskanych z płynu
z płukania oskrzelowo-pęcherzykowego. W dużym stopniu wzrasta poziom
limfocytów CD8+ (cytotoksycznych), a w mniejszym CD4+ (pomocniczych). W proces tworzenia ziarniniaków szczególnie zaangażowane są
134
Alergiczne zapalenie pęcherzyków płucnych – immunopatogeneza i leczenie
limfocyty CD4+, inaczej Th. Jedna subpopulacja tych limfocytów- Th1
uwalnia interferon γ (INFγ) i IL-2, a druga Th2- szereg interleukin : 4, 5, 10
[2]. Postuluje się, że przewaga limfocytów CD8+ jest związana z aktywną
fazą choroby, natomiast przewaga komórek CD4+ świadczy o postępującym procesie włóknienia [12]. Niezwykle ważnym elementem patogenezy jest podłoże genetyczne stanu zapalnego. Mianowicie badacze
sugerują, iż geny kodujące układ zgodności tkankowej o zwiększonej
częstości występowania alleli HLA – DQB1 oraz HLA – DR B1 koreluje
z przebiegiem reakcji zapalnej u chorych hodowców gołębi [11]. Na uwagę
zasługuje również interleukina 10, której niedobór powoduje, że aktywność
komórek Th1 nie jest hamowana, czego konsekwencją jest ciągle
wzrastające lub utrzymujące się na wysokim poziomie stężenie interferonu
γ. W konsekwencji prowadzi to do rozwoju zapalnej reakcji ziarniniakowej [2]. Wysoki odsetek limfocytów jest związany nie tylko z nadmiernym ich napływem do pęcherzyków płucnych, ale także z zaburzonym
procesem zaprogramowanej śmierci komórki, czyli apoptozy [13]. To
zjawisko ma miejsce nie tylko w AZPP, ale jest istotnym elementem
patogenezy innych chorób śródmiąższowych, takich jak sarkoidoza,
samoistne włóknienie płuc, czy nieswoiste śródmiąższowe zapalenie płuc.
Na uwagę zasługują także komórki NK– natural killers, bowiem w ostrym
przebiegu AZPP komórki NK występują w zwiększonych ilościach
w stosunku do liczby u osób zdrowych [2].
Interesującym wydaje się fakt, że osoby palące mniej są narażone na
rozwój AZPP, być może dlatego, że cechują się niższym stężeniem
przeciwciał klasy IgG, które są skierowane przeciw antygenom. Naukowcy
tłumaczą to występowaniem w dymie tytoniowym substancji mających
supresyjny wpływ na odpowiedź immunologiczną prowadzącą do
wytwarzania interleukiny 1 i TNFα i rozwoju stanu zapalnego [2].
3. Metody badań i wykrywania
Alergiczne zapalenie pęcherzyków płucnych diagnozuje się na podstawie
badania radiologicznego klatki piersiowej, badania czynnościowego,
laboratoryjnego, płukania oskrzelowo-pęcherzykowego oraz badania histologicznego. W niniejszej pracy uwaga zostanie skupiona na metodach dających
informację o obrazie immunologicznym. W celu prawidłowego rozpoznania
choroby w pierwszej kolejności zbierany jest wyczerpujący wywiad. Ważną
informacją wymagającą uwzględnienia jest fakt czy pacjent ma kontakt
z cząstkami pochodzenia organicznego o rozmiarach pozwalających
przemieszczenie do dolnych dróg oddechowych [2].
Badanie radiologiczne klatki piersiowej jest zazwyczaj pierwszym
krokiem w ocenie pacjenta z podejrzeniem AZPP. Podobnie jak w innych
chorobach śródmiąższowych ukazuje niespecyficzne wyniki, szczególnie
135
Anna Łabejszo, Tomasz Wandtke, Maciej Gawroński
w typie ostrym i podostrym [21]. Z uwagi jednak na niedoskonałość
podziału na postać ostrą, podostrą i przewlekłą Ismail proponuje podział na
cztery typy. W postaci podostrej w środkowych i dolnych obszarach płuc
obserwuje się zacienienia guzkowe słabo odgraniczone, a w postaci
przewlekłej ogniska zagęszczeń miąższowych mają charakter nieregularny,
płuca mają zmniejszoną objętość. Znacznie istotniejszą rolę w diagnozowaniu zmian w płucach ma tomografia komputerowa klatki piersiowej
(HRCT). Metoda ta jest znacznie bardziej czuła niż RTG. Dzięki tej
metodzie diagnostycznej można wykryć zmiany odpowiadające poszczególnym obrazom histopatologicznym [9].
Badania laboratoryjnego nie wykonuje się rutynowo z powodu zbyt małej
ilości danych, które pozwalałyby na rozpoznanie AZPP. Jeśli już jest
przeprowadzane to analizie poddawana jest krew, w której po wywołaniu
alergenem odpowiedzi można zaobserwować nowo wykształcone granulocyty
obojętnochłonne, a także zjawisko eozynofilii. Mogą również wystąpić
zwiększone stężenia lizozymu i enzymu przekształcającego angiotensynę
(ACE). Enzym ten jest odpowiedzialny za konwersję angiotensyny I do
angiotensyny II, która wykazuje właściwości powodujące kurczenie naczyń
krwionośnych. Spośród chorych istnieje grupa, u której we krwi można
wykryć przeciwciała skierowane przeciw antygenom wywołującym AZPP
[9,17].Zaobserwować można podwyższone stężenia immunoglobulin IgM
i IgG, czasem także obecność białka C-reaktywnego, czynnika reumatoidalnego (RF) [15]. Jednak nie upoważnia to do rozpoznania choroby
[4,9,18]. Bardziej pomocnym, ale niewyrokującym okazuje się być płukanie
oskrzelowo pęcherzykowe (bronchoalveolarlavage, BAL), dzięki któremu
można uzyskać obraz różnych populacji komórkowych. Kilka godzin od
pobrania materiału BAL po ekspozycji na alergen zwiększa się ilość populacji
granulocytów obojętnochłonnych, potem ten poziom się obniża. Jednak
w ciągu następnych godzin wzrasta frakcja limfocytów i utrzymuje się nawet
kilka lat przy braku ponownego kontaktu z alergenem. W większości badań
obserwowana jest limfocytoza na poziomie powyżej 50% ogólnej liczby
komórek w płynie z BAL. W populacji limfocytów przeważają Tc, czyli
limfocyty cytotoksyczne CD8+ (stosunek limfocytów CD4/CD8 w większości
przypadków wynosi poniżej 1) [2]. Można również w niektórych przypadkach
dostrzec zwiększony odsetek komórek plazmatycznych, tucznych i eozynofilii
[4]. Badanie histologiczne dostarcza nam więcej informacji. W fazie ostrej
alergicznego zapalenia pęcherzyków płucnych, już w niewielkim czasie po
ekspozycji na alergen stwierdza się obecność nacieków neutrofilów
i eozynofilóww oskrzelikach, pęcherzykach płucnych i wokół naczyń
krwionośnych. W miarę upływu czasu uwidaczniają się nie tylko nacieki
zapalne, ale formują się też ziarniniaki. Jeśli ekspozycja na alergen nie jest
kontynuowana ziarniniaki mogą ulec wchłonieniu, ale naciek z komórek
zapalnych pozostaje [4].
136
Alergiczne zapalenie pęcherzyków płucnych – immunopatogeneza i leczenie
4. Leczenie
Do działań profilaktycznych przede wszystkim zalicza się unikanie
ekspozycji na alergeny wywołujące chorobę poprzez zmianę środowiska.
Jeśli nie jest to możliwe, to w miarę możliwości wymagane jest stosowanie
masek ochronnych, filtrów, odzieży ochronnej, czy też opracowanie
technologii mających na celu zapobieganie wilgoceniu siana i rozwojowi
grzybów [9]. Z reguły przy ostrym przebiegu HP to wystarczy by objawy
choroby uległy cofnięciu. W celu przyspieszenia reemisji choroby stosuje
się leczenie glikokortykosteroidami (GCS) w dawce 0,5 mg//kg m.c. do
czasu ustąpienia objawów spowodowanych ekspozycją na antygen.
A następnie w okresie około 6 tygodni odstawia się leki.Kortykoterapia
może być wskazana w przypadku pacjentów z typem podostrym
postępującym i przewlekłym jednak nie wydaje się by miała wpływ na
długotrwały wynik [21]. Aby zapobiec dalszemu włóknieniu stosuje się
próby leczenia skojarzonego- GCS z lekami immunosupresyjnymi, np.
zazatiopryną wykazującą działanie cytotoksyczne [4, 16]. W jednym
z badań przeprowadzonych na myszach naukowcy próbowali zneutralizować interleukinę (IL-17), która jak wiadomo, wzmaga proces zapalny,
stosując poliklonalne przeciwciała skierowane przeciw IL-17. Dzięki
zmniejszeniu aktywności tej cytokiny HP miało łagodniejszy przebieg.
Dane te podkreślają istotną rolę IL-17 w czasie progresji choroby.
Potrzebne są jednak dalsze badania [14].
5. Podsumowanie
Alergiczne zapalenie pęcherzyków płucnych jest chorobą spowodowaną
przez reakcję immunologiczną na antygeny środowiskowe, którymi mogą
być, np. pyły, zanieczyszczenia środowiska, grzyby, bakterie. Ze względu
na rodzaj antygenu wyróżniamy wiele odmian tej choroby. Objawami
charakterystycznymi są m.in. duszność, kaszel, gorączka. Patogeneza
choroby wiąże się z III i IV typem reakcji immunologicznej, w których
istotną rolę odgrywają przeciwciała klasy IgG i IgM. Przeciwciała tworzą
z antygenem kompleksy immunologiczne, które uruchamiają kaskadę
zdarzeń prowadzącą do rozwinięcia stanu zapalnego, a następnie procesu
włóknienia. Jednoznaczna przyczyna, dlaczego alergeny będące w środowisku wzmagają odpowiedź immunologiczną nie jest znana. AZPP
diagnozuje się na podstawie badania radiologicznego, tomografii
komputerowej klatki piersiowej, adodatkowych cennych informacji
dostarcza badanie histopatologiczne i BAL. Charakterystyczna jest limfocytoza na poziomie powyżej 50% ogólnej liczby komórek odzyskanych
z BAL. W populacji limfocytów przeważa frakcja tych o charakterze
cytotoksycznym. Brak obecnie standardu w postępowaniu leczniczym
137
Anna Łabejszo, Tomasz Wandtke, Maciej Gawroński
AZPP. Stosuje się terapię glikokortykosteroidami, lecz u niektórych osób
schorzenie przechodzi w fazę przewlekłą z włóknieniem, w którym
leczenie jest często nieskutecznei zmniejszenie objawów klinicznych
jest krótkotrwałe. Podejmowane są próby leczeniaskojarzonego – GCS
z lekami immunosupresyjnymi, np. z azatiopryną. Przy tak wąskim
zakresie stosowanych terapii wydaje się być koniecznym poznawanie
i rozważanie zagadnień związanych z mechanizmami immunologicznymi
i podłożem genetycznym choroby w celu opracowania lepszych metod
leczenia skierowanych na przeciwdziałanie przyczynom, a nie tylko
niwelowaniu objawów.
Literatura
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
Bourke S. J., Dalphin J. C., Boyd G., Hypersensitivity pneumonitis: current
concepts, European Respiratory Journal, 18, (2001), s. 81-92
Wiatr E., Rowińska-Zakrzewska E., Pirożyński M., Choroby śródmiąższowe
płuc, α-medicapress, (2012), s. 124-133
Selman M., Hypersensitivity pneumonitis, Interstitial lung diseases, (2003),
s. 452-484
Diego C. P., Cullinan P., Extrinsic allergic alveolitis. European Respiratory
Monograph, 46 (2009), s. 112-125
Monakare S., Haahtela T., Farmer‘s lung – a 5 yr. follow-up of eighty-six
patients, Clinical & Experimental Allergy,17 (1987), s. 143-51
Gołąb J., Jakóbisiak M., Lasek W.,Stokłosa T., Imunnologia, Wydawnictwo
Naukowe PWN, (2013), s. 129-137
Rose C., Lara A., Hypersensitivity pneumonitis, Murray&Nadel’s Textbook
of Respiratory Medicine, (2010), s. 1587-1601
Rowińska-Zakrzewska E., Bestry I., Alergiczne zapalenie pęcherzyków
płucnych, Choroby Wewnętrzne, (2005), s. 580-583.
Lewandowska K., Alergiczne zapalenie pęcherzyków płucnych, Postępy Nauk
Medycznych, 4 (2011), s. 274-285
Woda B. A., Hypersensitivity pneumonitis an immunopathology review,
Archives of Pathology & Laboratory Medicine, 132 (2008), s. 204-205
Mcsharry C., Anderson K., Bourke S. J., Boyd G., Takes your breath away
– the immunology of allergic alveolitis,Clinical & Experimental Immunology,
128 (2002), s. 3-9
Lacasse Y., Assayag E., Cormier Y., Myths and controversies in
hypersensitivity pneumonitis, Seminars in Respiratory and Critical Care
Medicine, 29 (2008), s. 631-642
Girard M., Lacasse Y., Cormier Y., Hypersensitivity pneumonitis, Allergy,
64(2009), s. 322-334
Amrita D. J., Daniel J. F., Sameer R. O., Glenda T., Kevin R. F., Fernando J.
M., Cory M. H.,: Interleukin-17–mediated Immunopathogenesis in
Experimental Hypersensitivity Pneumonitis, American Journal Of Respiratory
And Critical Care Medicine, 179 (2009) s. 705-716
138
Alergiczne zapalenie pęcherzyków płucnych – immunopatogeneza i leczenie
15. Selman M., Mejia M., Pardo A., Hypersensitivity pneumonitis, Intersitial
pulmonary and bronchiolar disorders, (2008), s. 267-288
16. Navarro C., Meja M., Gaxiola M., Mendoza F., Carrillo G., Selman M.,
Hypersensitivity pneumonitis, Treatments in Respiratory Medicine, 5 (2006),
s. 167-179
17. Richerson H. B., Bernstein I. L., Fink J. N. et al., Guidlines for the clinical
evaluation of hypersensitivity pneumonitis: report of the Subcomittee on
Hypersensitivity Pneumonitis, The Journal Of Allergy And Clinical
Immunology, 84 (1989), s. 839-844
18. Ismail T., Mcsharry C., Boyd G., Extrinsic allergic alveolitis, Respirology,
11 (2006),s. 262-268
19. Kirkhorn S. R., Garry V. F., Agricultural Lung Diseases, Environmental
Health Perspectives, 108 (2000), s. 705-712
20. Hanak V., Golbin J. M., Ryu J. H., Causes and presenting features in 85
consecutive patients with hypersensitivity pneumonitis, Mayo Clinic
proceedings, 82 (2007), s. 812-816
21. Spagnolo P., Rossi G., Cavazza A., Bonifazi M., Paladini I., Bonella F.,
Sverzellati N., Costabel U., Hypersensitivity Pneumonitis: A Comprehensive
Review, J Investig Allergol Clin Immunol., 25(4), 2015, s. 237-250
Alergiczne zapalenie pęcherzyków płucnych- immunopatogeneza
i leczenie
Alergiczne zapalenie pęcherzyków płucnych (HP) to choroba ziarniniakowa miąższu płuc
i oskrzelików, której przyczyną jest reakcja alergiczna na ciągłe lub powtarzane narażenie na
antygeny środowiskowe, którymi mogą być pyły przemysłu rolniczego i spożywczego, białka
bakterii, roślin i zwierząt, grzyby lub też cząstki nieorganiczne, takie jak izocyjaniany. Objawami
towarzyszącymi chorobie są: gorączka, kaszel, duszność, ból głowy, narastająca duszność
wysiłkowa. Wyróżniamy wiele odmian tej choroby, m.in. płuco farmera, płuco kuśnierzy, czy
płuco hodowców ptaków.Proces zapalny zaczyna się od odpowiedzi układu immunologicznego
w postaci reakcji nadwrażliwości typu III (kompleksy immunologiczne), a następnie (z punktu
widzenia całej patogenezy) ważniejszego etapu, czyli reakcji typu IV (reakcja komórkowa typu
późnego). Jeśli proces ten nie zostanie zahamowany z czasem postępuje włóknienie. Przy
stawianiu diagnozy bierze się pod uwagę wynik badania histologicznego, radiologicznego klatki
piersiowej, badania czynnościowego, laboratoryjnego, płukania oskrzelowo-pęcherzykowego.
Podwyższone stężenie przeciwciał klasy IgG i IgM, limfocytoza z przeważającą ilością
limfocytów cytotoksycznych to charakterystyczne cechy AZPP. Obserwuje się też obecność
ziarniniaków oraz cechy zapalenia oskrzelików i śródmiąższowego włóknienia. W płynie
z płukania oskrzelowo-pęcherzykowego przeważają limfocyty, które mogą stanowić nawet około
70% składu komórkowego płynu. Najskuteczniejszym działaniem jakie można podjąć by
zapobiegać rozwojowi choroby to zaprzestanie ekspozycji na antygen powodujący reakcję
alergiczną. W ciężkich i przewlekłych przypadkach stosuje się terapię kortykosteroidową,
leczenie skojarzone- GCS z lekami immunosupresyjnymi. Naukowcy próbują opracowywać
coraz to nowe metody leczenia, czego przykładem są badania nad interleukiną 17.
139
Anna Łabejszo, Tomasz Wandtke, Maciej Gawroński
Hypersensitivity pneumonitis- immunopathogenesis and treatment
Hypersensitivity pneumonitis (HP) is an inflammatory disease of the lung parenchyma and
bronchioles, caused by continuous, repeated exposure to environmental antigens, such asdusts
ofagricultural industry and nutritional industry, bacterial proteins, plants and animals, fungi or
inorganic particles, such as isocyanates. The symptoms associated with the disease include fever,
cough, shortness of breath, headache, progressive dyspnoea.There are several variations of this
disease, including farmer's lung, furriers’ lung, or bird breeders’ lung. Theinflammatory process
begins with the type IIIimmune response (creation of immune complexes), and subsequently by
the type IV reaction (delayed cell response), which is more important step from the point of view
of the whole pathogenesis. If this process is not stopped, in time the fibrosis will progress. The
diagnosis takes into account the results of histologic examination, chest X-ray, functional testing,
laboratory testing, bronchoalveolar lavage, but the most important is HRCT of lung.
Characteristics of HP are: increased concentration of IgG and IgM, lymphocytosis with prevalent
amount of cytotoxic lymphocytes. The presence of granulomas and features of bronchiolitis and
interstitial fibrosis is also observed. In bronchoalveolar lavage fluid prevalent lymphocytes are
observed, they may constitute up about 70% of the cellular composition of this fluid.The most
effective action that patients can uptake to prevent development of the disease is eradicate
exposure to the antigen, which cause an allergic reaction. In severe or chronic cases corticosteroid
therapy, or combinated therapy with GCS andimmunosuppressants is necessary. Scientists are
trying to develop new, more effective methods of treatment, for example by studying role of
interleukin 17 in inflammation processes.
140
Adrian Dubicki1
Metody leczenia deformacji czaszki u dzieci.
Rodzaje kasków korekcyjnych
oraz metody ich wykonywania
1. Wstęp
Przed wiekami odmienność w budowie ciała, a szczególnie w kształcie
głowy, była wyznacznikiem statusu społecznego, cechą rozpoznawczą danej
kultury lub talizmanem. Z tego powodu czaszka była często poddawana
celowym deformacjom. Większość współczesnego społeczeństwa unika
takiego wyróżniania się i dąży do idealnego wyglądu. Dlatego gdy dojdzie do
zniekształcenia czaszki u dziecka, rodzice ze względów zdrowotnych, jak
i estetycznych coraz częściej decydują się na leczenie.
Połączenie wiedzy medycznej z techniczną pozwala na szybkie i dokładne
postawienie diagnozy oraz rozpoczęcie leczenia prowadzącego do
przywrócenia prawidłowego kształtu czaszki dziecka. Czas w przypadku tego
schorzenia ma zasadniczy wpływ. Zbyt późne stwierdzenie deformacji może
ograniczyć możliwość wykorzystania nieinwazyjnych, nieoperacyjnych metod
korekcji, a nawet doprowadzić do uszkodzeń neurologicznych wywołanych
zwiększonym ciśnieniem śródczaszkowym.
Współczesna medycyna wypracowała metody korekcji deformacji – od
inwazyjnych operacji chirurgicznych do nieinwazyjnych ortez, zwanych
kaskami korekcyjnymi, które szczegółowo opisano w niniejszej pracy. Wzrost
zainteresowania leczeniem schorzeń czaszki stanowi inspirację do tworzenia
nowych metod terapii.
2. Cel pracy
Zamysłem niniejszej pracy jest usystematyzowanie wiedzy z zakresu
metod leczenia deformacji czaszki u dzieci. W pracy szczególną uwagę
poświęcono kaskom korekcyjnym, które stają się coraz częściej stosowaną
metodą leczenia deformacji ułożeniowych czaszki.
1
[email protected], Katedra Inżynierii Materiałowej i Biomedycznej, Wydział
Mechaniczny, Politechnika Białostocka, www.pb.edu.pl
141
Adrian Dubicki
3. Rodzaje deformacji
Powstanie deformacji związane jest z zaburzeniami wzrostu płaskich kości
czaszki. Rozwijające się mózgowie powoduje wzrost ciśnienia
śródczaszkowego co sprawia, że łączące poszczególne kości czaszki szwy
ulegają rozciągnięciu. Gdy możliwość swobodnego wzrostu kości we
wszystkich kierunkach jest zaburzona, dochodzi do powstania deformacji [1].
Gdy przyczyną deformacji jest przedwczesne zamknięcie czy zrośnięcie się
pojedynczego lub kilku szwów czaszkowych, mamy do czynienia
z kraniosynostozą. Takie schorzenie występuje u jednego na 2500 żywo
urodzonych dzieci. W zależności od tego który szew uległ przedwczesnemu
zrośnięciu, głowa przybiera konkretny kształt. Nazwy rodzajów
kraniosynostoz tworzone są na podstawie wyglądu czaszki. Możemy więc
wyróżnić łódkogłowie, krótkogłowie, trójkątnogłowie i skośnogłowie.
Leczenie tego rodzaju deformacji wymaga najczęściej interwencji
chirurgicznej [2].
Przyczyną deformacji może być również długotrwały zewnętrzny ucisk na
daną okolicę czaszki. Ciągle rosnące, miękkie kości ulegają zniekształceniu,
gdyż uniemożliwiony jest rozwój mózgowia w danym, uciskanym kierunku.
Tutaj wyróżniamy deformacje ułożeniowe takie jak łódkogłowie, krótkogłowie
oraz skośnogłowie. W większości wypadków nie zagrażają one powikłaniom
neurologicznym ani rozwojowym u dziecka. Wiążą się głównie z aspektem
estetycznym [1, 3].
4. Metody leczenia
Leczenie deformacji czaszki w każdym przypadku wymaga
indywidualnego podejścia. Pierwszym i niezbędnym krokiem jest dokładna
diagnoza wskazująca przyczynę powstania deformacji oraz jej zaawansowanie.
Pozwala ona obrać odpowiednią ścieżkę leczenia lub jego zaniechanie.
Podstawową metodą w przypadku stwierdzenia kraniosynostoz jest zabieg
chirurgiczny. Głównym jego celem jest rozcięcie skostniałych szwów.
Tradycyjne operacje wiążą się z dużym ryzykiem i obecnie stosowane są
w ciężkich przypadkach kraniosynostozy. Gdy zrośnięciu uległ pojedynczy
szew, możliwe jest wykonanie zabiegu przy użyciu endoskopu. Głównym
celem jest zmniejszenie ciśnienia śródczaszkowego oraz dodatkowo poprawa
estetyki kształtu głowy [4, 5].
Gdy przyczyna deformacji nie wynika z synostozy szwów ważny jest
poziom zaawansowania deformacji. Gdy zniekształcenie jest lekkie, lekarze
zalecają metodę odpowiedniego pozycjonowania dziecka. Pomaga ona
w korekcji małych deformacji, ale jej skuteczność objawia się głównie wtedy
gdy stosowana jest do zapobiegania powstaniu zniekształceń głowy.
W bardziej zaawansowanych przypadkach stosuje się zaopatrzenie orto-
142
Metody leczenia deformacji czaszki u dzieci.
Rodzaje kasków korekcyjnych oraz metody ich wykonywania
pedyczne. Specjalnie dopasowane kaski lub opaski pomagają w korygowaniu kształtu głowy nawet już u raczkujących czy zaczynających chodzić
dzieci. Wywoływane przez nie naciski w miejscach zniekształcenia
uniemożliwiają dalsze ich postępowanie i stopniową poprawę geometrii
czaszki [6].
Wzrost liczby przypadków takich deformacji powoduje powstawanie
coraz to nowych metod leczenia. Stosowane są specjalne poduszki
odpowiednio układające głowę dziecka. Jedną z metod jest też powstała
w USA chiropraktyka. Nie zdobyła ona jednak uznania wśród lekarzy.
Nową, będącą w fazie testów klinicznych terapią jest leczenie farmakologiczne. Gdy istnieje ryzyko genetycznych kraniosynostoz, to (aby im
zapobiec) ciężarnej kobiecie podawany jest lek. Hamuje on aktywność
zaangażowanego w rozwój zrostów szwów enzymu ERK, który regulowany jest przez zmutowane geny FGF. Przed takim leczeniem należy
jednak wykonać szereg skomplikowanych badań genetycznych aby
sprawdzić mutacje tych genów. Niestety takie leczenie jest zapobiegawcze
i musi rozpocząć się jeszcze w życiu płodowym [7].
4.1. Zabiegi chirurgiczne
Interwencja chirurgiczna najczęściej stosowana jest w przypadku
deformacji wywołanej kraniosynostozą. W zależności od ilości zrośniętych
szwów, zabieg może być wykonany inwazyjnie lub mało inwazyjnie przy
użyciu endoskopu. Głównym celem tego zabiegu jest zmniejszenie
ciśnienia wewnątrzczaszkowego oraz poprawa efektu estetycznego. Zabiegi
powinny być wykonywane jak najwcześniej, najlepiej do ukończenia 1
roku życia. Kości dziecka są wtedy miękkie i nie doprowadza się do
powikłań neurologicznych. Ich późniejsze przeprowadzenie prawdopodobnie uniemożliwia zastosowanie endoskopu [8].
4.1.1. Operacje klasyczne
Kiedyś podstawowym (dziś stosowanym tylko w skomplikowanych
przypadkach deformacji czaszki) rodzajem zabiegu była operacja
klasyczna. Polega ona na wycięciu kostnych pasków wraz ze zrośniętymi
szwami i dopasowaniu sąsiadujących kości w czaszce. Jest zabiegiem
poważnym, wiążącym się z dużym ryzykiem poprzez podanie znieczulenia
oraz dużą utratę krwi. Pomimo tego częstotliwość komplikacji utrzymuje
się na poziomie ok. 2%, co czyni ten rodzaj leczenia bezpiecznym. Ma to
związek ze stosowaniem coraz to nowocześniejszych technik wspomagających planowanie operacji [9, 10].
Często stosowana jest przez chirurgów metoda „π”. Polega ona na
rozcięciu zrośniętego, poprzecznego szwu oraz przecięciu kości po obu
143
Adrian Dubicki
stronach podłużnego szwu (rys. 1). Rozcięcia czaszki kształtem przypominają gracką literę π, która stała się nazwą tej metody. Powstały jej liczne
modyfikacje, zależne od rodzaju deformacji [10].
Rysunek 1. Model głowy z łódkogłowiem przed zabiegiem (po lewej) i po wykonaniu nacięć π [10]
Inną metodą w bardziej zaawansowanych przypadkach jest podzielenie
czaszki półksiężycowatymi nacięciami na segmenty. Są one odpowiednio
docinane, dopasowywane i (jeżeli zachodzi taka potrzeba) zamieniane
między sobą (rys. 2), tak aby uzyskać jak najlepszy efekt zabiegu [10].
Rysunek 2. Schemat korekcji metodą całkowitej rekonstrukcji – segmentacja łódkogłowia [10]
144
Metody leczenia deformacji czaszki u dzieci.
Rodzaje kasków korekcyjnych oraz metody ich wykonywania
W przypadku zrostu większości szwów czaszka może zostać ponacinana
aby umożliwić jej rozrost (rys. 3). W tym przypadku coraz częściej
używane jest oprogramowanie komputerowe pomagające uzyskać modele
bryłowe i numeryczne umożliwiające przeprowadzenie analiz i otrzymanie
wizualizacji efektów leczenia [9].
Rysunek 3. Nacięcia czaszki podczas klasycznej operacji [9]
Po takich zabiegach często w celu ochrony czaszki stosuje się specjalne
kaski. Zostały one opisane w rozdziale 4.2.1.
4.1.2. Zabiegi endoskopowe
Przeprowadzenie zabiegu przy użyciu endoskopu najczęściej stosowane
jest u dzieci do 6 miesiąca życia, u których występują izolowane
kraniosynostozy (skostnienia jednego szwu). Wprowadzany podskórnie
endoskop z odpowiednią końcówką rozcina skostniałe szwy umożliwiając
normalny wzrost czaszki. Po ich rozcięciu (w zależności od przypadku),
kości mogą zostać od siebie oddalone za pomocą specjalnych płytek (rys.
4A). Po takim zabiegu zaleca się stosowanie specjalnych kasków
modelujących czaszkę, aby podczas wzrostu przybrała ona prawidłową
geometrię [11].
145
Adrian Dubicki
Rysunek 4. Zabiegi endoskopowe: A – metoda rozcięcia szwów, B – metoda nacięcia czaszki
[11]
Inną techniką stosowaną przy operacjach endoskopowych jest nacięcie
czaszki w takich miejscach, aby podczas wzrostu kości czaszki naturalnie
przybierały odpowiedni kształt (rys. 4B). W tym przypadku wzrost czaszki
odbywa się podobnie jak u zdrowego dziecka i nie jest potrzebne
stosowanie ortez modelujących [11].
Zabieg endoskopowy jest bardziej korzystny od klasycznej operacji. Jest
to zabieg mało inwazyjny, dzięki czemu zmniejsza się ryzyko powikłań.
Poprzez zmniejszenie miejsca cięcia poprawia się również efekt
kosmetyczny. Dodatkowo jego wykonanie jest możliwe w pierwszych
miesiącach życia, dzięki czemu unika się zwiększenia ciśnienia
śródczaszkowego i powikłań neurologicznych oraz uzyskuje lepszą
korekcję czaszki [8].
Rysunek 5. Zabieg usunięcia synostozy szwów przy użyciu endoskopu [12]
Współcześnie operacje przy użyciu endoskopu cieszą się coraz większą
popularnością, co skutkuje szybkim rozwojem tej techniki, zarówno
poprzez nowe pola wykorzystania w leczeniu, jak i w coraz nowocześniejszych modelach endoskopów pojawiających się na rynku.
146
Metody leczenia deformacji czaszki u dzieci.
Rodzaje kasków korekcyjnych oraz metody ich wykonywania
4.2. Aparaty stosowane w leczeniu
Zabiegi operacyjne nie są jedyną metodą korekcji deformacji. Coraz
większą popularnością zarówno wśród pacjentów, jak i lekarzy cieszą się
różnego rodzaju aparaty m.in. ortezy czy wyciągi kostne. Są one mało lub
nieinwazyjne, a tym samym bezpieczniejsze od operacji, które stosowane
są tylko w bardzo zaawansowanych przypadkach, głównie przy kraniosynostozach.
W niektórych przypadkach, po operacji rozcięcia szwów czy też
modelowania kości czaszki, aby zabezpieczyć głowę i zachować
odpowiednie efekty operacji lub wymodelować odpowiedni kształt czaszki
stosuje się specjalne kaski ochronno-modelujące [5].
Innym rodzajem aparatów są kaski korekcyjne. Stosowane głównie przy
deformacjach ułożeniowych, pozwalają na bezpieczną korekcję powstałych
zniekształceń i uzyskanie odpowiedniej geometrii główki dziecka. Ważne
jest odpowiednio szybkie zastosowanie tej terapii, aby odbyła się ona
w trakcie okresu wzmożonego rozwoju mózgowia [3, 13].
W przypadku leczenia twarzoczaszki stosowane są głównie wyciągi
twarzowo-czaszkowe. Ich zastosowanie poprzedzone jest rozcięciem kości
w miejscach które mają być wydłużone, co pobudza je do zrostu. Następnie
w obu częściach rozciętej kości umieszczane są specjalne płytki połączone
cylindrem dystrakcyjnym. Poprzez powolne zwiększanie odległości (o ok.
1 mm dziennie) za pomocą cylindra, rozciągnięciu ulega pierwotna
kostnina powstająca w miejscu przecięcia oraz okoliczne tkanki – nerwy,
naczynia krwionośne, skóra i mięśnie. Proces ten nosi nazwę osteogenezy
dystrakcyjnej. Metoda ta umożliwia dosyć szybkie oraz zgodne z zamierzeniem wydłużenie kości [14].
4.2.1. Kaski ochronno-modelujące [5, 15]
Po operacyjnym leczeniu deformacji czaszki, rozcięciu lub wycięciu
szwów często niezbędne jest zastosowanie kasków. Jak sama nazwa
wskazuje pełnią one rolę ochronną oraz modelują odpowiedni kształt
czaszki.
Kask ochronno-modelujący jest elementem leczenia kraniosynostoz za
pomocą zabiegu operacyjnego. Po jego wykonaniu lekarz może zlecić
zamówienie uniwersalnego lub przygotowanie indywidualnie dopasowanego kasku. Wybór zależy głównie od rodzaju zabiegu chirurgicznego,
jego efektów oraz stopnia deformacji. Jeśli podczas operacji dokonano
wycięcia kliku szwów i rekonstrukcji czaszki, zalecane jest zazwyczaj
wykonanie indywidualnie dopasowanego kasku, ponieważ musi być on
używany przez dziecko nawet przez 12 miesięcy. W przypadku rozcięcia
pojedynczego szwu, dokonywanego głównie podczas zabiegu przy użyciu
147
Adrian Dubicki
endoskopu, ingerencja w kości czaszki nie jest zbyt wielka, więc może być
zastosowany kask uniwersalny. Posiada on specjalne peloty które
umieszcza się w odpowiednich, wskazanych przez lekarza miejscach tak
aby dopasować kask do głowy dziecka i aby spełniał on swoje funkcje.
Rysunek 6. Uniwersalny kask ochronno-modelujący z pelotami używany również do ochrony
głowy przy atakach epilepsji [16]
Zaopatrzenie dziecka w taki kask możliwe jest po 7-14 dniach od
operacji. Wówczas zmniejszeniu ulegają obrzęki pooperacyjne i możliwe
staje się odpowiednie dopasowanie uniwersalnego kasku lub określenie
wymiarów potrzebnych do wykonania indywidualnie dopasowanego.
Kaski wykonywane są zazwyczaj z termoplastycznych materiałów
– polipropylenu lub poliwęglanu, w uniwersalnych rozmiarach lub na
podstawie pobranych miar od konkretnego pacjenta. Mogą być one
przezroczyste lub specjalnie zabarwiane i z nadrukami aby uatrakcyjnić ich
stosowanie z myślą o dzieciach.
Budowa kasków jest różna i zależy zarówno od zapotrzebowania
pacjenta, jak i od firmy go wykonującej. Najczęściej spotykane są kaski
jednolite, składające się z jednej, ciągłej warstwy materiału, z otworami
wentylacyjnymi oraz czasami z nacięciem umożliwiającym nakładanie
kasku (rys. 6). Gdy kask posiada rozcięcie, niezbędne jest dodanie
elementu łączącego obie krawędzie, którym najczęściej jest rzep. Niekiedy
takie kaski posiadają dodatkowo materiałowy pasek na podbródek
pomagający utrzymać się ortezie w odpowiednim położeniu. Innym
rodzajem jest kask składający się z dwóch części materiału (rys. 7). Jedna
część nakładana jest na głowę dziecka (najczęściej na jej tylną
powierzchnię), a druga na przeciwną stronę, dodatkowo zachodząc
wypustkami na pierwszą. Taki typ kasku również wyposażany jest w rzep
148
Metody leczenia deformacji czaszki u dzieci.
Rodzaje kasków korekcyjnych oraz metody ich wykonywania
utrzymujący go w odpowiednim miejscu. Jego zakładanie jest jednak
łatwiejsze niż kasku z rozcięciem.
Rysunek 7. Kask ochronno-modelujący wykonany dla konkretnego pacjenta [5]
Noszenie takiego kasku wiąże się z utrudnieniem wymiany ciepła głowy
z otoczeniem i ze wzrostem temperatury. W tym celu kaski mają specjalne
otwory wentylacyjne, umieszczane w miejscach, w których nie występuje
zbyt duży kontakt z powierzchnią głowy. W przypadku dosyć luźnych
kasków uniwersalnych takie rozwiązanie jest wystarczające, lecz przy
dopasowanych kaskach należy obserwować dziecko czy nie występują
u niego objawy przegrzania.
4.2.2. Kaski korekcyjne
Coraz większą popularnością w leczeniu ułożeniowej deformacji
czaszki, cieszy się terapia kaskami korekcyjnymi. Chociaż powstała
w drugiej połowie XX wieku, dopiero obecnie zyskuje coraz większe grono
zwolenników zarówno wśród lekarzy, jak i pacjentów. Prawdopodobnie
jest to związane z satysfakcjonującymi wynikami w leczeniu dzieci
uzyskanymi w czasie akcji przeciwko SIDS oraz z obecnym dążeniem
ludzi do idealnego wyglądu [17, 18].
Terapia kaskiem korekcyjnym wykorzystuje naturalny wzrost głowy
dziecka. Wewnętrzna powierzchnia kasku jest odpowiednio konstruowana
na podstawie kształtu głowy, dlatego muszą one być wykonywane
indywidualnie. Głównym celem kasku jest zablokowanie możliwości
149
Adrian Dubicki
wzrostu czaszki w miejscach prawidłowo rozwiniętych. W tych miejscach
orteza styka się z powierzchnią głowy uniemożliwiając ich dalszy wzrost
i pogłębianie się deformacji. Przeciwnie dzieje się w miejscach gdzie
występuje zniekształcenie. Są one celowo odbarczone poprzez pozostawienie wolnej przestrzeni, dzięki czemu umożliwiony jest dalszy wzrost
czaszki w tych rejonach i zmniejszanie się spłaszczenia [17, 19].
Ze względu na wykorzystanie w tej metodzie wzrostu czaszki,
niemożliwe jest korzystanie z niej gdy takowego wzrostu nie ma. Z tego
powodu terapia kaskowa ma ograniczenia związane z wiekiem dziecka.
Wzrost czaszki jest dość intensywny do ukończenia 1 roku życia. Jest to
najbardziej odpowiedni czas na rozpoczęcie i ukończenie terapii. Jej rozpoczęcie zalecane jest po wyczerpaniu innych metod np. pozycjonowania czy
metod fizjoterapeutycznych, przeważnie już po ukończeniu 4-5 miesiąca
życia. Im wcześniej rozpocznie się korekcja czaszki tym szybszy będzie
w jej trakcie wzrost, a więc i krócej potrwa leczenie [17, 19]. Szacunkowy
czas terapii przedstawiony został w tabeli poniżej.
Tabela 1. Szacunkowy czas trwania terapii w zależności od wieku jej rozpoczęcia [17]
Wiek dziecka gdy rozpoczęto terapię
Długość leczenia
3-5 miesięcy
2-4 miesięcy
5-7 miesięcy
3-5 miesięcy
7-9 miesięcy
4-7 miesięcy
10 miesięcy
6-9 miesięcy
Im później rozpoczyna się terapię tym dłużej trwa leczenie. Późne
rozpoczęcie leczenia może powodować również nieuzyskanie pełnej
korekcji. Za ostateczny czas kiedy terapia może się rozpocząć uważa się
1,5 roku życia. Po tym czasie efekty leczenia są mało zauważalne,
a leczenie trwa bardzo długo [18].
Przeciwskazaniem do zastosowania terapii kaskowej może być
kraniosynostoza. Z tego powodu na pierwszej wizycie dziecko powinno
być poddane dokładnej diagnozie z określeniem przyczyny powstania
deformacji. Również wodogłowie czy nieprawidłowości w rozwoju mózgu
i wzrost ciśnienia śródczaszkowego uniemożliwiają wdrożenie terapii
kaskowej. Dzieci powyżej 18 roku życia również nie powinny być
poddawane leczeniu tą metodą. Ma to związek z jej małą skutecznością,
gdyż w tym wieku głowa nie rośnie już wystarczająco szybko oraz często
do tego czasu zrośnięciu ulegają już szwy czaszkowe [20].
150
Metody leczenia deformacji czaszki u dzieci.
Rodzaje kasków korekcyjnych oraz metody ich wykonywania
Na początku terapii, w jej pierwszych dniach należy zwracać szczególną
uwagę na podrażnienia skóry oraz w szczególnych przypadkach na
przegrzanie. Co 4 godziny należy zdejmować kask i sprawdzać czy na
skórze nie występują otarcia i zaczerwienienia. Gdy takie wystąpią, należy
odczekać 30 minut i jeżeli po tym czasie nie ustąpią oznacza to
konieczność wykonania poprawek kasku. W takiej sytuacji należy
skontaktować się z lekarzem prowadzącym lub protetykiem w celu
naniesienia korekty. Jeżeli podrażnienia nie będą występować przez kolejne
trzy dni, kontrole należy przeprowadzać co 12 godzin. Nie zwalnia to
jednak z wizyt kontrolnych, które w zależności od wieku dziecka,
zaawansowania terapii oraz deformacji powinny odbywać się co 2 do 6
tygodni [20].
W trakcie terapii ważne jest utrzymanie odpowiedniej czystości kasku.
Dziecko powinno w nim spędzać 23 godziny na dobę, więc czyszczenie
takiego kasku najlepiej wykonywać w trakcie kąpieli dziecka. Najlepszym
sposobem jest przetarcie wnętrza kasku alkoholem lub jakimś preparatem
antybakteryjnym po czym przemycie go wodą [20].
Prawidłowo prowadzone leczenie deformacji za pomocą kasków nie
powoduje poważnych komplikacji. Głównym problemem jest utrzymanie
kasku w czystości oraz związane z tym występowanie podrażnień
skórnych. Z powodu bezpośredniego stykania się skóry z wyściółką kasku
może powstać kontaktowe zapalenie skóry. Zbyt wysoka temperatura może
wywołać przegrzanie, a dodatkowo występujący pot – wysypkę cieplną czy
potówki. Nieprawidłowe dopasowanie kasku może skutkować powstaniem
otarć lub skaleczeń. Należy w takiej sytuacji skontaktować się z lekarzem
prowadzącym w celu dokonania poprawek. Nieprawidłowo wykonany kask
może powodować nadmierne ciśnienie śródczaszkowe i wywołane nim
powikłania neurologiczne lub pogorszenie geometrii głowy. Takie sytuacje
zdarzają się jednak bardzo rzadko. Aby uniknąć takich problemów
zaopatrzenia się w kask należy dokonywać w renomowanych placówkach
z dużym doświadczeniem [20].
5. Rodzaje kasków korekcyjnych
Wszystkie kaski działają na tej samej zasadzie – ograniczania wzrostu
w prawidłowo ukształtowanych miejscach przy równoczesnym umożliwieniu go w miejscach zdeformowanych. Mimo to istnieją różne wersje
kasków w zależności od firmy je produkującej oraz od rodzaju deformacji.
Najczęściej spotyka się kaski w całości pokrywające powierzchnię głowy
oraz takie z wycięciem na jej górnej powierzchni.
151
Adrian Dubicki
Rysunek 8. Dziecko podczas przymiarki kasku z wyciętą górną częścią [17]
Kaski z wyciętą górną powierzchnią (rys. 8), którą nie poddaje się
korekcji są również często nazywane opaskami korekcyjnymi. Głównym
producentem na terenie Europy jest Cranioform. Obejmują one tylko
miejsce wymagające korekcji. Takie rozwiązanie jest korzystne ze względu
na zmniejszenie ilości potrzebnego materiału, a więc i zmniejszenie ciężaru
kasku oraz kosztów jego wykonania. Inną ważną korzyścią jest zwiększenie
powierzchni niezaburzonej wymiany ciepła z otoczeniem. W przypadku
takiego kasku często nie stosuje się dodatkowych otworów wentylacyjnych. Opaski przeważnie posiadają wycięcia na małżowiny uszne, przez
co nie utrudniają komunikacji z dzieckiem i nie powodują niepotrzebnych
ucisków [17].
Pierwszą firmą, która na terytorium Polski wprowadziła terapię
kaskową było V!GO. Oferuje ona typowe kaski, które w przeciwieństwie
do wcześniej omawianych opasek nie posiadają wycięcia na górnej
powierzchni (rys. 9). Niewprowadzenie takiego rozwiązania tłumaczone
jest ryzykiem wzrostu czaszki w kierunku wycięcia i przybraniem przez nią
stożkowego kształtu. Wymusza to zastosowanie licznych otworów, aby
umożliwić wymianę ciepła. Dodatkowo kask nie posiada wycięć przy
uszach aby ułatwić utrzymanie się go w prawidłowym położeniu. Firma
wprowadziła możliwość wyboru tekstury, aby urozmaicić wygląd kasku
i zachęcić dziecko do korzystania z niego [19].
152
Metody leczenia deformacji czaszki u dzieci.
Rodzaje kasków korekcyjnych oraz metody ich wykonywania
Rysunek 9. Kask korekcyjny obejmujący całą powierzchnię głowy [19]
Niektóre zakłady produkcyjne oferują kaski wykonane z przezroczystych tworzyw. Jedną z nich jest firma KidCap działająca w USA. Ich
zaletą jest możliwość ciągłej obserwacji skóry dziecka i reagowanie
w przypadku powstania uczulenia, wysypki czy otarć (rys. 10). Kask ten
w przeciwieństwie do poprzednio przedstawionych nie posiada na całej
swej powierzchni wyściółki. Jest ona umieszczona tylko przy łącznikach.
Styka się on bezpośrednio swą formującą częścią z głową dziecka.
Dodatkowo wyposażony jest w polimerowe łączniki, które reagują
(rozciągając się) na zmiany kształtu głowy[18].
Rysunek 10. Przezroczyste kaski umożliwiające obserwację skóry głowy [18]
153
Adrian Dubicki
5.1. Budowa oraz materiały używane do produkcji kasków
Budowa kasków jest z reguły podobna. Zewnętrzna, twarda część
wykonana jest z tworzywa sztucznego. Do najczęściej używanych należy
poliwęglan (PC), polipropylen (PP), kopolimer estrowy (PETG) oraz
rzadziej z polietylen, głównie ten o wysokiej gęstości (PE-HD). Ta warstwa
materiału ma za zadanie powstrzymanie dalszego wzrostu czaszki
w wybranych rejonach. Z tego powodu materiał powinien mieć wysoką
sztywność i być odporny na odkształcenia. Dodatkowo, głównie w przypadku bezpośredniego kontaktu ze skórą, powinien być zgodny biologicznie i nie powodować reakcji alergicznych (hipoalergiczny). Ważna jest
również odporność na działanie czynników mechanicznych, termicznych
oraz na wilgotność. Dodatkowo tworzywo powinno w łatwy sposób
odbierać ciepło i wymieniać je z otoczeniem [17, 18, 19].
Wewnętrzna warstwa wykonywana jest najczęściej ze spienionego
kopolimeru etylu i octanu winylu (EVA), spienionego polietylenu (PE)
oraz firmowego tworzywa Aliplast. Wyściółka kasku nie powinna chłonąć
wilgoci – potu, co mogło by powodować rozwój bakterii oraz powstanie
nieprzyjemnego zapachu. Dodatkowo musi być dosyć twarda, nie powinna
zbytnio odkształcać się pod wpływem ścisku, co mogłoby pogarszać
wyniki leczenia. Podobnie jak w przypadku zewnętrznej części, wyściółka
powinna umożliwiać wymianę ciepła. Ważna jest również jej biozgodność
oraz hipoalergiczność. Wewnętrzna część kasku składa się przede
wszystkim z kilku warstw materiału. Umożliwia to odpowiednie
dopasowanie kasku i doszlifowanie w trakcie leczenia wynikające ze
zmieniającego się kształtu głowy oraz jej wzrostu. Ponadto, materiał
wyściółki służy do amortyzacji [17, 18, 19].
Większość kasków posiada rozcięcia umożliwiające nakładanie go na
głowę. Po nałożeniu takiego kasku konieczne jest unieruchomienie takiego
przecięcia, aby unieruchomić kask na właściwym miejscu. Do tego celu
stosowane są najczęściej rzepy. Umożliwiają one każdorazowe dopasowanie kasku do kształtu i rozmiaru głowy. Ważna jest również (w pewnym
stopniu) podatność tego połączenia, w przypadku gdyby głowa została za
mocno ściśnięta [17, 18, 19].
Większość kasków (prócz wcześniej wspomnianych opasek korekcyjnych) posiada dodatkowe otwory. Służą one do polepszenia wentylacji,
wymiany ciepła oraz odprowadzenia wilgoci. Jest to bardzo ważne w celu
uniknięcia przegrzania głowy czy powstania podrażnień i uczuleń skórnych
[18, 19].
154
Metody leczenia deformacji czaszki u dzieci.
Rodzaje kasków korekcyjnych oraz metody ich wykonywania
5.2. Wykonywanie kasków
Proces wykonania kasków nie różni się zbytnio od standardowego
postępowania w przypadku tworzenia lejów protezowych czy ortez.
Pierwszym etapem jest konsultacja z lekarzem, który zdiagnozuje pacjenta
określając przyczyny powstania deformacji, jej zaawansowanie oraz podejmie
decyzję o leczeniu i jego przebiegu. Kolejnym krokiem jest wykonanie modelu
głowy dziecka, który posłuży do dalszego wykonania kasku. W tym przypadku
istnieją dwie metody. Pierwsza bazuje na wykonaniu negatywu i pozytywu
przy użyciu masy gipsowej. Druga wykorzystuje nowe technologie, które
umożliwiają digitalizację powierzchni głowy, obróbkę obrazu i tworzenie jej
modelu za pomocą oprogramowania komputerowego [17, 21]. Obie ścieżki
produkcji przedstawiono w poniższej tabeli.
Tabela 2. Porównanie metod (etapów) produkcji kasków korekcyjnych [17, 21]
Nr.
etapu
Metoda cyfrowa
Nałożenie folii ochronnej na
powierzchnię głowy
1
Nałożenie na powierzchnię
głowy trykotu umożliwiającego
poprawienie dokładności
otrzymanych zdjęć 3D
Nałożenie uprzednio
namoczonych opasek gipsowych
na głowę; oczekiwanie na
utwardzenie gipsu
2
Wykonanie zdjęć 3D i wczytanie
ich do oprogramowania
komputerowego
3
Opracowanie wirtualnego
modelu głowy dziecka
o prawidłowej geometrii,
dodanie naddatków
4
Wykonanie modelu głowy
dziecka przy użyciu frezarki
sterowanej numerycznie
5
Przygotowanie i rozgrzanie
materiału termoplastycznego
6
Formowanie kasku na podstawie
pozytywu przy użyciu pompy
próżniowej
Metoda tradycyjna
Rozcięcie negatywu gipsowego
i zdjęcie z głowy pacjenta
Przygotowanie negatywu:
połączenie rozcięcia, pokrycie
wewnętrznej części negatywu
warstwą umożliwiającą
późniejsze oddzielenie negatywu
i pozytywu
Przygotowanie masy gipsowej
i zalanie nią negatywu,
umocowanie metalowego pręta
Rozcięcie negatywu, wyjęcie
pozytywu
155
Adrian Dubicki
Dodanie naddatków,
ukształtowanie powierzchni
pozytywu, która posłuży do
wykonania kasku
(należy pamiętać o naddatku na
całej powierzchni na wyściółkę
kasku)
7
Usunięcie nadmiaru materiału
i pozytywu z wnętrza kasku
Przygotowanie i rozgrzanie
materiału termoplastycznego
8
Dodanie wyściółki
Formowanie kasku na podstawie
pozytywu przy użyciu pompy
próżniowej
9
Obróbka wykańczająca, dodanie
klamer, rzepów
Usunięcie nadmiaru materiału
i pozytywu z wnętrza kasku
10
Dodanie wyściółki
11
Obróbka wykańczająca, dodanie
klamer, rzepów
12
Metody z wykorzystaniem masy gipsowej coraz częściej wypierane są
przez o wiele szybsze, bardziej ekonomiczne i czystsze metody komputerowe.
Największą ich zaletą jest szybkość zarówno przy pomiarach, jak i wykonaniu
pozytywu. Zrobienie zdjęć może trwać nawet tylko ok. 1,5 ms, co jest bardzo
korzystne mając na względzie żwawość dzieci. Pozwala to również na
skrócenie czasu wizyty, a często również i strachu dziecka [17, 18, 21].
Rysunek 11. Tworzenie negatywu za pomocą opasek gipsowych [22]
156
Metody leczenia deformacji czaszki u dzieci.
Rodzaje kasków korekcyjnych oraz metody ich wykonywania
W obu metodach wykorzystywane są materiały termoplastyczne.
Zrezygnowano w nich z użycia laminatów. Prawdopodobnie ma to związek
z dużą ilością laminatu jaka potrzebna by była do wytworzenia takiego kasku,
trudnością w jego równomiernym rozprowadzeniu, więc i w zachowaniu
równomiernej siły nacisku na czaszkę. Kask wykonany z żywic musiałby
utwardzać się przez kilka godzin, podczas których wydzielane by było ciepło.
Rysunek 12. Komputerowy model głowy dziecka [17]
Po uformowaniu tworzywa termoplastycznego według pozytywu
dokonuje się jego obróbki. Usuwane są niepotrzebne fragmenty tworzywa,
wykonywane nacięcia umożliwiające nakładanie ortezy, nadawany jest
odpowiedni kształt krawędziom oraz ma miejsce ich zaokrąglanie. W
większości przypadków dodaje się wyściółkę. Ważnym elementem jest
również wykonanie otworów wentylacyjnych w odpowiednich miejscach
oraz klamr i rzepów mocujących [17, 21, 22].
Rysunek 13. Pozytyw gipsowy wykonany przy pomocy frezarki CNC [17]
157
Adrian Dubicki
Taki kask trafia do pacjenta w celu przymiarki oraz ewentualnych
poprawek. W pierwszych dniach korzystania z terapii kaskowej należy
zwracać uwagę na ewentualne podrażnienia skórne czy otarcia. Każdy taki
przypadek sugeruje nieodpowiednie dopasowanie kasku i konieczność
doszlifowania wyściółki [20].
6. Podsumowanie
Rozwój i udoskonalanie metod korekcji czaszki napędzane są coraz
większą dbałością o zdrowie i wygląd. Są one również możliwe dzięki
wykorzystaniu przez medycynę rozwijającej się techniki. Połączenie
wiedzy medycznej z techniczną skutkuje uzyskaniem zadowalających
efektów leczenia, przy jednoczesnym zapewnieniu jak największego
komfortu oraz bezpieczeństwa w trakcie terapii.
Indywidualne podejście do pacjenta umożliwia wdrożenie skutecznej
i bezpiecznej terapii. Przyczynia się do tego rozwój diagnostyki
i wykorzystanie metod komputerowych.
Od przyczyny powstania deformacji oraz jej stopnia zależy wybór
odpowiedniej terapii. Wśród zabiegów operacyjnych, popularne staje się
wykorzystanie endoskopii. Deformacje niezaawansowane coraz częściej
korygowane są indywidualnie wykonanymi kaskami. Metody pomiarów
oraz produkcji takich ortez są stale rozwijane.
Rozwój techniki i medycyny będzie skutkował powstaniem coraz
nowszych metod korekcji oraz rozwojem już istniejących.
Literatura
1.
2.
3.
4.
5.
6.
7.
Bochenek A., Reicher M., Anatomia człowieka. Tom I, Warszawa:
Wydawnictwo Lekarskie PZWL, 2009, s. 298-436
Aleck K., Craniosynostosis Syndromes in the Genomic Era. Phoenix: XI
Seminars in Pediatric Neurology, Elsevier, 2004, strony 256-26
Biggs W. S., Diagnosis and management of positional head deformity,
Michigan: American Family Physician, 2003, zeszyt 67, strony:1953-1956
Laskowska-Ziętek A., Misiuk-Hojło M., Przedwczesne zarośnięcie szwów
czaszkowych – aspekty okulisty-czne i stomatologiczne, Wrocław: Dental and
Medical Problems, 2007, zeszyt 44, strony 242-246, ISSN 1644-387X
Kaufman A. B., Muszynski C. A., Matthews A., Etter N., The Circle of
Sagittal Synostosis Surgery, Milwaukee: Elsevier, XI Seminars in Pediatric
Neurology, 2004, strony 243-248
Halberg A., Graham J. M., Gomez M., Earl D. L., Management of
Deformational Plagiocephaly: Repositioning Versus Orthotic Theraphy, Los
Angeles: Elsevier, The Journal of Pediatrics, 2005, strony 258-262
Jak zapobiegać i leczyć przedwczesny zrost kości czaszki [online], PAP – Nauka
w Polsce, www.naukawpolsce.pap.pl/ aktualnosci/ news, 65110, jak-zapobiegaci-leczyc-przedwczesny-zrost-kosci-czaszki.html [dostęp: 24 XII 2013 r.]
158
Metody leczenia deformacji czaszki u dzieci.
Rodzaje kasków korekcyjnych oraz metody ich wykonywania
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
Larysz D., Przedwczesne zarośnięcie szwów czaszkowych – kraniosynostoza
[online],http://www.nzozkangur.pl/artykuly,przedwczesne_zarosniecie_szwow_
czaszkowych_kraniosynostoza.html [dostęp: 24 XII 2013 r.]
Gzik M., Tejszerska D., Wolański W., Gzik-Zroska B., Komputerowe
wspomaganie planowania zabiegu korekcji trigonocefalii u dzieci, Gliwice:
Modelowanie Inżynierskie, 2009, zeszyt 38, strony 51-56, ISSN 1896-771X
Wolański W., Larysz D., Gzik M., Kawlewska E., Komputerowe metody
wspomagania leczenia kraniosynostozy, Gliwice: Modelowanie Inżynierskie,
2011, zeszyt 41, strony 437-444, ISSN 1896-771X
Wolański W., Larysz D., Gzik M., Inżynierskie wspomaganie endoskopowych
zabiegów neurochirurgicznych, Gliwice: Modelowanie Inżynierskie, 2011,
zeszyt 41, strony 429-436, ISSN 1896-771X
Medim – Instrumenty mistrzów, Nowość w ofercie Karl Storz [online],
http://www.medim.pl/aktualnosci. php?nID=109 [dostęp 26 XII 2013r.]
Co to jest "plagiocefalia ułożeniowa"(positional plagiocephaly)? [online],
http://www. mamopedia.pl/10-11-mies/zdrowie/plagiocefalia-ulozeniowa
[dostęp: 15 XII 2013r.]
Kulewicz M., Osteogeneza dystrakcyjna w chirurgii ortognatycznej,
Warszawa: Fundacja Multis Multum, 2001, Acta Clinica, Tom 1, Numer 3,
strony 117-128
Murad G. J. A., Clayman M., Seagle M. B., White S., Perkins L. A., Pincus D.
W.: Endoscopic-assisted repair of craniosynostosi, Gainesville: Neurosurgical
Focus, 2005, Tom 19, strony 1-10
Danmar Clear Helmet[online], http://www.adaptivespecialties.com/danmar-clearhelmet.aspx [dostęp 26 XII 2013 r.]
Cranioform babies head correction [online], Cranioform Group,
http://www.cranioform.de/pl.html [dostęp: 26 XII 2013 r.]
KidCap. Innovative design, complete car, optimal results [online].:
http://www.helmettherapy.com/ [dostęp: 26 XII 2013 r.]
Kaski korekcyjne [online], V!GO-Ortho Polska.: http://www.vigoortho.pl/kaski_korekcyjne,9.html [dostęp: 26 XII 2013 r.]
Cranial molding helmet information and wearing instructions [online], Orthotic
Solutions, http://www.orthoticsolutions.com/cranial.html [dostęp: 26 XII 2013 r.]
Jak robi się protezy [online], http://www.amputacja.pl/index.php [dostęp:
30 XII 2013 r.]
Cranial Molding Helmets [online], Atlantic Prosthetics & Orthotics,
http://www.unchospitalpando.com /Site/Cranial_Molding_Helmets.html
[dostęp: 30 XII 2013r.]
159
Adrian Dubicki
Metody leczenia deformacji czaszki u dzieci. Rodzaje kasków
korekcyjnych oraz metody ich wykonywania
Deformacje czaszki u dzieci są coraz częściej dostrzeganym i leczonym schorzeniem. W zależności od przyczyn powstania zniekształcenia należy wprowadzić odpowiednie postępowanie
korygujące.
Współczesna medycyna coraz chętniej korzysta z nowinek technologicznych, wykorzystując
postępy w leczeniu deformacji. Przypadki deformacji wywołanych kraniosynostozą, coraz
częściej korygowane są przy wykorzystaniu endoskopów, wypierając tradycyjne zabiegi chirurgiczne. Opracowana została również nieinwazyjna metoda leczenia deformacji ułożeniowych
– kaskami korekcyjnymi. Do niedawna korekcja tego rodzaju deformacji była lekceważona.
Obecnie rozwijane są metody pomiarów, metody oceny poziomu deformacji oraz sposobu
produkcji kasków korekcyjnych.
Treatment methods of the skull malformations in children. The types
of corrective helmets and methods of their execution
The skull malformations in children are being increasingly recognized and treated diseases.
Depending on the causes of malformation, appropriate corrective procedure must be introduced.
Contemporary medicine is increasingly willing to use the technological innovations, using the
advances in the treatment of malformations. Cases of malformations triggered by
craniosynostosis, are more and more frequently corrected using endoscopes displacing traditional
surgery. Non-invasive method for the treatment of positional malformations has also been
developed – with corrective helmets. Until recently, correction of this type of malformation was
neglected. Currently, measurement methods, methods to assess the level of malformation and
helmets production are being developed.
160
Adrian Dubicki1, Żaneta Anna Mierzejewska2
Ocena deformacji
i metody pomiaru czaszki u dzieci
1. Wstęp
Oznaką zdrowia człowieka, zarówno fizycznego jak i psychicznego jest
jego wygląd zewnętrzny. Jest on również ważnym elementem postrzegania
go w społeczeństwie przez innych ludzi. W szczególności ważny jest
wygląd głowy, głównie ze względu na jej pierwszoplanową rolę
w komunikacji werbalnej i niewerbalnej.
Pojawienie się wszelkich nieprawidłowości w kształcie czaszki może
świadczyć o wadach genetycznych, nieprawidłowym rozwoju kości
czaszki, lub niewłaściwej pielęgnacji. W każdym z tych przypadków ważna
jest dokładna diagnostyka i poznanie przyczyny ich powstawania.
Współczesna technika pozwala na coraz szybsze i dokładniejsze
rozpoznanie problemu oraz opracowanie postępowania naprawczego.
2. Cel pracy
Zamysłem tej pracy jest usystematyzowanie wiedzy w zakresie
najczęściej występujących deformacji czaszki, z przypisaniem ich do
przyczyn powstania. Niniejsze opracowanie ukazuje również obecnie
stosowane w takich przypadkach metody diagnostyczne oraz sposób oceny
stopnia zniekształceń.
3. Rodzaje deformacji czaszki oraz przyczyny ich powstawania
Płaskie kości czaszki rosną w trzech kierunkach. Grubościowy wzrost
przebiega od ich wewnętrznej strony, a przyrost na długość i szerokość
rozpoczyna się przy ograniczonych elastycznymi szwami brzegach kości.
Rozwijające się mózgowie, poprzez wywoływane ciśnienie śródczaszkowe,
powoduje rozciąganie się szwów determinując wzrost kości czaszki.
Jakiekolwiek zaburzenia związane ze szwami, objawiające się najczęściej
w ich za wczesnym kostnieniu, powoduje niesymetryczny, nierównomierny
rozrost kości czaszki w jednym kierunku i powstanie deformacji [1].
1
[email protected], Katedra Inżynierii Materiałowej i Biomedycznej, Wydział
Mechaniczny, Politechnika Białostocka, www.pb.edu.pl
2
[email protected], Katedra Inżynierii Materiałowej i Biomedycznej,
Wydział Mechaniczny, Politechnika Białostocka, www.pb.edu.pl
161
Adrian Dubicki, Żaneta Anna Mierzejewska
Takie ograniczenie możliwości wzrostu może być spowodowane
również częstym i długotrwałym uciskiem na daną okolicę czaszki.
Wówczas prócz uniemożliwienia rozrostu może dojść do zniekształcenia
miękkich kości. Powstanie takich deformacji może wiązać się również
z krzywicą i wywołanym utrzymującym się zmiękczeniem kośćca czaszki [1].
3.1. Kraniosynostoza
Kraniosynostoza jest wadą wrodzoną polegającą na przedwczesnym
zamknięciu, zrośnięciu się szwu lub szwów czaszkowych, prowadzących
do zmian w kształcie głowy – powstaniu deformacji. Do zrośnięcia szwów
może dojść nie tylko po narodzinach, ale nawet już w życiu płodowym [2,
3]. Kraniosynostoza jest dość częstym przypadkiem. Występuje u jednego
na 2500 żywo urodzonych dzieci [2]. Zarówno pod względem etiologicznym jak i morfologicznym każdy przypadek kraniosynostozy jest
różny. Z tego powodu każda deformacja wymaga dokładnych badań
klinicznych [2]. W przypadku podejrzenia zrośnięcia szwów, czego oznaką
jest nienaturalny kształt głowy, konieczne jest wykonanie zdjęcia RTG lub
bardziej zaawansowanych badań takich jak tomografia komputerowa, która
jest niezbędna przy dalszym leczeniu schorzenia. Każde dziecko
z podejrzeniem kraniosynostozy powinno być skonsultowane przez
neurochirurga dziecięcego, a w szczególności te ze znacznymi deformacjami w prawidłowej geometrii czaszki [4].
162
Ocena deformacji i metody pomiaru czaszki u dzieci
Rysunek 1. Rodzaje kraniosynostoz [2]
Wygląd głowy przy kraniosynostozie zależny jest od tego, który szew
czaszkowy uległ przedwczesnemu zrośnięciu. Brak możliwości symetrycznego wzrostu kości w kierunku wzdłużnym i poprzecznym oraz postępujący wzrost mózgu powoduje niegeometryczny rozwój czaszki i powstanie
deformacji, które poprzez charakterystyczny wygląd pozwalają określić
skostniały szew. Wyróżniane są cztery zasadnicze rodzaje kraniosynostoz:
 łódkogłowie (scaphocephaly);
 krótkogłowie (brachycephaly);
 trójkątnogłowie (trigonocephaly);
 skośnogłowie (plagiocephaly).
W przypadku skośnogłowia wyróżnia się dodatkowo odmianę przednią
lub tylną, w zależności od tego, czy zrośnięciu uległ odpowiednio szew
wieńcowy czy węgłowy [4].
Na rysunku 1 zaprezentowane zostały szkice głównych rodzajów
kraniosynostoz wraz z umiejscowieniem skostniałych w danych przypadkach szwów.
Kraniosynostoza wymaga leczenia nie tylko z powodu wyglądu,
estetyki ale również powikłań neurologicznych związanych ze wzrostem
ciśnienia śródczaszkowego takich jak spadek przepływu krwi przez mózg,
163
Adrian Dubicki, Żaneta Anna Mierzejewska
prowadzące do niedotlenienia i w konsekwencji zaburzeń słuchu, wzroku
i upośledzenia umysłowego [2, 3].
3.1.1. Łódkogłowie (scaphocephaly)
Przyczyną łódkogłowia jest kościozrost, znajdującego się pomiędzy
kośćmi ciemieniowymi szwu strzałkowego. Biegnie on od przodu ku
tyłowi głowy, na środku górnej części czaszki. Brak możliwości wzrostu
w tym szwie powoduje zablokowanie rozwoju szerokościowego czaszki
(rys. 2a). Staje się ona nadmiernie długa w stosunku do małej szerokości.
Dodatkowo czoło jest uwypuklone ku przodowi, a potylica ku tyłowi
podkreślając jeszcze bardziej łódkowaty wygląd czaszki [1, 5]. Łódkogłowie jest najczęściej występującą spośród wszystkich kraniosynostoz.
Diagnozuje się ją w 50% wszystkich przypadków deformacji [6].
3.1.2. Krótkogłowie (brachycephaly)
Przedwczesny zrost szwu wieńcowego, łączącego kości ciemieniowe
z czołową, powoduje powstanie deformacji zwanej krótkogłowiem.
Mózgowie ma ograniczoną przestrzeń i nie może rozwijać się w kierunku
długościowym – przednim i tylnym (rys. 2b). Rekompensowane jest to
wzrostem szerokościowym, w kierunku boków czaszki. Głowa staje się
przez to nienaturalnie szeroka, a często również i wysoka. Te schorzenie
występuje często jako dodatkowy objaw przy zespołach wad genetycznych
[1, 6]. Krótkogłowie jest drugą po łódkogłowiu, najczęściej występującą
formą kraniosynostozy. Szacuje się, że występuje w 22% wszystkich
przypadków [2].
164
Ocena deformacji i metody pomiaru czaszki u dzieci
a)
b)
Rysunek 2. Rozrost mózgowia a) przy łódkogłowiu, b) przy krótkogłowiu [6]
3.1.3. Trójkątnogłowie (trigonocephaly)
Trójkątnogłowie wiąże się z kościozrostem szwu czołowego, biegnącego
od czubka głowy, przez środek czoła w kierunku nosa. Normalnie szew ten
powinien zamknąć się do 2 roku życia. Jego przedwczesne zrośnięcie, często
już przed porodem powoduje nacisk mózgowia na czoło, które przybiera
klinowaty kształt [1, 5].
165
Adrian Dubicki, Żaneta Anna Mierzejewska
Rysunek 3. Kształt czaszki przy trójkątnogłowiu [6]
Szew wieńcowy wyczuwalny, a czasami i widoczny jest w postaci
krawędzi kości. Gdy dojdzie do przedwczesnego zamknięcia, poprzez
działające ciśnienie śródczaszkowe, na powierzchni zewnętrznej szwu
powstaje grzbiet [6]. Prócz klinowatego zniekształcenia kości czołowej,
przy trójkątnogłowiu można zaobserwować dystopię oczodołów. Wada ta
stanowi od 5 do 10% przypadków kraniosynostoz [7].
3.1.4. Skośnogłowie (plagiocephaly)
Skośnogłowie może powstać przez przedwczesny zrost szwów, ale
i również przez wrodzoną asymetrię półkul mózgowych [1]. W zależności
od tego, czy skostnieniu uległ szew wieńcowy czy węgłowy rozróżnia się
odpowiednio skośnogłowie przednie lub tylne (rys. 4) [4].
166
Ocena deformacji i metody pomiaru czaszki u dzieci
a)
b)
Rysunek 4. Rozrost mózgowia przy skośnogłowiu przednim (a) oraz tylnym (b) [6]
Przednie skośnogłowie charakteryzuje się wzrostem czaszki po
przeciwnej stronie od zrośniętego szwu wieńcowego. Wzrost ten obejmuje
zarówno górną część czaszki jaki i jej podstawę. Powoduje to deformację
czoła, twarzy, uszu oraz nosa. Ucho po stronie zrośniętego szwu jest lekko
wysunięte do przodu. Czoło po przeciwnej od szwu stronie ulega
zniekształceniu, poprzez charakterystyczne wysunięcie kości czołowej ku
przodowi [2].
Skośnogłowie tylne wygląda podobnie jak przednie. Po przeciwnej
stronie od zrośniętego szwu węgłowego, wybrzuszeniu ulega kość czołowa
oraz część tylna czaszki. Ucho po stronie skostniałego szwu pozostaje
w prawidłowym położeniu lub jest lekko cofnięte. Schorzeniu towarzyszy
zniekształcenie twarzy, oczodołów. Zniekształceniu ulega również
podstawa czaszki przez co przybiera ona pochylony kształt [2].
Spośród wszystkich kraniosynostoz, skośnogłowie występuje najrzadziej. Diagnozuje się je u ok. 2-4% dzieci z kraniosynostozą [2].
3.2. Deformacje ułożeniowe
Przyczyną deformacji nie zawsze jest zrost szwów czaszkowych. Może
do nich dochodzić również z powodu długotrwałego zewnętrznego ucisku
na daną okolicę czaszki. Miękkie kości ulegają wtedy zniekształceniu,
a uniemożliwiony w tym kierunku rozwój mózgowia skutkuje powstaniem
deformacji [1]. Takie zniekształcenia czaszki, którego przyczyną nie jest
kościozrost szwów, nazywane są deformacjami ułożeniowymi.
Radykalny wzrost liczby przypadków nastąpił między 1992, a 1999
rokiem. Spowodowane to było przez akcję Amerykańskiej Akademii
167
Adrian Dubicki, Żaneta Anna Mierzejewska
Pediatrycznej (AAP) nazwanej „Back to Sleep‖. Kampania ta miała na celu
zachęcenie rodziców do układania dzieci na plecach, aby zapobiec tzw.
nagłej śmierci łóżeczkowej (SIDS – ang. Sudden Infant Death Syndrome).
Akcja przyniosła pozytywne skutki, liczba śmiertelnych przypadków
zmniejszyła się o ponad 50%, lecz skutkowało to nagłym zwiększeniem
(ok. 5-krotnym) przypadków deformacji czaszki. Częste przebywanie
dziecka na plecach, nie układanie w innej pozycji (na boku), powodowało
uciski na potylicę i jej spłaszczenie. Szacuje się że deformacja ułożeniowa
dotyka jedno na 60 dzieci [8].
Rysunek 5. Rodzaje deformacji ułożeniowych [9]
Podobnie jak w przypadku kraniosynostoz, rozróżnia się kilka rodzajów
deformacji ułożeniowych. Ich nazwy są ściśle związane z kształtem
zdeformowanej czaszki. W zależności od miejsca długotrwałego nacisku,
głowa przybiera inny kształt. Są one bardzo podobne do tych związanych z
kraniosynostozą, więc i przyjęto dla nich podobne nazwy (z dodatkiem
wskazującym na przyczynę – ułożeniowe). Do najczęściej występujących
deformacji ułożeniowych czaszki należą [9]:
 łódkogłowie ułożeniowe (positional scaphocephaly);
 krótkogłowie ułożeniowe (positional brachycephaly);
 skośnogłowie ułożeniowe (positional plagiocephaly).
Na rysunku 5 zaprezentowane zostały fotografie oraz szkice najczęściej
występujących deformacji ułożeniowych.
Deformacja ułożeniowa w większości wypadków nie zagraża
powikłaniom neurologicznym ani rozwojowym u dziecka. Głównie wiąże
się ona z aspektem estetycznym. Ważna jest odpowiednia diagnoza
i odróżnienie deformacji ułożeniowych od zrostowej, ze względu na
odmienne leczenie obu tych przypadków.
168
Ocena deformacji i metody pomiaru czaszki u dzieci
Rysunek 6. Różnice pomiędzy skośnogłowiem ułożeniowymi a wywołanym kraniosynostozą [6]
Może w tym pomóc często wyczuwalny grzbiet występujący na
skostniałym szwie. W przypadku skośnogłowia dodatkowo pomocne
będzie położenie ucha (w deformacji ułożeniowej ucho po spłaszczonej
stronie jest widocznie przesunięte względem drugiego, w kraniosynostozie
przeciwnie – ucho po przeciwnej do spłaszczonej strony jest przesunięte)
oraz bardziej wysunięte z jednej strony czoło (podobnie jak w przypadku
uszu). Najlepsza oraz jednoznacznie określająca przyczynę deformacji
będzie diagnoza za pomocą zdjęć RTG lub tomografii komputerowej [8].
169
Adrian Dubicki, Żaneta Anna Mierzejewska
4. Ocena stopnia deformacji
Zaawansowanie deformacji ma duży wpływ przy podejmowaniu decyzji
co do rodzaju leczenia, określania czasu oraz prognozowania jego efektów.
Stopień zniekształcenia określany jest na podstawie przeprowadzonych
pomiarów, będących elementem diagnozy [10].
Jednym z pierwszych etapów diagnozy jest wykonanie pomiarów
czaszki. W większości przypadków dokonuje się to metodą stykową, czyli
za pomocą przyrządów stykających się z głową dziecka. Należą do nich
mały cyrkiel kabłąkowy, miarka obwodów głowy lub zwykła miarka
krawiecka. Często dopiero po stwierdzeniu deformacji dokonuje się
pomiarów bezstykowych za pomocą np. skanerów czy zdjęć 3D oraz
dokładnej analizy otrzymanych wyników.
Dla ocenienia stopnia deformacji przyjęte są specjalne wzory wypracowane na podstawie uśrednionych proporcji czaszek o prawidłowej
geometrii. Krótkogłowie wraz z łódkogłowiem posiada wspólny wzór
pomagający określić stopień zniekształcenia czaszki. W przypadku
skośnogłowia dokonuje się porównania otrzymanych wartości [11].
4.1. Pomiary stopnia krótkogłowia i łódkogłowia [11]
Aby uzyskać prawidłowe wyniki konieczne jest odpowiednie określenie
skrajnych punktów, pomiędzy którymi mierzona będzie odległość.
Wyróżniamy cztery takie punkty (rys. 7):
 A – umieszczony nieco powyżej, pomiędzy brwiami;
 P – najdalej wysunięte miejsce na tylnej części głowy;
 S oraz D – znajdujące się po obu stronach głowy, nieco powyżej uszu.
Rysunek 7. Umiejscowienie punktów pomiarowych [11]
170
Ocena deformacji i metody pomiaru czaszki u dzieci
Po zmierzeniu odległości pomiędzy tymi punktami należy podstawić je
do specjalnego wzoru (1), który pozwoli obliczyć tzw. Cephalic Index (CI).
CI(%)= (SD/AP)*100
(1)
Na podstawie indywidualnej wartości indeksu możemy obliczyć tzw.
Deformation Index (DI). Określa on w jakim stopniu pacjent odbiega od
standardowej wartości CI. Za standardowy, uśredniony wynik CI przyjęto
wartość 78%.
Tabela 1. Wzory do określania stopnia DI
Krótkogłowie (gdy CI > 78%)
DI(%) = CI – 78%
Łódkogłowie (gdy CI < 78%)
DI(%) = 78% – CI
Za prawidłową wartość CI uważa się przedział od 75 do 85%. Przedział
70-75% oraz od 85% do 90-95% świadczy o łagodnej, umiarkowanej
deformacji. Pozostałe wartości nie mieszczące się w powyższych przedziałach oznaczają bardziej zaawansowane deformacje.
4.2. Pomiary stopnia skośnogłowia [11]
Do określenia stopnia zaawansowania skośnogłowia podobnie jak
w przypadku krótkogłowia i łódkogłowia potrzebne jest kreślenie położenia
punktów AP. Utworzą one linię podziałową pomiędzy dwoma półkulami.
Dodatkowo niezbędne jest określenie dłuższej przekątnej czaszki, której
miejsca styku utworzą punkty Ll oraz krótszej z początkowymi punktami
Rr. Ważny jest również kąt α pomiędzy przekątnymi a linią podziałową
(rys. 8).
Rysunek 8. Punkty oraz kąt przy pomiarze stopnia skośnogłowia [11]
171
Adrian Dubicki, Żaneta Anna Mierzejewska
Początkowo należy określić linie podziałową. Od punkt A znajdującego
się pomiędzy brwiami, należy poprowadzić prostopadłą względem czoła
linię, do punktu P. Jeżeli jest ono zdeformowane należy określić jak ta linia
przebiegałaby przy prawidłowej geometrii czaszki. Kolejnym krokiem jest
określenie najdłuższej przekątnej czaszki, wyznaczenie punktów L-l oraz
zmierzenie odległości między nimi. Dłuższa przekątna wraz z linią
podziałową przecina się pod kątem α. Pod takim samym kątem należy
zmierzyć odległość pomiędzy punktami R-r, tworzącymi krótszą przekątną.
Od otrzymanej wartości długości dłuższej przekątnej, należy odjąć
wartość krótszej. Różnica ta jest miarą potrzebną do określenia stopnia
deformacji (tabela 2).
Tabela 2. Miara skośnogłowia
Łagodne
Umiarkowane
Ciężkie
1-9 mm
10-19 mm
powyżej 20 mm
Pomiarów potrzebnych do określenia zaawansowania skośnogłowia, jak
i krótkogłowia i łódkogłowia można dokonać zarówno przy wykorzystaniu
przyrządów stykowych i bezstykowych. Najczęściej używane i wykorzystywane w medycynie przedstawione zostały w poniższych podrozdziałach.
5. Pomiary stykowe
Pomiary stykowe najczęściej stosowane do postawienia pierwszej
diagnozy, stwierdzenia czy u danego pacjenta występuje deformacja
czaszki. Dokonywane są przy pomocy prostych urządzeń bezpośrednio
pokazujących wartość mierzonej wielkości.
Jednym z takich urządzeń jest cyrkiel kabłąkowy. Zbudowany jest on
z dwóch ruchomych, wygiętych kabłąkowo ramion oraz prostopadle
umieszczonej do nich linijki. Na jej powierzchni umieszczona jest
podziałka umożliwiające odczytanie wartości pomiaru. Pozwala on na
mierzenie średnic np. kości, stóp czy głowy. Istnieją jego dwie odmiany
– duży i mały. Duży służy do pomiarów np. szerokości klatki piersiowej
czy bioder. Mała odmiana cyrkla (rys. 9) wykorzystywana jest przy
mierzeniu mniejszych średnic. Do pomiarów deformacji czaszki wykorzystuje się odmianę małą cyrkla, gdyż jej wymiary mieszczą się
w zakresie pomiarowym tego rodzaju cyrkla [11].
Do pomiaru obwodu główki dziecka wykorzystywane są specjalne
miarki (rys. 10). Przybierają one różne formy. Mogą być zwijane do
specjalnego pojemnika lub wyglądać jak zwykła miarka krawiecka.
172
Ocena deformacji i metody pomiaru czaszki u dzieci
Rysunek 9. Cyrkiel kabłąkowy mały [11]
Do metod stykowych należy również zaliczyć skanery stykowe.
Umożliwiają one otrzymanie dokładnie odwzorowanej powierzchni głowy
w postaci cyfrowego modelu. Specjalne ramie pomiarowe sczytuje
położenie w przestrzeni po zetknięciu się z badanym obiektem. Niestety nie
mogą być one stosowane do bezpośredniego pomiaru głowy dziecka ze
względu na długi czas takiego pomiaru i konieczność unieruchomienia
badanego obiektu. Drugim powodem jest plastyczność tkanek, a ta metoda
może być wykorzystywana tylko przy twardych, nieodkształcalnych
obiektach [12].
Rysunek 10. Miarka do pomiaru obwodu głowy noworodków i niemowląt [13]
173
Adrian Dubicki, Żaneta Anna Mierzejewska
6. Pomiary bezstykowe
Bezstykowe metody pomiarowe wykorzystywane są głównie przy
dalszej diagnozie oraz planowaniu leczenia. Pomiar dokonywany jest bez
bezpośredniego kontaktu urządzenia z badaną powierzchnią. Do takiego
rodzaju urządzeń mogą więc również zostać zaliczone m.in. rezonans
magnetyczny lub tomografia komputerowa, wykorzystywane w diagnozie
do oceny poziomu skostnienia szwów oraz ewentualnych powikłań
neurologicznych [4, 12].
Bezstykowe pomiary najczęściej wykonywane są za pomocą skanerów,
głównie laserowych. Niestety nie wszystkie ich rodzaje dopuszczane są do
użytku w medycynie. Głównie ma to związek z zastosowanym
w urządzeniu rodzajem lasera i ryzykiem uszkodzenia wzroku [12].
Jednym z bezpiecznych, przeznaczonych do korzystania w medycynie
body skanerów jest ręczny, przenośny skaner Go!Scan 3D. Wykorzystuje
on biały laser o małej energii, bezpieczny dla wzroku. Wiązka światła pada
na powierzchnię skanowanego przedmiotu tworząc linię świetlną. Jej obraz
sczytywany jest przez detektor. W zależności od odległości pomiędzy
skanowaną powierzchnią a skanerem zmienia się kąt linii świetlnej. Po jego
przechwyceniu przez detektor, przy znanym położeniu źródła światła
i detektora oraz kąta odbicia linii, przy wykorzystaniu metody triangulacji,
obliczane jest położenie punktów tworzących powierzchnię. Zaletą tego
skanera jest szybkość uruchomienia (gotowy do użycia po 2 minutach) oraz
skanowania zarówno małych jak i dużych powierzchni. Skanowany obiekt
nie musi być sztywno przytwierdzony, nieruchomy. Może poruszać się
w trakcie skanowania (głównie obracać). Zadowalająca jest również jakość
skanowania. Pozwala ona na skanowanie różnych materiałów z dokładnością do 0,1 mm [14].
Innym często stosowanymi czytnikami są skanery prążkowe. Ich
działanie jest podobne jak wcześniej opisanych skanerów laserowych.
Różnicą jest rodzaj obrazu padającego na badaną powierzchnię. Zamiast
pojedynczej linii, obiekt jest oświetlany za pomocą rzutnika sekwencją
prążków o znanej grubości i gęstości. Wykorzystywany jest w tym
przypadku efekt prążków Moire’a [12].
Przykładem takich skanerów, często używanych w medycynie są m.in.
Gemini, MegaCapturor czy Cyclops. Są to skanery stacjonarne, które
umieszcza się na płaskiej powierzchni lub na statywie. Umożliwiają one nie
tylko skanowanie pojedynczych fragmentów, ale również całego ciała.
Skanery te dodatkowo pozwalają otrzymać bardzo realistyczny obraz wraz
z kolorem. Ich dokładność jest zależna od odległości pomiaru oraz
powierzchni. Im większa powierzchnia skanowania, tym mniejsza jest
dokładność skanu [14].
174
Ocena deformacji i metody pomiaru czaszki u dzieci
Często pomiary wykonywane są przy użyciu kilku ustawionych wokół
badanego obiektu i odpowiednio skalibrowanych aparatów fotograficznych
lub kamer. Taka technika nosi nazwę fotogrametrii [15, 16].
W tym samym momencie, wszystkie aparaty wykonują zdjęcia
badanego obiektu, a specjalny program komputerowy łączy je tworząc
trójwymiarowy model obiektu (rys. 11). Położenie poszczególnych punktów
określane jest na podstawie odległości i kątów z przynajmniej dwóch zdjęć.
Przy znanej skali, położeniu aparatów i katów możliwe jest określenie
rzeczywistej odległości pomiędzy punktami. Tak otrzymany obraz jest
dalej przetwarzany, w celu otrzymania modelu bryłowego, który może
zostać wykorzystany do dokładnego określenia deformacji oraz zaplanowania leczenia [15, 16].
Rysunek 11. Skanowanie przy użyciu zestawu kamer [15]
Istnieje wiele metod bezkontaktowego pomiaru (rys. 12). Są one bardzo
przydatne przy diagnozie (rys. 13) oraz planowaniu leczenia. W znaczny
sposób pomagają w zmniejszeniu do minimum czasu trwania często
stresującej dla dziecka diagnozy.
175
Adrian Dubicki, Żaneta Anna Mierzejewska
a)
Rysunek 12. a) model głowy w trakcie pomiarów (widoczne wyświetlane na powierzchni modelu
sekwencje pasków), b) proces dopasowania chmur
Rysunek 13. Pomiar odległości pomiędzy punktami AP (długość) i SD (szerokość)
7. Podsumowanie
Deformacje czaszki, które niegdyś były często bagatelizowane, obecnie
są coraz sprawniej diagnozowane i leczone. Połączenie wiedzy medycznej
z techniczną pozwala na szybkie i dokładne postawienie diagnozy oraz
wdrożenie środków prowadzących do prawidłowego ukształtowania
czaszki u dziecka. Czas w przypadku tego schorzenia ma zasadniczy wpływ.
176
Ocena deformacji i metody pomiaru czaszki u dzieci
Za późne stwierdzenie deformacji może w znaczny sposób ograniczyć
możliwość wykorzystania nieinwazyjnych, nieoperacyjnych metod
leczenia, a nawet doprowadzić do uszkodzeń neurologicznych, wywołanych zwiększonym ciśnieniem śródczaszkowym.
Wykorzystanie w diagnostyce bezstykowych metod pomiarowych
pozwala na znaczne skrócenie czasu potrzebnego do określenia poziomu
zmian. zaprezentowane w pracy techniki cyfrowe umożliwiają w pewnym
stopniu zautomatyzowanie procesu stawiania diagnozy, gdyż poprzez
wykorzystanie odpowiednich programów komputerowych możemy
otrzymać bardzo dokładną analizę deformacji. Zaletą jest również bardzo
duża dokładność pomiarów, często nie osiągalna tradycyjnymi metodami.
Podziękowania
Praca zrealizowana przy wsparciu finansowym Wydziału Mechanicznego
Politechniki Białostockiej w ramach projektu „Rozwój młodych naukowców
i uczestników studiów doktoranckich‖ nr MB/WM/14/2014.
Literatura
Bochenek A., Reicher M., Anatomia człowieka. Tom I, Warszawa,
Wydawnictwo Lekarskie PZWL, 2009, s. 298-436
2. Aleck K., Craniosynostosis Syndromes in the Genomic Era, Phoenix, XI
Seminars in Pediatric Neurology, Elsevier, 2004, s. 256-26
3. Gzik M., Tejszerska D., Wolański W., Gzik-Zroska B., Komputerowe
wspomaganie planowania zabiegu korekcji trigonocefalii u dzieci, Gliwice,
Modelowanie Inżynierskie, 2009, zeszyt 38, s. 51-56
4. Wolański W., Larysz D., Gzik M., Kawlewska E., Komputerowe metody
wspomagania leczenia kraniosynostozy, Gliwice, Modelowanie Inżynierskie,
2011, zeszyt 41, s.437-444
5. Polskie Centrum Medyczne Elobot., Kraniosynostoza [online],
http://o.elobot.pl/ artykul/kraniosynostoza-anomalii-twarzoczaszki [dostęp:
8 XII 2013r]
6. Oregon Health & Science University., Craniofacial & Cleft Palate Program
[online], http://www.ohsu.edu/xd/health/services/doernbecher/programsservices/ cleft-palate-craniofacial.cfm [dostęp: 8 XII 2013r.]
7. Laskowska-Ziętek A., Misiuk-Hojło M., Przedwczesne zarośnięcie szwów
czaszkowych – aspekty okulistyczne i stomatologiczne, Wrocław, Dental
and Medical Problems, 2007, zeszyt 44, s. 242-246
8. Biggs W. S., Diagnosis and management of positional head deformity,
Michigan, American Family Physician, 2003, zeszyt 67, s.1953-1956
9. Co to jest "plagiocefalia ułożeniowa"(positional plagiocephaly)? [online],
http://www.mamopedia.pl/10-11-mies/zdrowie/plagiocefalia-ulozeniowa
[dostęp: 15 XII 2013r.]
10. Larysz D., Ocena wyników leczenia izolowanych kraniosynostoz u dzieci
z uwzględnieniem aspektów klinicznych, biomechanicznych oraz
1.
177
Adrian Dubicki, Żaneta Anna Mierzejewska
11.
12.
13.
14.
15.
16.
neurorozwojowych – Suplement do rozprawy habilitacyjnej [online],
http://leczeniekraniosynostoz.pl/ [dostęp: 12 XII 2013r.]
Measuring Plagiocephaly [online], MIMOS,
http://www.plagiocephalyflathead.com/cart_mimos_CRANEO.php
[dostęp: 1 I 2014r.]
CAD / CAM / CAE / MES [online] Design News Polska,
http://www.designnews.pl/menu-gorne/kanaly-tematyczne/cad-cam-cae-mes/
[dostęp: 3 I 2014 r.]
Miarka do pomiaru obwodu głowy noworodków i niemowląt SECA 212
[online]. http://www.medysklep.pl/ index.php [dostęp: 1 I 2014r.]
CaspSystem Systemy wizyjne 3D [online]. http://www.pomiar3d.pl/
[dostęp:3 I 2014 r.]
Cranioform babies head correction [online]. Cranioform Group,
http://www.cranioform.de/pl.html [dostęp: 26 XII 2013 r.]
Tokarczyk R., Fotogrametria cyfrowa w zastosowaniach medycznych do
pomiaru ciała ludzkiego – przegląd i tendencje rozwojowe systemów
pomiarowych [online], http://home.agh.edu.pl/~tokarcz/public/fot_med.pdf
[dostęp 4 I 2014 r.]
Ocena deformacji i metody pomiaru czaszki u dzieci
Zewnętrzny wygląd człowieka jest oznaką jego zdrowia, zarówno fizycznego jak i psychicznego,
jest również ważnym elementem postrzegania w społeczeństwie przez innych ludzi.
Najistotniejsza jest płaszczyzna czołowa, głównie ze względu na zasadniczą rolę w komunikacji
werbalnej i niewerbalnej z ludźmi. Jeśli chodzi o zniekształcenia czaszki, rodzice z powodów
zdrowotnych i estetycznych coraz częściej decydują o leczeniu. Współczesna medycyna
rozwinęła metody korekty zdeformowanego ciała – od inwazyjnych zabiegów chirurgicznych do
bezinwazyjnych metod leczenia kaskami korekcyjnymi.
W pracy zaprezentowane zostały podstawowe, najczęściej spotykane rodzaje deformacji czaszki,
z uwzględnieniem przyczyn ich powstawania – przedwczesny zrost szwów czaszkowych lub
długotrwałe naciski na dany rejon głowy. Określenie przyczyny powstania zniekształceń
umożliwia wdrożenie odpowiedniego leczenia. Zależy ono również od stopnia deformacji, który
określany jest za pomocą opisanych w niniejszym opracowaniu wzorów. Rozwój techniki
umożliwia coraz szybsze i dokładniejsze przeprowadzenie pomiarów czaszki, a nawet ich analizę
w celu otrzymania gotowych zaleceń do korekcji.
Evaluation methods for measuring skull deformation in pediatric
patients
The external appearance of human is a sign of his health, both physically and mental and an
important element of perception in the community by other people. The most important in that
plane is the appearance of the head, mainly because of its essential role in verbal and nonverbal
communication with people. When it comes to distortion of the skull, parents due to health
reasons and for aesthetic increasingly decide on treatment. Modern medicine has developed
methods for correcting deformities – from invasive surgical procedures to non-invasive orthoses
called corrective helmets.
The increased interest in the treatment of diseases of the skull stimulates the creation of new
therapies. The development of technology creates enormous opportunities ranging from speeding
up diagnosis, by designing the helmet until his execution. The work has been shown and
described individually tailored course design helmet using the latest technical solutions.
178
Alicja Janicka1, Anna Cwynar2, Blanka Ziomkowska3, Tomasz Wybranowski4
Fluorescencyjna spektroskopia
czasowo-rozdzielcza.
Proste narzędzie diagnostyczne
1. Wprowadzenie
Metody spektroskopowe używane są od dawnych czasów, początkowo
(Newton, Kartezjusz) kiedy spektroskopia stawiała pierwsze kroki, nie
dostrzegano rozległości potencjału jaki stanowią metody spektroskopowe.
W dzisiejszych czasach badania przy użyciu światła są dość dobrze
poznaną sztuką badawczą, która jednak w dobie obecnej nauki ciągle
podlega modyfikacjom i ulepszeniom. Spektroskopia czasowo- rozdzielcza
jest szeroko stosowana w biochemii, fizyce, farmacji czy medycynie. Jej
największą zaletą jest prostota oraz z klinicznego punktu widzenia mała
inwazyjność i bezpieczeństwo. Jest to istotną cechą zarówno dla pacjenta
jak i lekarzy i naukowców. Jednym z najprostszych przykładów małoinwazyjności w zastosowaniu fluorescencyjnej spektroskopii czasoworozdzielczej jest analiza osocza uzyskanego z krwi pełnej pacjenta.
2. Cel pracy
Celem niniejszej pracy jest przedstawienie spektroskopii jako
małoinwazyjnej, szybkiej oraz niewymagającej długiego czasu techniki,
która dzięki korelacji, jaka występuje między światłem a cząsteczkami,
może być używana m.in. do badania właściwości białek oraz wykorzystywana przy diagnostyce różnego rodzaju schorzeń.
1
[email protected], Collegium Medicum w Bydgoszczy, Wydział Farmaceutyczny,
Studenckie Koło Naukowe Biofizyki przy Zakładzie Biofizyki
2
[email protected], Collegium Medicum w Bydgoszczy, Wydział Farmaceutyczny, Katedra
i Zakład Patobiochemii i Chemii Klinicznej
3
[email protected], Collegium Medicum w Bydgoszczy, Wydział Farmaceutyczny, Katedra
i Zakład Biofizyki
4
[email protected], Collegium Medicum w Bydgoszczy, Wydział
Farmaceutyczny, Katedra i Zakład Biofizyki
179
Alicja Janicka, Anna Cwynar, Blanka Ziomkowska, Tomasz Wybranowski
3. Omówienie
3.1. Ogólna charakterystyka białek
Białkami (inaczej proteiny lub polipeptydy) nazywamy wielkocząsteczkowe elementy budujące wszystkie organizmy żywe. Białka przede
wszystkim są produktami, które powstają poprzez połączenie się grup alfakarboksylowych z alfa-aminowymi, których spoiwem są wiązania
peptydowe. Praktycznie wszystkie białka składają się z połączenia w różnej
kombinacji 20 aminokwasów powszechnie występujących w przyrodzie,
których to łańcuchy boczne są odmienne. Te boczne łańcuchy tak zwane
reszty R różnią się między sobą kształtem, zdolnością do wytwarzania
wiązań wodorowych, ale także reaktywnością chemiczną, charakterem
hydrofobowym oraz wielkością i posiadanym ładunkiem elektrycznym [1].
W związku z tym, że białka są tworzone przez kombinację różnych
aminokwasów, logicznym wydaje się fakt, że w zależności od tych
składowych elementów, zmieniają się właściwości fizyczne i chemiczne
powstałych peptydów. Ogólna norma wagowa, pozwalająca stwierdzić czy
dana cząsteczka jest peptydem mówi, że za białko uznaje się cząsteczkę,
której łączna masa cząsteczkowa przekracza 10 kDa.
Białka mają budowę złożoną, a ponieważ są zbudowane często z wielu
aminokwasów, których reszty są mocno rozgałęzione, ich struktura jest
przestrzenna. Struktura pierwszorzędowa białek jest przydatna podczas
określania kolejno po sobie postępujących aminokwasów. Jednak oprócz
struktury pierwszorzędowej wyróżnić można jeszcze kolejne 3 poziomy
organizujące złożoną strukturę białek, które różnią się rodzajem
i stabilnością wiązania. Wiązania wodorowe są charakterystyczne
w strukturach drugorzędowych. Złożone łańcuchy białkowe mogą tworzyć
różne konstrukcje helisy polipeptydowej typu, alfa, beta – harmonijki, pętli,
a także wstęga – zwrot – wstęga. Boczne niepolarne łańcuchy
aminokwasów, występujące w trzeciorzędowej strukturze białka „chowają
się” wewnątrz makrocząsteczki w tak zwanym rdzeniu hydrofobowym.
Wewnątrz protein niezwykle istotną rolę, polegającą w głównej mierze na
stabilizacji konstrukcji białka odgrywają siły Van der Waalsa oraz mostki
dwusiarczkowe. Czwartorzędowa struktura określa białka składające się
z kilku łańcuchów polipeptydowych. Sposób upakowania białka zależy od
jego funkcji. Białka pełnią funkcje praktycznie we wszystkich procesach
zachodzących w organizmie począwszy od mechanicznego stabilizowania
tkanek oraz narządów jako funkcji strukturalnych, przez pełnienie roli
katalizatorów różnych reakcji do transportu różnych związków metali,
enzymów oraz innych substancji. Białka to także hormony, które regulują
procesy zachodzące wewnątrz organizmu. Dodatkowo jako np. przeciw-
180
Fluorescencyjna spektroskopia czasowo-rozdzielcza. Proste narzędzie diagnostyczne
ciała ochraniają przed czynnikami atakującymi organizm pełniąc funkcję
białek układu odpornościowego [1‚4].
3.2. Białka osocza
Osocze zwane także plazmą jest zasadniczym składnikiem krwi otrzymywanym po odwirowaniu krwi pełnej w odpowiednich warunkach,
w którym zawieszone są komórkowe elementy morfotyczne krwi.
Całkowite stężenie białka u zdrowego człowieka w jego osoczu wynosi od
65 do 80 g/l. Osocze jest bogato białkowym supernatantem krwi pełnej,
bowiem znajduje się w nim nawet ponad 300 różnych białek, jednakże
najważniejsze są dwie grupy z rodziny immunoglobulin i albuminy,
odpowiedzialne za zmiany całkowitego stężenia protein. To właśnie białka
osocza odpowiadają za kontrolę zaopatrywania w płyny przestrzeni
pozanaczyniowych, regulują procesy homeostatyczne oraz regulują
krzepnięcie krwi, pełnią funkcje transportowe dla wielu substancji oraz
odpowiadają za ochronę organizmu przed czynnikami chorobotwórczymi.
Z powodu na przykład nadmiernej utraty białka przez nerki czy przewód
pokarmowy, upośledzonego jego wchłaniania czy też niedostatecznej
biosyntezy w osoczu może dojść do hipoproteinemi, która objawia się
poprzez zmniejszenie stężenia albuminy. Odwrotnym do hipoproteinemi
zjawiskiem patologicznym jest hiperproteinemia objawiająca się
podwyższoną syntezą immunoglobulin (podwyższona synteza albumin jest
praktycznie niespotykana), stąd właściwsza nazwa dla tego zjawiska to
hipergammaglobulinemia [4].
Białka osocza można rozdzielić za pomocą elektroforezy na 5 głównych
frakcji do których zaliczmy: albuminę, α1-globuliny, α2-globuliny,
β-globuliny oraz γ-globuliny. Wszystkie z tych frakcji pełnią różnorodne
funkcje. Skład poszczególnych frakcji białkowych w prawidłowych
warunkach po rozdziale elektroforetycznym przedstawia Tab. 1.
181
Alicja Janicka, Anna Cwynar, Blanka Ziomkowska, Tomasz Wybranowski
Tab. 1. Poszczególne frakcje białkowe po rozdziale elektroforetycznym surowicy. Źródło:
Dembińska-Kieć A., Naskalski J.: Diagnostyka laboratoryjna z elementami biochemii klinicznej
FRAKCJA
STĘŻENIE BIAŁKA
(g/l)
ZAWARTOŚĆ
BIAŁKA (%)
Albumina
35-55
55,0-70,0
α1-globuliny
0,9-2,1
1,4-2,9
α2-globuliny
5,0-7,9
7,0-11,0
β-globuliny
8,0-13,0
5,7-7,9
γ-globuliny
9,0-16,0
5,7-7,9
Razem
65,0-82,0
100
W każdą z przedstawionych w powyższej tabeli frakcji wliczają się
konkretne białka. Jakie konkretnie białka należą do konkretnej grupy
przedstawia Tab. 2.
182
Fluorescencyjna spektroskopia czasowo-rozdzielcza. Proste narzędzie diagnostyczne
Tab. 2. Poszczególne białka tworzące frakcje po rozdziale elektroforetycznym. Źródło:
Diagnostyka laboratoryjna z elementami biochemii klinicznej. Dembińska-Kieć A., Naskalski J.
Elsevier Urban & Partner, Wrocław 2010.
Frakcja
Białka
Albumina
albumina
α1-globuliny
α1-antytrypsyna, α1-kwaśna glikoproteina, α1-lipoproteina
(apoA, HDL)
α2-globuliny
α2-makroglobulina, haptoglobina
β-globuliny
Transferryna, betalipoproteina (apoB, LDL)
Β2-globuliny
Frakcja C3 dopełniacza, immunoglobulina A,
immunoglobulina G
γ-globuliny
Immunoglobuliny klasy A, G, M, białko C-reaktywne
3.2.1. Albumina
Głównym białkiem osocza, którego stężenie we krwi wynosi 40-52 g/l
(stanowi do 50-70% całościowej ilości białek surowicy) jest albumina [4].
Białko to jest syntezowane w wątrobie, a za jego degradację w organizmie
odpowiedzialne są komórki śródbłonka naczyń, mięśni i skóry, degeneracja
w wątrobie oraz nerkach zachodzi w mniejszej ilości [5]. Albumina pełni
w organizmach żywych wiele różnych funkcji. Jest odpowiedzialna m.in.
za utrzymanie prawidłowego ciśnienia osmotycznego krwi, jest zarazem
białkiem antyoksydacyjnym oraz buforującym, a jej cząsteczki są
swoistego rodzaju magazynem dla aminokwasów. Pełni także funkcje
transportujące będąc nośnikiem drobnocząsteczkowych metabolitów, przenosi ona po wcześniejszym związaniu się kwasy tłuszczowe, bilirubinę,
hormony oraz co istotne jony różnych metali w tym wapnia, miedzi,
kobaltu czy niklu. Albumina jest stosunkowo dużym białkiem zbudowanym z 585 reszt aminokwasowych, gdzie jedną z reszt jest tryptofan
Trp-214 [6]. Fragment N – końcowy albuminy jest najistotniejszym
obszarem z punktu widzenia wiązania się z nim jonów metali przejściowych. Składa się on z czterech aminokwasów kwasu asparaginowego
– alaniny – histydyny – lizyny. To fragment szczególnie narażony
i wrażliwy na uszkodzenia. Wiele różnych czynników w tym zwiększony
183
Alicja Janicka, Anna Cwynar, Blanka Ziomkowska, Tomasz Wybranowski
stres oksydacyjny może wpływać na strukturę albuminy, która pod jego
wpływem może ulec zmianie [7, 8].
3.3. Fluorescencja
Zjawisko emisji fal świetlnych generowanych przez różnego rodzaju
cząsteczki to jedno z najczęściej stosowanych w badaniach biofizycznych
i biochemicznych metod badawczych wykorzystywanych w biologii
molekularnej. Terminem fluorescencji określa się emitowanie światła przez
wcześniej wzbudzoną cząsteczkę, która w tym czasie przechodzi
z najniższego poziomu oscylacyjnego S1 do stanu S0 podstawowego.
Cząsteczka absorbuje kwanty światła, w wyniku czego jest jej dostarczana
energia. Skutkiem takiego procesu jest wejście cząsteczki w stan wzbudzony. Proces pobrania energii w postaci światła przez cząsteczkę zachodzi
bardzo szybko zachodząc w przeciągu około 10-15s. Promieniowanie, które
emituje cząsteczka w procesie świecenia (fluorescencji), zanika praktycznie
natychmiast po odcięciu źródła promieniowania w szybkim czasie około
10-8s [9]. Przechodzenie cząsteczek ze stanu podstawowego do
wzbudzonego i odwrotnie w sposób zarówno promienisty (z emisją
światła) jak i bezpromienisty) przedstawia diagram Jabłońskiego (Rys. 1.)
Rys. 1 Diagram Jabłońskiego, Źródło: Lakowicz J.R., Principles of Fluorescence Spectroscopy.,
Springer, USA 2006
Do przejścia cząsteczki na wyższy poziom oscylacyjno-wibracyjny
w stanie S1 albo S2 dochodzi poprzez absorpcję przez fluorofor kwantu
światła. Do najniższego poziomu energetycznego (stan poziomu
wibracyjnego S1) przechodzi większość molekuł w trakcie procesów
bezpromienistej konwersji wewnętrznej. Jest to czas rzędu 10-12s. Energia
cząsteczki, która znajduje się w stanie singletowym S1 może także
rozproszyć energię w sposób promienisty. Do takich procesów zaliczamy
184
Fluorescencyjna spektroskopia czasowo-rozdzielcza. Proste narzędzie diagnostyczne
fluorescencję, fosforescencję oraz opóźnioną fluorescencję. Do procesów
bezpromienistych zalicza się konwersję wewnętrzną oraz konwersję
międzysystemową [9]. Przejście międzysystemowe zachodzi wówczas,
kiedy będąca w stanie wzbudzonym cząsteczka podda się konwersji do tak
zwanego stanu trypletowego T1. Taka sytuacja zachodzi wówczas, gdy
jedna molekuła zderzy się z inną.
Przejściem cząsteczki ze wzbudzonego stanu trypletowego (T1) do stanu
podstawowego S0, któremu towarzyszy emisja fotonu nazywa się
fosforescencją. Po takim przejściu czas zaniku może trwać długo po
przerwaniu emisji promieniowania wzbudzającego [10, 11].
Energia wytwarzana podczas fluorescencji jest znacznie niższa od tej,
którą początkowo cząsteczka absorbuje. Jest to wynikiem tego, że w trakcie
procesu część energii zostaje pochłonięta przez zjawiska konwersji
wewnętrznej. Takie zjawisko tłumaczy przesunięcie Stokes’a wskazujące
na to, że do utraty energii dochodzi wskutek przesunięcia się widma emisji
w stronę dłuższych fal w porównaniu do fal absorpcji. Istnieją jeszcze inne
procesy powodujące straty energetyczne zalicza się do nich relaksację
rozpuszczalnikową, wygaszanie fluorescencji, a także transfer energii.
Cząsteczka wraca do stanu początkowego po pewnym czasie (czasie życia
fluorescencji) oraz po tzw. wydajności kwantowej. Wydajność kwantowa
w zjawisku fluorescencji jest stosunkiem ilości fotonów jakie cząsteczka
wyemitowała w trakcie promienistego procesu przechodzenia ze stanu S1
do stanu S0 w porównaniu do liczby fotonów jakie ta sama cząsteczka
pochłonęła w momencie absorpcji. Czasem życia fluorescencji (fluorescence
lifetime, FLT), określa się natomiast średni czas, jaki cząsteczka pokonuje
w trakcie wzbudzenia do czasu zanim nastąpi jej powrót do stanu podstawowego. Jeżeli cząsteczka w stanie wzbudzonym zderzy się w trakcie
przebywanej drogi z wygaszaczem, intensywność jej fluorescencji może
znacznie się obniżyć. W trakcie takiego „karambolu” na poziomie
molekularnym, energia z molekuły wzbudzonej przenosi się na wygaszacz
(np. cząsteczka tlenu, amina lub halogenek), który przejmując część energii
ze stanu podstawowego przechodzi w stan wzbudzony [9‚13].
3.3.1. Rezonansowy transfer energii
Rezonansowe przeniesienie energii (Fluorescence Resonance Energy
Transfer, FRET) to mechanizm podczas którego dochodzi do przeniesienia
energii pomiędzy dwoma chromoforami. Cząsteczka, która została
wzbudzona absorbując energię w postaci światła nazywa się donorem,
natomiast molekuła wzbudzona w trakcie bezpromienistego procesu
przekazania energii nazywamy akceptorem. Zajście tego mechanizmu jest
zależne od odległości jaka dzieli akceptor od donora. Jeżeli cząsteczki
znajdują się od siebie w granicach rzędu 2-10nm, a także jeżeli fala
185
Alicja Janicka, Anna Cwynar, Blanka Ziomkowska, Tomasz Wybranowski
emitowana przez molekuły donora nakładają się na siebie z falą
absorpcyjną molekuły akceptora, donor przechodzi do podstawowego stanu
elektronowego, a molekuła która jest akceptorem przechodzi w stan
wzbudzenia. Czas życia donora zmniejsza się, a badacz obserwuje zmianę
pasma emisji molekuły, która została wzbudzona na skutek w procesie
absorpcji światła [14].
3.3.2. Fluorescencyjne właściwości białek
Związki biologiczne takie jak białka, czasami zawierają w swojej
budowie fluorofory, czyli grupy wykazujące zdolność absorpcji energii
o konkretnej długości fali zdolne później oddać tą energię w postaci
sygnału świetlnego. Takie właściwości związków znalazły zastosowanie
w badaniach nad fluorescencją, pełniąc funkcje sondy molekularnej lub
znacznika fluorescencyjnego. W analizach klinicznych to pożądane cechy
pomagające określić lokalizację obszaru patologicznego, który ma zostać
poddany obserwacji. Dzięki znajomości maksimum absorpcji i emisji reszt
aminokwasów fluorescencyjnych oraz np. znajomości wartości referencyjnych czasów życia fluorescencji można dzięki spektroskopii określić np.
poziom uszkodzenia białek spowodowanych działaniem leków czy też np.
nadmiernym wysiłkiem fizycznym [15]. Do grupy substancji, które
posiadają zdolność emisji światła należą takie barwniki jak fluoresceina
oraz rodamina, białka, barwniki pochodzenia roślinnego np. chlorofil
i karotenoidy, poszczególne witaminy oraz hormony takie jak ryboflawina
i kwas foliowy a także kwasy nukleinowe.
Właściwości fluorescencyjne protein wynikają z obecności w ich
łańcuchu aromatycznych reszt aminokwasowych takich jak fenyloalanina,
tyrozyna i tryptofan (Rys. 2.).
Rys. 2. Wzory strukturalne fenyloalaniny, tyrozyny oraz tryptofanu występujących
w białkach i będące chromoforami Źródło: [http://ztibsl.ch.pw.edu.pl/3wm/upl/1361989118.pdf]
186
Fluorescencyjna spektroskopia czasowo-rozdzielcza. Proste narzędzie diagnostyczne
Każdy z przedstawionych powyżej aminokwasów fluoryzuje z zakresie
fali bliskiemu nadfioletowi. Dla fenyloalaniny maksymalna absorpcja
wynosi 260nm, a emisja jest równa 282nm. Tyrozyna charakteryzuje się
nieco niższą energią, maksimum jej absorpcji wynosi 275nm a emisja
304nm. Widmo absorpcji dla tryptofanu sięga najdłuższych fal wynosząc
295nm, a emisji 353nm (Tab.3.) [9].
Tab.3. Maksimum absorpcji oraz maksimum emisji reszt aminokwasów fluorescencyjnych
Maksimum absorpcji
Maksimum emisji
Fenyloalanina
260 nm
282 nm
Tyrozyna
275 nm
304 nm
Tryptofan
298 nm
353 nm
Reszta tryptofanowa odgrywa najważniejszą rolę w absorpcji,
a następnie fluorescencji emitowanej przez białka. Fluorescencja tyrozyny
jest wyciszana w procesie bezpromienistego przeniesienia energii (rezonansowego) pomiędzy tyrozyną i tryptofanem. Fenyloalanina wykazuje się
bardzo niską wartością fluorescencji, która jest możliwa do zaobserwowania prawie wyłącznie w przypadku braku w łańcuchu polipeptydowym tyrozyny i tryptofanu.
Pierścień indolowi, który wbudowany jest w cząsteczkę tryptofanu,
odpowiada za jego fluorescencję. To właśnie od tego fragmentu zależą
właściwości fluorescencyjne chromoforu, a także ładunek sąsiednich reszt
aminokwasów oraz przestrzenna lokalizacja [16]. Jeżeli aminokwas
tryptofanu jest zlokalizowany na powierzchni białka maksimum emisji
światła jest takie jak prezentuje powyższa tabela 3. Jeżeli natomiast reszta
tryptofanowa położona jest wewnątrz cząsteczki białka, maksimum emisji
przesuwa się w kierunku krótszych fal [14, 15].
3.3.3. Spektroskopia czasowo-rozdzielcza
Stosowanie spektroskopii czasowo-rozdzielczej pozwala dokładnie
zmierzyć czas życia fluorescencji. Proces ten polega na wzbudzaniu
badanej próbki energią w postaci fotonów, a następnie rejestracji czasu
w którym dochodzi do zaniku fluorescencji [9]. Natężenia promieniowanego światła maleje wykładniczo wraz z upływem czasu. Ten mechanizm opisywany jest wzorem:
I(t)=I0e –t/ô (1)
187
Alicja Janicka, Anna Cwynar, Blanka Ziomkowska, Tomasz Wybranowski
gdzie:
I0 – natężenie fluorescencji w chwili przerwania wzbudzenia;
η – średni czas życia fluorescencji, po tym czasie natężenie świecenia
próbki maleje e-krotnie;
I(t) – zanik intensywności fluorescencji [16].
3.3.4. Przykłady wykorzystania spektroskopii
Spektroskopia czasowo-rozdzielcza wykorzystywana jest między
innymi do określenia kinetyki dezaktywacji dzięki analizie widm absorbcji
np. kamptotetycyny, związku pochodzenia naturalnego o działaniu
przeciwnowotworowym. Aktywna przeciwnowotworowo w środowisku
alkalicznym laktonowa forma kamptotecyny, wiąże się z albuminą
w osoczu, a poprzez hydrolizę, stopniowo przechodzi w nieaktywną formę
karboksylową. W trakcie tego procesu dzięki obserwacji ewoluujących
widm (forma aktywna przechodzi w formę nieaktywną) możliwe jest
określenie kinetyki dezaktywacji związku [17, 18].
Metody spektroskopowe są także podstawą działania wielu urządzeń
laboratoryjnych. Zasadę ich działania wykorzystuje się m.in. przy analizie
albuminy modyfikowanej niedokrwieniem (IMA, ischemia modified
albumin) jako markera ostrego niedotlenienia mięśnia sercowego.
Praktycznie marker ten oznacza się przy użyciu spektroskopii w teście
wiązaniu kobaltu przez albuminę. Kiedy w surowicy zwiększa się poziom
IMA ilość niezwiązanego kobaltu także się zwiększa, przez co dochodzi do
powstania kompleksu z chromogenem – ditiotreitolem (DTT). Reakcja
barwna oceniana właśnie spektrofotomotrycznie nasila się proporcjonalnie
do stężenia IMA w surowicy. Analiza dokonywana jest przy długości fali
równej 470 nm, a wynik odczytywany jest w standardowych jednostkach
absorbancji [7, 19, 20].
Analiza spektroskopowa wykorzystywana jest także przy diagnostyce
chorób zwyrodnieniowych ośrodkowego układu nerwowego (tzw.
taupatie), które są związane z patologią białka tau. Do taupatii zalicza się
m.in. chorobę Alzheimera, otępienie czołowo-skroniowe, czy też
zwyrodnienie korowo-podstawne. Spektroskopia, którą wykorzystuje się do
badania taupatii jest w stanie wykazać swoiste zaburzenia metabolizmu,
które objawiają się spadkiem stężenia NAA zwłaszcza w stosunku do
stężenia białka kreatyny oraz wysokoenergetycznych związków fosforu.
Stężenie białka tau oceniane spektroskopowo, uznawane jest za marker we
wczesnej diagnostyce procesu zwyrodnieniowego w ośrodkowym układzie
nerwowym [21].
Spektroskopia wykorzystywana jest również w diagnostyce zmian
onkologicznych piersi. Dla przykładu spektroskopia Ramana, przy długości
188
Fluorescencyjna spektroskopia czasowo-rozdzielcza. Proste narzędzie diagnostyczne
fali 514 i 532nm, pozwala odróżnić tkanki o budowie prawidłowej od
tkanek ze zmianami nowotworowymi w zależności od charakterystycznych
drgań karotenoidów, białek, lipidów oraz wody. I tak, zakres drgań dla
lipidów oraz białek mieści się w przedziale 2800-3100cm-1, pasma dla
cząsteczek wody to normy 3258, 3311, 3410cm-1, a dla karotenoidów 1004,
1158, 1518cm-1. Cząsteczki te uznaje się za markery, które pozwalają
(dzięki ustalonym wartościom) odróżnić komórki o budowie prawidłowej
od zmienionych nowotworowo. Dla przykładu uznaje się, że pasmo
3311cm-1 dla cząsteczek wody, jest typowe dla komórek nowotworowych
w ludzkim gruczole piersiowym. Wynika to z większej hydratacji komórek
nowotworowych od komórek niezmienionych. Odpowiednie ich
nawodnienie pobudza procesy dzielenia się, ekspresję onkogenu oraz
dezaktywuje te geny, które są odpowiedzialne za różnicowanie się
komórek. Bogata hydratacja tkanki nowotworowej hamuje także proces
apoptozy, oraz jest proporcjonalna do stopnia złośliwości nowotworu [22].
4. Podsumowanie
Autorzy pracy przedstawili unikalne właściwości białek, które dzięki
obecności aminokwasów takich jak fenyloalanina, tryptofan i tyrozyna
(chromofory) stanowią swoistego rodzaju markery, zdolne do wykrywania
uszkodzeń białek wywołanych przez np. leki, intensywny wysiłek fizyczny
czy też zanieczyszczone środowisko. Do takiej identyfikacji dochodzi na
skutek fotoluminescencji. Badana cząsteczka w pierwszym etapie pobiera
energię w postaci fotonów, a następnie oddaje energię, która mierzona jest
przez intensywność fluorescencji czyli intensywność emitowanego przez
nią światła. W zależności od wspomnianej intensywności świecenia
przedstawionego w postaci wykresu świadczy poziom uszkodzenia białka.
Podane właściwości białek, zwłaszcza białek osocza, sprawiają, że stanowi
ono doskonały materiał do badań. Dokładnie opisano zasadę zajścia
procesu fluorescencji, w wyniku której dochodzi do wejścia cząsteczki
w stan wzbudzony. Autorzy pracy starali się przedstawić spektroskopię
jako wygodną, szybką i niezagrażającą życiu metodę, na której działaniu
oparta jest praca wielu urządzeń diagnostycznych, pomagających
w rozpoznaniu różnego rodzaju schorzeń.
189
Alicja Janicka, Anna Cwynar, Blanka Ziomkowska, Tomasz Wybranowski
Literatura
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
Ponczek M. B., Wachowicz B., Oddziaływanie reaktywnych form tlenu i azotu
z białkami, Postępy Biochem., 2005, 51, 2, 140-145
Berg J., Tymoczko J., Stryer L., Biochemia, PWN, Warszawa 2007
Kłyszejko-Stefanowicz L., Ćwiczenia z Biochemii, PWN, Warszawa 1999
Dembińska-Kieć A., Naskalski J., Diagnostyka laboratoryjna z elementami
biochemii klinicznej, Elsevier Urban & Partner, Wrocław 2010
Gburek J., Gołąb K., Juszczyńska K., Nerkowy katabolizm albuminy – aktualne
poglądy i kontrowersje, Postępy Hig. Med. Dośw., 2011, 65, 668-677
Moriyama Y., Ohta D., Hachiya K., Mitsui Y., Takeda K., Fluorescence behavior
of tryptophan residues of bovine and human serum albumins in ionic surfactant
solutions: a comparative study of the two and one tryptophan(s) of bovine and
human albumins, Journal of Protein Chemistry, 1996, 15, 3, 256-272
Myszka W., Dudziak J., Torliński L., Albumina modyfikowana niedokrwieniemnowy marker biochemiczny niedokrwienia mięśnia sercowego – przegląd wyników
badań klinicznych, Now. Lek.,2006, 75, 2, 174-178
Kordecka M., Piwowar A., Płaskej E., Warwas M., Albumina modyfikowana
niedokrwieniem – specyficzny marker w diagnostyce kardiologicznej?, Wiad.
Lek., 2008, 61, (10-12), 263-268
Lakowicz J.R., Principles of Fluorescence Spectroscopy., Springer, USA 2006
Jóźwiak Z., Bartosz G., Biofizyka. Wybrane zagadnienia wraz z ćwiczeniami,
Wydawnictwo Naukowe PWN, Warszawa 2005
Atkins P. W., Postawy chemii fizycznej, Wydawnictwo Naukowe PWN,
Warszawa 2009
Bartosz G., Druga twarz tlenu, Wydawnictwo Naukowe PWN, Warszawa
2003, 19-120
Kalisz O., Wolski T., Gerkowicz M., Smorawski M., Reaktywne formy tlenu
(RFT) oraz ich rola w patogenezie niektórych chorób, Annales Veterinaria,
2007, 62, 87-99
Suppan P., Chemia i światło, tł. J. Prochorow, Wydawnictwo naukowe PWN,
Warszawa 1997
Paszyc S., Podstawy fotochemii, Wydawnictwo Naukowe PWN, Warszawa 1992
Bryszewska M., Leyko W., Biofizyka dla biologów, Wydawnictwo Naukowe
PWN, Warszawa 1997
Kruszewski S., Ziomkowska B., Cyrankiewicz M., i in., Kinetyka dezaktywacji
kamptotecyny określana metodą analizy ewoluujących widm absorpcji,
Annales Academiae Medicae Bydgostiensis, 2004, 18/3, 53-57
Ziomkowska B., Kruszewski S., Siuda R., Cyrankiewicz R., Deactivation rate
of camptothecin determined by factor analysis of steady-state fluorescence and
absorption spectra, Optica Applicata, Vol. XXXVI, No.1,2006
Malczewska-Malec M., Kieć-Wilk B., Leszczyńska-Gołąbek I. i wsp.,
Albumina modyfikowana niedokrwieniem jako marker choroby
niedokrwiennej, Kardiologia Polska 2009; 67 (supl.6): 441-448
Birkner K., Hudzik B., Poloński L., Nowe potencjalne markery w chorobie
wieńcowej, Folia Cardiologica Excerpta 2011, 6;2, 144-151
190
Fluorescencyjna spektroskopia czasowo-rozdzielcza. Proste narzędzie diagnostyczne
21. Pokryszko-Dragan A., Zagrajek M. M., Słotwiński K., Taupatie – choroby
zwyrodnieniowe ośrodkowego układu nerwowego związane z patologią białka
tau, Postępy Hig. Med. Dośw., 2005;59: 386-391
22. Brożek-Płuska B., Metody spektroskopowe w diagnostyce zmian
nowotworowych ludzkiego gruczołu piersiowego, Zeszyty naukowe nr 1157,
Wydawnictwo Politechniki Łódzkiej, Łódź 2013
Fluorescencyjna spektroskopia czasowo-rozdzielcza. Proste narzędzie
diagnostyczne
Spektroskopia czasowo-rozdzielcza wykorzystywana była już od dawna. To prosta
i nieskomplikowana metoda, która opiera się na analizie światłem. W przyrodzie istnieje wiele
związków zdolnych do pobrania energii i oddania jej w postaci emisji światła. Do takich
związków zaliczyć można białka. To cecha wynikająca z obecności fenyloalaniny, tryptofanu
i tyrozyny, które stanowią swoistego rodzaju marker. Głównym białkiem osocza jest albumina,
która posiada w swoim składzie tryptofan. Badanie osocza metodą spektroskopową jest
małoinwazyjną metodą badawczą.
Time-resolved fluorescence of spectroscopy. A simple diagnostic tool
Time-resolved spectroscopy has been used for a long time. This is a simple and uncomplicated
method, which is based on the analysis of light. In the nature there are many compounds which
are able to absorb energy and emit it in the form of light emission. Proteins are an example of
such compounds. It is characteristic of the presence of phenylalanine, tryptophan and tyrosine,
which are a kind of marker. The main plasma protein is albumin, which also contains
a tryptophan. The study plasma spectroscopy method is minimally invasive research method.
191
Alicja Janicka1, Anna Cwynar2, Blanka Ziomkowska3, Joanna Sikora4
Fotoluminescencja – proste narzędzie analizy
wpływu pH na aktywność przeciwnowotworową
pochodnych kamptotecyny
1. Wprowadzenie
Co roku na nowotwory choruje oraz umiera coraz większa liczba osób.
Dzięki rozwojowi medycyny i technologii średnia długość życia
społeczeństwa wzrasta, a co za tym idzie rozwijający się i dłużej żyjący
człowiek, wykazuje się zwiększoną podatnością na choroby nowotworowe.
Czynniki takie jak zanieczyszczone środowisko, palenie tytoniu, ale także
niewłaściwa dieta oraz styl życia są przyczynami wzmożonej zachorowalności. W przeciągu 10-lecia począwszy od roku 2000, zarejestrowany
został spadek zgonów z powodu nowotworów tylko o 10%, podczas gdy
obniżenie śmiertelności z powodu chorób układu krążenia zmniejszono
o 30% [1]. Choroby nowotworowe są ogromnym problemem, ponieważ
mimo rozwoju medycyny oraz ciągłego udoskonalania technik ich
wykrywania są wciąż w dużej mierze uznawane za choroby nieuleczalne.
Grupy naukowców na świecie nieustannie opracowują nowe leki mogące
okazać się antidotum na choroby nowotworowe. Obecnie za jedną
z potencjalnych substancji uznawanych za antynowotworowe uznaje się
kamptotecynę wraz z jej pochodnymi. Właściwości związku wynikają
prawdopodobnie z mechanizmu jego działania, w trakcie którego dochodzi
do inhibicji topoizomerazy I [2].
2. Cel pracy
Celem niniejszej pracy jest zwrócenie uwagi czytelnika na możliwość
wykorzystania prostych metod spektroskopowych do analizy aktywności
przeciwnowotworowej związków kamptotecyny, których dobroczynne
właściwości są zależne od środowiska pH, w jakim się znajdują.
1
[email protected], Collegium Medicum w Bydgoszczy, Wydział Farmaceutyczny,
Studenckie Koło Naukowe Biofizyki przy Zakładzie Biofizyki
2
[email protected], Collegium Medicum w Bydgoszczy, Wydział Farmaceutyczny, Katedra
i Zakład Patobiochemii i Chemii Klinicznej
3
[email protected], Collegium Medicum w Bydgoszczy, Wydział Farmaceutyczny, Katedra
i Zakład Biofizyki
4
[email protected], Wydział Lekarski, Katedra Farmakologii i Terapii
192
Fotoluminescencja – proste narzędzie analizy wpływu pH
na aktywność przeciwnowotworową pochodnych kamptotecyny
3. Omówienie
W obecnej dobie nauki oczywistym wydaje się fakt, że wartości pH
(potencjał wodorowy) w organizmie ludzkim są zmienne w zależności od
zajmowanego obszaru. Okazuje się jednak, że wiedza ta z medycznego
punktu widzenia może mieć ogromne znaczenie w leczeniu nowotworów.
Zdrowe komórki występujące w organizmie ludzkim posiadają pH
w granicach ok. 7,2. Podobnie jeżeli chodzi o krew. Wartość pH dla krwi
ludzkiej u zdrowego człowieka kształtuje się między 7,35 a 7,45.
Niemiecki biochemik Otto Heinrich Warburg dokonał ciekawego odkrycia.
Otóż wnętrze komórek nowotworowych posiada środowisko, którego punkt
pH wynosi ok. 6,8, a więc jest nieznacznie przesunięte w stronę środowiska
kwaśnego [2]. Taka zmiana we wnętrzu komórek nowotworowych
dokonuje się poprzez produkcję kwasu mlekowego, która jest wynikiem
niewłaściwie zachodzącego szlaku glikolizy oraz wysokiego poziomu
dwutlenku węgla. Wysokie stężenie CO2 wewnątrz komórek nowotworowych jest spowodowane małym ich dotlenieniem, a więc także ich
słabym ukrwieniem. Wynikiem tych spostrzeżeń było odkrycie, że komórki
nowotworowe, którym zostanie stworzone środowisko alkaliczne nie są
zdolne do przetrwania w nim [3].
W niniejszej pracy fotoluminescencja została okrzyknięta mianem
narzędzia. Takie sformułowanie jest w pełni uzasadnione. Światło posiada
zdolność do oddziaływania z różnymi układami molekularnymi, także
z tkankami czy cząsteczkami np. we krwi czy osoczu. W wyniku tych
oddziaływań zachodzą takie procesy jak rozpraszanie, skupianie,
fotoluminescencja, absorpcja itd. Na podstawie unikatowego zachowania
światła po jego zetknięciu się z układem molekularnym, można uzyskać
informacje na temat różnego rodzaju właściwości badanego obszaru czy
związku [25].
3.1. Kamptotecyna
Kamptotecyna jest naturalnym roślinnym związkiem wywodzącym się
z drzewa Camptotheca acuminata (japońska nazwa to xi shu – drzewo
szczęścia).
Dobroczynne właściwości antynowotworowe kamptotecyny od
dawnych czasów wykorzystywali już Chińczycy między innymi w leczeniu
białaczki [4]. Kamptotecyna jest alkaloidem i została wyizolowana w 1966
r. podczas, gdy jej właściwości przeciwnowotworowe zostały potwierdzone
8 lat wcześniej przez Monroe E. Walla i Jonathana Hartwella.
Wyizolowany alkaloid używany był w leczeniu nowotworów przewodu
pokarmowego w latach 70-tych, jednak musiano zaprzestać tych praktyk
z powodu występujących biegunek oraz krwotocznego zapalenia pęcherza [5].
193
Alicja Janicka, Anna Cwynar, Blanka Ziomkowska, Joanna Sikora
Z chemicznego punktu widzenia pięciocykliczną cząsteczkę kamptotecyny można podzielić na trzy części: część chinolinowa, indolizynowa,
a także część α-hydroksylaktonowa. Zależnie od środowiska w jakim
obecnie znajduje się cząsteczka, może dojść do zamknięcia lub otworzenia
się pierścienia α-hydroksylaktonowego (Rys. 1). W przyrodzie wyróżnia się
dwie formy kamptotecyny: laktonową – stabilną w środowisku kwaśnym,
gdzie wartości pH nie przekraczają 5,5 oraz formę karboksylową stabilną
w pH powyżej 9, w którą do przekształcenia dochodzi w środowisku
o wyższym pH. Pierwsza z wspomnianych warunkuje właściwości
przeciwnowotworowe związku, gdzie pierścień jest zamknięty. Forma
karboksylowa natomiast, do której przekształcenia dochodzi w wyniku
hydrolizy z formy laktonowej jest nieaktywną chemoterapeutyczną postacią
związku, w której pierścień ulega otworzeniu [6]. Mimo niestabilności
formy laktonowej i szybkiego jej przechodzenia w środowisku
fizjologicznym do formy karboksylowej działanie przeciwnowotworowe
kamptotecyny jest niepodważalne i w latach 80’ ponowiono badania nad
tworzeniem leków kamptotecynopochodnych, których celem jest
utworzenie kompleksu topoizomeraza I – DNA [7].
Rys. 1. Wzory strukturalne formy laktonowej i karboksylowej kamptotecyny [23]
3.2. Topoizomeraza I i jej inhibitory
Życie komórki oraz prawidłowe funkcjonowanie kwasu deoksyrybonukleinowego jest zapewniane przez enzymy jądrowe czyli topoizomerazy.
Niezwykły mechanizm działania tych enzymów polega na wprowadzaniu
oraz usuwaniu tak zwanych superskrętów DNA. W topoizomerazie
194
Fotoluminescencja – proste narzędzie analizy wpływu pH
na aktywność przeciwnowotworową pochodnych kamptotecyny
występującej w organizmie ludzkim wyróżnia się 4 domeny otaczające
centralne zagłębienie, w której wnętrzu znajduje się reszta aminokwasu
tyrozyny (tyr 723). Rola tyrozyny polega na przecięciu DNA w reakcji
katalizowanej przez topo I [8]. Cząsteczka DNA wiąże się z wewnętrzną
częścią zagłębienia enzymu, w trakcie której grupa –OH tyr723 działa na
jedną z nici DNA z grupą fosforanową w wyniku czego dochodzi do
powstania wiązania fosfodiestrowego enzym-DNA. Rozcięta dzięki zajściu
tego procesu cząsteczka DNA uwalnia jedną z grup OH 5’, po czym dzięki
energii z superhelikalnych skrętów może dojść do skrętu nici wokół
nieprzeciętego łańcucha. Poprzez taką rotację DNA superskręty zostają
wyeliminowane. To właśnie topoizomeraza I stoi na straży szybkości
rotacji, dokładnie kontrolując w ten sposób zajście procesu, a kiedy już
aktywowana reszta tyrozynowa powraca do formy początkowej
topoizomeraza odłącza się od DNA [9].
Działanie inhibitorów topoizomerazy I, w tym kamptotecyny i jej
pochodnych, polega na wiązaniu się w kompleks DNA-topo I oraz jego
stabilizacji. Dzięki nim hamowana jest ponowna ligacja rozdzielonych już
nici jednak sam proces rozdzielania nie jest zakłócany, co w efekcie
doprowadza do nagromadzania się pęknięć w DNA. Te jednoniciowe
pęknięcia nie szkodzą samej komórce i są odwracalne o ile nie dojdzie
jednak do spotkania się widełek replikacyjnych z uszkodzoną nicią kwasu
deoksyrybonukleinowego. Jeżeli jednak takie zetknięcie nastąpi, dojdzie do
trwałego uszkodzenia obu nici DNA doprowadzając do śmierci komórki.
Na podstawie takiego działania inhibitorów topoizomerazy można
stwierdzić, że są one terapeutykami dla fazy S cyklu komórkowego pełniąc
rolę cytostatyczną w trakcie zachodzącej syntezy DNA [5].
3.3. Pochodne kamptotecyny wykorzystywane w lecznictwie
Topotekan to pochodna kamptotecyny rozpuszczalna w wodzię dzięki
przyłączeniu w pozycji 9-C grupy N,N-dimetyloaminometylowej (Rys. 2)
[10]. Topotekan jest wykorzystywany w leczniu m.in. raka jajnika,
drobnokomórkowego raka płuc, a także raka szyjki macicy [11]. Dużą
zaletą tego związku jako leku (np. Hycamtin w postaci chlorowodorku
topotekanu), jest jego nienagromadzanie się w organizmie człowieka dzięki
krótkiemu okresowi półtrwania. Niestety jak każdy lek tak i topotekan
powoduje skutki uboczne do których zalicza się m.in. gorączkę,
krwiomocz, wymioty, bięgunkę oraz neutropenię [12].
195
Alicja Janicka, Anna Cwynar, Blanka Ziomkowska, Joanna Sikora
Rys. 2. Wzór strukturalny topotekanu [24]
Irinotekan (SN-38) jest kolejną pochodną kamptotecyny. W pozycji
C-10 grypy karbonylowej przyłączony jest fragment bispiperydynowy (Rys.
3). Enzym karboksyesterazy hydrolizuje grupę karboksypiperydynową do
powstania 7-etylo-10-karboksybispiperydyny SN-38 która jest aktywnym
metabolitem irynotekanu. Tak powstały związek wykazuje silne działanie
przeciwnowotworowe jako inhibitor topoizomerazy I [10]. Lek stosowany
jest w leczeniu nowotworów płuc (rak drobnokomórkowy i nie
drobnokomórkowy), okrężnicy i odbytnicy, ale także jako skuteczny
terapeutyk w leczeniu raka piersi, jajników, szyjki macicy nowotworach
złośliwych szyi i głowy oraz wielu innych [12]. Powstały SN-38 jest silnie
lipofilny, jego okres półtrwania jest dłuższy niż w postaci topotekanu
i aktualnie jest stosowany w terapii skojarzonej z cisplatyną [11].
Rys. 3. Wzór strukturalny irinotekanu [24]
196
Fotoluminescencja – proste narzędzie analizy wpływu pH
na aktywność przeciwnowotworową pochodnych kamptotecyny
3.4. Kamptotecyna a albumina
Albumina to przeważające ilościowo białko osocza (ok. 60%), jej
prawidłowe stężenie w organizmie ludzkim wynosi 34-47g/l, a masa
cząsteczkowa to ok. 69 kDa. Białko to charakteryzuje elipsoidalny kształt.
Taka cecha powoduje, że lepkość osocza nie zwiększa się przez co
transport białka w krwioobiegu jest łatwy. Dodatkowym atutem jest
znaczna ilość aminokwasów polarnych z hydrofilnymi grupami takimi jak
grupa hydroksylowa, tiolowa, aminowa i karboksylowa, dzięki czemu
albumina jest dobrze rozpuszczalna w wodzie i osoczu [13]. Głównym
organem, który syntezuje albuminę jest wątroba (ok. 8-14g białka na dobę).
Łącznie jest to w przybliżeniu 25% całej ilości albuminy. W początkowym
etapie reakcji dochodzi do syntezy tego białka jako preproteiny, dochodzi
do usunięcia peptydu sygnalnego w procesie jego przejścia do tak zwanych
cystern w szorstkiej siateczce śródplazmatycznej. W związku z tym, że to
właśnie wątroba jest głównym organem syntezy albumin wiele chorób
dotyczących tego organu charakteryzuje się ogólnym zmniejszeniem białka
w osoczu ludzkim [14].
Albumina zbudowana jest z 585 reszt aminokwasowych oraz zawiera
17 mostków disiarczkowych. Dzięki enzymom tnącym białka tzw.
proteazą, można wyodrębnić 3 główne domeny tego białka pełniące różne
funkcje. Zarówna pierwsza, druga jak i trzecia domena dzieli się na 2
części (poddomeny) co wyjaśnia możliwość wiązania się z albuminą wielu
różnych cząsteczek [15]. W organizmie ludzkim białko to w dużej mierze
jest białkiem transportowym, przenosząc między innymi jony wielu
różnych metali takich jak na przykład jony miedzy czy wapnia (połowa
Ca2+ znajdującego się w organizmie człowieka jest związanych z albuminą), ale również i z wolnymi kwasami tłuszczowymi wywodzących się
z adipocytów (komórek tłuszczowych) transportując je do różnych tkanek.
Albumina ma zdolność do wiązania wielu leków w tym do wiązania się
z kamptotecyną i jej pochodnymi, silnie wpływając przy tym na jej
skuteczność działania oraz farmakokinetykę [15]. Znając właściwości
kamptotecyny oraz działanie formy karboksylowej oraz laktonowej wiemy
już, że ta pierwsza ma większe powinowactwo do wiązania się
w fizjologicznych warunkach (chodzi tu o warunki pH) z albuminą niż
forma laktonowa co ma znaczenie w jej przeciwnowotworowym działaniu.
Mimo, że w warunkach in vitro badacze są w stanie w prosty sposób
doprowadzić do przejścia z formy karboksylowej do formy laktonowej i na
odwrót (zmiana warunków pH), w organizmie ludzkim proces ten jest
niemożliwy ze względu na to, że w osoczu w którym znajduje się
albumina, dochodzi tylko do procesu hydrolizy (Rys. 4.)
197
Alicja Janicka, Anna Cwynar, Blanka Ziomkowska, Joanna Sikora
Rys.4. W warunkach fizjologicznych forma laktonowa przechodzi w formę karboksylową.
Wykres pokazuje jak we krwi zmniejsza się stężenie formy laktonowej [25]
Ze względu na niemożność zajścia w takich warunkach laktonizacji, jest
to proces nieodwracalny. Po mniej więcej 120 minutach od wprowadzenia
kamptotecyny w formie laktonowej do roztworu z albuminą, aktywna
przeciwnowotworowo jej postać w procesie hydrolizy zanika. Z powyższego
procesu można wywnioskować, że najistotniejsze dla długotrwałego
działania leku jest jak najdłuższe utrzymanie jego odpowiedniego stężenia
w organizmie pacjenta w postaci niezwiązanej z białkiem. Tylko to
gwarantuje farmakologiczną aktywność i działanie przeciwnowotworowe.
O ile w warunkach in vitro jest to stosunkowo proste ze względu na
operowanie zmianą pH, o tyle in vivo jest to utrudnione ze względu na
zachowanie homeostazy i pH fizjologicznego. To właśnie w związku z tym
poszukiwane były wcześniej wspomniane związki pochodne kamptotecyny
(topotekan,
irinotekan),
stabilne
w warunkach
fizjologicznych,
o zachowanych właściwościach przeciwnowotworowych, łatwo wiążące się
z obszarem zmienionym nowotworowo [6, 13, 22].
198
Fotoluminescencja – proste narzędzie analizy wpływu pH
na aktywność przeciwnowotworową pochodnych kamptotecyny
3.5. Fotoluminescencja
Czym jest fotoluminescencja najlepiej w sposób graficzny opisuje
schemat Jabłońskiego, przedstawiający procesy fizyczne zachodzące
w cząsteczce, która to oddziałuje z fotonami (Rys. 5.). Schemat w prosty
sposób demonstruje tak zwane stany elektronowe cząsteczki zarówno
trypletowe jak i singletowe oraz wskazuje przepływ energii z jednego do
drugiego i odwrotnie. Najczęściej schemat wykorzystuje się do
przeanalizowania fluorescencji oraz fosforescencji czyli tak zwanej
luminescencji [16].
Rys. 5. Diagram Jabłońskiego (wg Lakowicz 2006) [19]
Fluorochrom – jego mianem nazywamy cząsteczkę, która jest zdolna do
emitowania światła, po uprzednim pobraniu energii. W początkowym
stadium (to znaczy w stanie podstawowym) cząsteczka znajduje się
w stanie singletowym (na rysunku 5 oznaczony jako S0). Działająca na
cząsteczkę odpowiednio duża energia powoduje jej przejście na wyższy
stan, także singletowy. Foton jest absorbowany z bardzo dużą szybkością
rzędu nawet 10-15s [16]. Istnieje reguła mówiąca o tym że elektrony mogą
przechodzić miedzy stanami, których multipletowość jest taka sama.
Diagram Jabłońskiego ma na celu łatwiejsze wyróżnienie oraz
zademonstrowanie zjawisk fizycznych, które przebiegają we wnętrzu
cząsteczki już po zaabsorbowaniu przez nią fotonów. W tym miejscu
należy zaznaczyć, że do takich procesów oprócz wymienionych powyżej
zjawisk fotoluminescencji czyli fosfore- i fluorescencji zalicza się także tak
zwane procesy bezpromieniste. Konwersja wewnętrzna to proces
bezpromienisty dotyczący zarówno przejść międzysystemowych czyli
przejścia między stanami o innej multipletowości, oraz przejść
elektronowych między stanami gdzie multipletowość jest taka sama [16].
199
Alicja Janicka, Anna Cwynar, Blanka Ziomkowska, Joanna Sikora
Analizując diagram Jabłońskiego należy zwrócić uwagę na dwa terminy
dotyczących rodzajów fotoluminescencji. Fluorescencja wiąże się z przejściem ze stanu S1 do S0, w trakcie czego dochodzi do „wyświecenia”.
W trakcie fosforescencji cząsteczka przechodzi ze stanu T 1 do stanu S0.
Różnica występuje także w czasie opóźnienia świecenia od momentu
absorbancji fotonu. Dla fluorescencji jest to czas rzędu 10-8s, gdzie
fosforescencja potrzebuje nawet do kilku sekund. Jest to związane z czasem
życia cząsteczki w stanie S i T [17, 18, 19].
3.6. Fluorescencja, a określanie właściwości kamptotecyny
Spektroskopowe pomiary czasu życia fluorescencji, pomiary zaników
anizotropii fluorescencji oraz analizy widm fluorescencji kamptotecyny są
bardzo istotne w badaniach właściwości nad aktywnością kamptotecyny
zależną od pH, w jakim się znajduje. Na podstawie wyników tych analiz
można dowiedzieć się, co dzieje się z cząsteczką w czasie życia stanu
wzbudzonego, po czym możliwe jest określenie miejsca, w jakim znajdują
się fluoryzujące cząsteczki i czy są one wolne czy związane oraz
określenie, jaki jest współczynnik powinowactwa kamptotecyny do białek
czy błon komórkowych.
Im większe powinowactwo pochodnych kamptotecyny do tkanki, tym
większe ich właściwości przeciwnowotworowe. Wynika to z faktu, że
w organizmie związki kamptotecyny w formie laktonowej (forma stabilna
w środowisku kwaśnym) ulegają hydrolizie do formy karboksylowej (pH
zasadowe), natomiast co ciekawe laktonowa forma, która uległa już
związaniu z błoną nie ulega przemianie do formy nieaktywnej nowotworowo. Przed taką kumulacją cząsteczek aktywnych w tkance zmienionej, może jednak dojść do trwałego związania się kamptotecyny z albuminą we krwi co spowoduje zmniejszenie się ilości formy laktonowej zanim
dotrze ona do miejsca docelowego, w którym ma się nagromadzić [19, 25].
4. Podsumowanie
Światło jest cennym narzędziem badawczym. Opisany przypadek jego
wykorzystania jest dobrym przykładem na używanie światła w badaniach
farmaceutyków. Zjawiska fotoluminescencji towarzyszące działaniu
światła są w stanie dostarczyć badaczowi istotnych informacji na temat
analizowanego związku czy tkanki, z których można wyczytać tak jak
w przypadku kamptotecyny zależność kamptotecyny od środowiska pH
w jakim się znajduje na jej działanie przeciwnowotworowe [25].
Z niniejszej pracy jasno wynika, że w pH oscylującym wokół 6,8
hydroliza aktywnej przeciwnowotworowo formy laktonowej kamptotecyny
zachodzi wolniej. Adams i in. [2] w swojej publikacji tłumaczą ten
200
Fotoluminescencja – proste narzędzie analizy wpływu pH
na aktywność przeciwnowotworową pochodnych kamptotecyny
wolniejszy proces uwodnienia cząsteczki w takich warunkach środowiskowych jej budową. W pH powyżej 7 dochodzi do otworzenia się
pierścienia E, co jak już wiemy prowadzi do unieaktywnienia czynnej
antynowotworowo postaci związku. Istnieją liczne doniesienia wskazujące,
że hydroliza procesu zachodzi tym szybciej im wyższe jest pH [2],
a metody pomiaru fotoluminescencji są w stanie bardzo dokładnie (poprzez
np. pomiar widm absorbcji) określić m.in. czy w danym pH, pochodna
kamptotecyny jest aktywna przeciwnowotworowo oraz czy związała się
z obszarem patologicznym [6, 20, 21].
Literatura
Dane statystyczne dotyczące przyczyn zgonu, 2012,
http://ec.europa.eu/eurostat/statisticsexplained/index.php/Causes_of_death_statistics/pl, data wejścia na stronę
2. Adams D. J., Wahl M. L., Flowers J. L., Sen B., Colvin M., Dewhirst M. W.,
Manikumar G., Wani M. C., Camptothecin analogs with enhanced activity
against human breast cancer cells. II. Impact of the tumor pH gradient,
Cancer Chemother Pharmacol 2006; 57 145-154
3. Dr Otto Heinrich Warburg o głównej przyczynie powstawania nowotworów,
CudpH, http://cudph.pl/dr-otto-heinrich-warburg-o-glownej-przyczyniepowstawania-nowotworow
4. Van Wyk B. E., Wink M., Rośliny lecznicze świata. Ilustrowany przewodnik,
MedPharm Polska, Wrocław 2008, 76
5. Brunton L. L. i in., Analogi kamptotecyny, Farmakologia Goodmana
i Gilmana, Tom II, Wydawnictwo Czelej, Lublin 2007, 1450-1453
6. Ziomkowska B., Kruszewski S., Cyrankiewicz M., Stolarska P., Siepielska A.,
Badanie oddziaływania kamptotecyny i 7-etylo-10-hydroksykamptotecyny
z białkami osocza metodą pomiaru anizotropii fluorescencji, Medical and
Biological Sciences, 2007, 21 (4) 127-132
7. Perry M. C., The chemotherapy source book, Williams & Wilkins, Baltimore
1996, 425
8. Berg J. M. i in., Topoizomerazy przygotowują podwójną helisę DNA do
rozplecenia, Biochemia, Wydawnictwo Naukowe PWN, Warszawa 2011, 794
9. Berg J. M. i in., Topoizomerazy typu I odpowiadają za relaksację struktur
superhelikalnych, Biochemia, Wydawnictwo Naukowe PWN, Warszawa
2011, 794-795
10. Cragg G. M. i in., Anticancer agents from natural products, CRC Press, Boca
Raton FL 2012, 6-16
11. Katzung B. G. i in., Farmakologia ogólna i kliniczna, Wydawnictwo Czelej,
Lublin 2012, 1096
12. Kostowski W., Herman Z. S., Inhibitory topoizomerazy, Farmakologia.
Podstawy farmakoterapii, Tom II, Wydawnictwo Lekarskie PZWL, Warszawa
2008, 423-425
1.
201
Alicja Janicka, Anna Cwynar, Blanka Ziomkowska, Joanna Sikora
13. Bańkowski E., Biochemia. Podręcznik dla studentów studiów licencjackich
i magisterskich, MedPharm Polska, Wrocław 2014, 36
14. Murray R. K. i in., Albumina jest głównym białkiem ludzkego osocza, Biochemia
Harpera, Wydawnictwo Lekarskie PZWL, Warszawa 2002, 924-925
15. Davidson V. L., Sittman D. B., Biochemia, Urban & Partner, Wrocław 2002, 44
16. Ślusarek G., Fluorescencja i fosforescencja, Biofizyka molekularna, Red.
Grajkowska B., Wydawnictwo Naukowe PWN, Warszawa 2011, 464-465
17. Jaroszyk F., Zjawiska fizyczne zachodzące w cząsteczkach wzbudzonych.
Fotoluminescencja. Schemat Jabłońskiego, Biofizyka, Wydawnictwo
Lekarskie PZWL, Warszawa 2011, 783-786
18. Jóźwiak Z., Bartosz G., Polaryzacja fluorescencji, Biofizyka. Wybrane
zagadnienia wraz z ćwiczeniami, Wydawnictwo Naukowe PWN, Warszawa
2008, 136-137
19. Lakowicz J. R., Principles of Fluorescence Spectroscopy, Kluwer Academic
/Plenum Publishers, New York 1999, 303-304
20. Mi Z., Burke T. G., Differential Interactions of Camptothecin Lactone and
Carboxylate Forms with Human Blood Components, Biochemistry, 1994, 33
10325-10336
21. Ziomkowska B., Cyrankiewicz M., Kruszewski S., Hydroxycamptothecin
Deactivation Rates and Binding to Model Membranes and HSA Determined by
Fluorescence Spectra Analysis, Combinatorial Chemistry & High Throughput
Screening, 2007, 10 (6) 459-465
22. Ziomkowska B., Kruszewski S., Siuda R., Cyrankiewicz M., Określenie
kinetyki dezaktywacji kamptotecyny metodą analizy ewolucji czasowej widm
absorbancji i fluorescencji, XIII Krajowa Konferencja Naukowa
"Biocybernetyka i inżynieria biomedyczna". Gdańsk, 10-13 IX 2003. T. 2.
Biopomiary. Red. A. Nowakowski, [B.m., 2003] s. 1156-1161
23. Ziomkowska B., Cyrankiewicz M., Kruszewski S., Determination of
Hydroxycamptothecin Affinities to Albumin and Membranes by Steady-State
Fluorescence Anisotropy Measurements, Combinatorial Chemistry & High
Troughput Screening 2007, 10, 486-492
24. Naumczuk B., Synteza I badanie właściwości chemicznych I biologicznych
potencjalnych inhibitorów topoizomerazy I oddziaływujących z oligomerami
DNA, Praca przedstawiona Radzie Naukowej Instytutu Chemii Organicznej
Polskiej Akademii Nauk w celu uzyskania stopnia doktora nauk chemicznych,
Warszawa 2015
25. Kruszewski S., Zastosowanie zjawisk fotoluminescencji w badaniach
farmaceutycznych oraz w diagnostyce i terapii przeciwnowotworowej, Wykład
wygłoszony podczas Ogólnopolskiego Dnia Nauki 2005, Wiadomości
Akademickie 19, 2005
202
Fotoluminescencja – proste narzędzie analizy wpływu pH
na aktywność przeciwnowotworową pochodnych kamptotecyny
Fotoluminescencja – proste narzędzie analizy wpływu pH na
aktywność przeciwnowotworową pochodnych kamptotecyny
Kamptotecyna jest alkaloidem pochodzącym z drzewa Camptotheca acuminata. Ta substancja
należy do inhibitorów topoizomerazy I. Kamptotecyna ze względu na działania niepożądane nie
jest wykorzystywana w lecznictwie bezpośrednio, ale za pomocą pochodnych takich jak
irynotekan czy topotekan. Działanie przeciwnowotworowe pochodnych kamptotecyny jest
zależne od pH, w jakim się znajdują. Dzięki fotoluminescencji, możliwe jest zbadanie aktywności
kamptotecyny.
Photoluminescence – a simple tool to analyze the impact of pH on the
antitumor activity of camptothecin derivatives
Camptothecin it is an alkaloid which is produced of the Camptotheca acuminate tree. This
substance belongs to the inhibitors of topoisomerase I. The Camptothecin has many adverse drug
reactions and is not used in therapeutics directly, but with using its derivatives such as irinotecan
and topotekan. The antitumor effect of camptothecin derivatives is dependent on the pH at which
they are located. By the photoluminescence, to research the activity of camptothecin it is possible.
203
Arkadiusz Goede1, Maciej Gawroński2, Tomasz Wandtke3
Technika DNA origami
– potencjalne zastosowania
1. Wprowadzenie
DNA przez wzgląd na swoje cechy takie jak: rozpoznawanie molekularne,
programowalność, prostota syntezy, zdolność do samoorganizacji, oraz
łatwość przewidzenia struktury w nanoskali, wydaje się być wspaniałą
molekułą umożliwiającą tworzenie złożonych struktur dwu i trójwymiarowych.
Nanotechnologia DNA wykorzystuje w dużej mierze zasadę samoistnego
łączenia się dwóch pojedynczych nici DNA w podwójną helisę za pomocą
wiązań między komplementarnymi parami zasad. Wiązanie się adeniny
wyłącznie z tyminą i cytozyny z guaniną pozwala na programowanie procesu
budowy struktur z DNA. Podwójna helisa DNA natywnie posiada liniową
nierozgałęzioną topologię umożliwiającą powstanie wyłącznie struktur
jednowymiarowych [1]. Jednakże porównując liniową, nierozgałęzioną
strukturę cząsteczki DNA z cząsteczką, która ma np. jedno rozgałęzienie
można zauważyć podobieństwo. Każda ze wspomnianych cząsteczek posiada
100% sparowanych komplementarnie ze sobą zasad. Jedyną różnicą jest
występowanie w rozgałęzionej cząsteczce dodatkowego ramienia, które może
mieć dowolną długość – (Rysunek 1).
Dodatkowe ramie nie wpływa jednak w żaden sposób na komplementarność pomiędzy pierwszą a drugą nicią DNA, jednakże replikacja takiej
cząsteczki przez polimerazę DNA jest nieskuteczna. Rozgałęzione cząsteczki
DNA nie są tylko wytworem sztucznym. Rozgałęzione struktury kwasu
nukleinowego naturalnie występują i są używane, głównie jako nietrwałe
półprodukty w procesach replikacji, rekombinacji i naprawy.
1
[email protected], Zakład Genoterapii, Wydział Lekarski, Uniwersytet Mikołaja
Kopernika, Collegium Medicum im. Ludwika Rydygiera w Bydgoszczy, http://www.cm.umk.pl
2
[email protected], Studenckie Koło Naukowe Terapii Genowej, Zakład Genoterapii,
Wydział Lekarski, Uniwersytet Mikołaja Kopernika, Collegium Medicum im. Ludwika
Rydygiera w Bydgoszczy, http://www.cm.umk.pl
3
[email protected]; Zakład Genoterapii, Wydział Lekarski, Uniwersytet Mikołaja
Kopernika, Collegium Medicum im. Ludwika Rydygiera w Bydgoszczy, http://www.cm.umk.pl
204
Technika DNA origami – potencjalne zastosowania
Rysunek 1. Porównanie natywnej dwuniciowej liniowej cząsteczki DNA (a) z cząsteczką DNA
rozgałęzioną (b) [2]
2. Początek nanotechnologii DNA – badania Seeman’a
Seeman jako pierwszy zdał sobie sprawę z możliwości wytworzenia
sztucznych punktów rozgałęzień DNA. Obserwacja DNA podczas jego
kopiowania w czasie podziału komórkowego była krokiem milowym dla
Seeman’a. Podczas powielania materiału genetycznego podwójna nić DNA
może się częściowo rozszczepić i przyłączyć komplementarnie do innej
nici DNA. W taki sposób naturalnie powstaje punkt rozgałęzienia,
a powstała cząsteczka nie wykazuje już liniowej topologii. Struktury
wytworzone podczas badań Seeman’a były raczej niewielkie. Budowa
nowych struktur wymagała żmudnego projektowania, a później syntezy
wszystkich składowych nici DNA. Ograniczenie stanowiło również
wykorzystanie syntezatorów DNA mogących produkować nici DNA
o długości dochodzącej tylko do setek par zasad. Jest to niestety
niewystarczające do wytworzenia dużych, wielowymiarowych i złożonych
struktur DNA [3].
Początkowe próby użycia molekuł DNA o pojedynczym punkcie
łączenia nie były udane. Problem stanowiła zbytnia elastyczność
komponentów DNA wykorzystywanych w budowie skomplikowanych
struktur. Pojedynczy punkt wiązania nie był wstanie zapewnić stabilnego
205
Arkadiusz Goede, Maciej Gawroński, Tomasz Wandtke
i silnego połączenia między cząsteczkami, uniemożliwiając tym samym
konstrukcję struktur wyższego rzędu [4]. Dopiero zastosowanie
wielorozgałęzionych łańcuchów pozwoliło osiągnąć wymaganą sztywność
i stabilność połączeń. Podwójnie rozgałęziony motyw po raz pierwszy
wykorzystano w 1993 roku i od tego czasu stał się motywem często
wykorzystywanym w nonotechnologii DNA. Złożone struktury DNA
często składają się z powtarzalnych komponentów utrzymywanych razem
dzięki lepkim końcom na każdym z nich [5-12].
3. Lepkie końce w nanotechnologii DNA
Lepkie końce wykorzystuje się do produkcji zrekombinowanych
liniowych cząsteczek DNA od prawie 35 lat [13]. Połączenie kohezji
lepkich końców z rozgałęzionymi cząsteczkami DNA, umożliwia
produkcję wielu złożonych struktur o różnej topologii przy stosunkowo
niewielkim wysiłku. Rozpoznanie jednej nici DNA przez inną nić jest
wykorzystywane w wielu typach nanotechnologii DNA i biologii
molekularnej. Szczególną cechą strukturalną nanotechnologii DNA jest to,
że wykorzystuje ona dobrze zdefiniowane struktury w miejscu łączenia się
dwóch helis DNA.
4. Powstawanie struktur rozgałęzionych
Kluczowym założeniem podczas analizy krystalicznej struktury 3D
cząsteczki DNA jest to, że kiedy dwie cząsteczki DNA są utrzymywane
razem przez lepkie końce, a znane są współrzędne w analizowanej
strukturze jednej z cząsteczek, to są znane również współrzędne drugiej. W
przypadku użycia innego systemu rozpoznawania biologicznego opartego
np. na oddziaływaniach przeciwciało-antygen, trzeba byłoby opracować
zależności przestrzenne dwóch partnerów w reakcji wiązania w każdej
parze. Wiele różnych lepkich końców posiada struktury, które są niemal
identyczne. Dlatego też w strukturalnej nanotechnologii DNA wykorzystuje się również różne metody kohezji: kohezję PX, dzielenie się
krawędziami, kohezję boczną [14‚18]. Wytworzenie cząsteczek rozgałęzionego DNA przy wykorzystaniu systemu biologicznej, wzajemnej
wymiany nici nie jest trudne. Rysunek 2 przedstawia kilka motywów
uzyskanych w ten sposób, które okazały się ważne w strukturalnej
nanotechnologii DNA. Połączenie Holiday’a (ang. Holliday junction; HJ)
występuje naturalnie jako biologiczny półprodukt w rekombinacji
genetycznej. Powstaje na skutek pojedynczej wzajemnej wymiany między
podwójnymi helisami DNA. Podwójnie skrzyżowana cząsteczka (ang.
Double cross-over; DX) jest półproduktem pochodzącym z dwóch wymian
pomiędzy podwójnymi helisami podczas mejozy. Cząsteczka potrójnie
206
Technika DNA origami – potencjalne zastosowania
skrzyżowana (ang. Triple crossover; TX) generowana jest przez dwie
wzajemne wymiany pomiędzy helisą cząsteczki DX a inną podwójną helisą
DNA [19-22]. Dwie nici DNA tworzące podwójną helisę mają przeciwną
biegunowość względem siebie. Wymiana może odbywać się pomiędzy
nićmi tej samej biegunowości lub przeciwnej. HJ, DX i TX są wynikiem
wymiany między nićmi o przeciwnej polaryzacji. Cząsteczka PX
charakteryzuje się wymianą pomiędzy nićmi tej samej polaryzacji [23].
Wymiana w motywie PX występuje w każdym możliwym miejscu, gdzie
nici są zestawione ze sobą. Wariant JX2 pozbawiony jest dwóch połączeń
w środku, w porównaniu do cząsteczki PX. Wykorzystuje się go do
tworzenia wytrzymałych nanomechanicznych „urządzeń”. Opisane wyżej
cząsteczki: DX, TX, PX, JX2 należą do grupy motywów sztywnych
i wytrzymałych i zostały przedstawione na rysunku 2 [18, 24].
Rysunek 2. Przegląd wybranych motywów rozgałęzionych [2]
Rysunek 3 przedstawia pojedyncze miejsce rozgałęzienia HJ. Każde
z czterech podwójnych spiralnych ramion jest zakończone lepkim końcem.
Rysunek pokazuje cztery z tych skrzyżowań zmontowanych razem
w strukturę czworokąta poprzez łączenie się lepkich końców. Lepkie końce
oprócz występowania wewnątrz wspomnianej struktury, występują również
na jej zewnętrznej części, co umożliwia jej rozszerzenie o kolejne
podjednostki składowe w postać dwuwymiarowych tablic krystalicznych.
Dwuwymiarowość wspomnianych tablic jest tak naprawdę tylko umowna,
gdyż natura DNA w postaci podwójnej helisy tak naprawdę czyni je
systemem 3D, a nie systemem 2D. W ten sposób rozgałęzione cząsteczki
DNA zaopatrzone w lepkie końce mogą być połączone w obiekty 3D
i tworzyć struktury w postaci siatki.
207
Arkadiusz Goede, Maciej Gawroński, Tomasz Wandtke
Rysunek 3. Schemat tworzenia dwuwymiarowych tablic krystalicznych z czterech HJ [2]
Istnieje szereg enzymów, które mogą być stosowane podczas prac
z DNA: ligazy przyłączają kowalencyjnie lepkie końce; enzymy restrykcyjne, mogą być stosowane do tworzenia interesujących odcinków DNA
jak i do celów analitycznych; egzonukleazy mogą zostać użyte w celu
usuwania nieprawidłowych komponentów; topoizomerazy natomiast można
wykorzystać do diagnozowania problemów topologicznych [7, 13, 25‚27].
5. Minimalizacja symetrycznych sekwencji (ang. Sequence
symetry minimalization)
W inżynierii molekularnej ważne jest zaprojektowanie elementów, które
mają możliwość łączenia się tylko w jeden sposób, w celu wyeliminowania
możliwości powstawania dwóch lub więcej konkurencyjnych, niespecyficznych produktów. Ważne jest również oszacowanie termodynamiki
w zależności od użytych sekwencji i wybrania najbardziej optymalnej dla
powstania zamierzonego produktu [28].
Rysunek 4 przedstawia czteroramienne skrzyżowanie DNA. Ramiona są
długie na 8 nukleotydów, więc każda z nici zawiera ich 16. 16 nukleotydów
dzieli się na szereg pokrywających się elementów (w tym przypadku 13
tetramerów). Każdy z tych elementów, takich jak sekwencja CGCA czy
GCAA jest unikalny. Ponadto każdy tetramer obejmujący „zakręt”
(np. sekwencja CTGA) nie posiada komplementarnej sekwencji (TCAG)
w żadnym miejscu rozgałęzionej cząsteczki. Dzięki takiemu zaprojektowaniu
sekwencji w całej cząsteczce jedyną konkurencję dla docelowych oktamerów
mogą stanowić trimery, takie jak sekwencja ATG. Wspomniane podejście
zakłada, że podwójne helisy są najkorzystniejszymi strukturami, które może
208
Technika DNA origami – potencjalne zastosowania
stworzyć DNA i że formowanie się podwójnej helisy doprowadzi do
pomyślnego utworzenia punktów odgałęzienia. Powodzenie tego sposobu
polega na kooperatywności tworzenia podwójnej helisy DNA.
Rysunek 4. Schemat czteroramiennej cząsteczki DNA [2]
Zbudowano jak dotąd kilka rozgałęzionych cząsteczek zawierających
trzy, cztery, pięć, sześć, osiem i dwanaście ramion. Z wielu badań wynika,
że kąt między ramionami wydaje się być elastyczny. W związku z tym
wcześniejsze konstrukcje były stałe pod względem topologii, a niekoniecznie pod względem ich trójwymiarowej struktury [29‚34].
6. Tablice DNA (ang. DNA arrays)
Po stworzeniu szeregu struktur rozgałęzionych, przedmiotem
zainteresowania stało się połączenie różnych gatunków struktur ze sobą.
Podczas budowy tablic DNA wymagana jest wysoka, strukturalna
integralność między poszczególnymi komponentami. Jak wspomniano
wyżej, pojedyncze skrzyżowanie, takie jak struktura HJ jest stosunkowo
elastyczne. Cząsteczki DX wykazują znacznie większą sztywność,
w porównaniu do podwójnej helisy DNA, czy cząsteczek HJ [8, 35].
Molekuły TX i PX wykazują podobne cechy pod względem sztywności co
209
Arkadiusz Goede, Maciej Gawroński, Tomasz Wandtke
DX. Właściwości te stały się podwaliną do użycia ich jako materiału
budulcowego w celu stworzenia tablic DNA [22, 36]. Tablice DNA
okazały się użyteczne jako rusztowanie podczas montażu urządzeń
nanomechanicznych. Przy użyciu komponentów DNA możliwe jest
wytworzenie swoistego rodzaju szablonów DNA, które zawierają
przewidywalne właściwości opierając się na kohezji lepkich końców
indywidualnych motywów. Szablony DNA można modyfikować poprzez
enzymatyczne dodanie lub usunięcie poszczególnych cech. Oprócz
tworzenia tablic z cząsteczek DX, możliwe jest również ich wytwarzanie
z periodycznych cząsteczek TX [22, 37]. Dwuwymiarowe struktury DNA
mogą również zostać zbudowane przy użyciu struktur DNA o wyglądzie
równoległoboków. Motywy te są wytwarzane przez połączenie czterech
HJ-podobnych rozgałęzień. W przeciwieństwie do DX, TX oraz cząsteczek
PX, dwie domeny cząstek HJ nie są równoległe do siebie [38‚40].
Zastosowanie cząsteczek DX pozwoliło na stworzenie różnych motywów,
w tym równoległoboków, czy trójkątów [41]. Tablice DNA, niebawem po
ich stworzeniu zostały zastosowane między innymi w celu stworzenia
rusztowania dla nanoczasteczek [42].
7. Tworzenie struktur 3D
Nanostruktury 3D powstają najczęściej przez składanie płaskich figur.
Innym sposobem montażu struktur trójwymiarowych jest tworzenie stosów
płaskich struktur. Jest to możliwe dzięki zastosowaniu miejscowospecyficznych sond w każdej warstwie, które selektywnie wiążą się
z konkretnym miejscem w innej warstwie.
Pierwszy obiekt trójwymiarowy zbudowany z DNA miał postać sześcianu,
w którym krawędzie składały się z podwójnych helis DNA, a wierzchołki
stanowiły punkty trójramiennych rozgałęzień. Każda z krawędzi sześcianu
powstaje poprzez dwukrotny obrót nici DNA ją tworzącej, co umożliwia
złożenie całej struktury z zachowaniem odpowiednich kątów pomiędzy jej
poszczególnymi elementami. W każdej krawędzi powstałej cząsteczki jest
obecne unikalne miejsce restrykcyjne. Dowodem zbudowania pożądanej
cząsteczki może być trawienie miejsc restrykcyjnych, doprowadzające do
zmian w budowie cząsteczki [26, 42].
Następną cząsteczką zbudowaną na bazie DNA był ścięty oktaedr.
Ośmiościan ścięty posiada 14 ścian. Sześć nici DNA odpowiada za tworzenie
ścian kwadratowych a osiem nici DNA za tworzenie ścian sześciokątnych. Z
każdego wierzchołka ośmiościanu ściętego wychodzą trzy krawędzie, jednak
cała struktura powstała poprzez wykorzystanie rozgałęzień czteroramiennych.
Dodatkowe helisy mogą być użyte do połączenia wielościanów w wersję
210
Technika DNA origami – potencjalne zastosowania
makrocząsteczki zeolitu A. W ciągu ostatnich kilku lat zbudowano ośmiościan
przy użyciu cząsteczek PX [25, 7, 15, 43].
Za strukturę wielowymiarowej cząsteczki zbudowanej z DNA odpowiadają
zastosowane węzły. Pół obrotu helisy DNA odpowiada jednemu węzłowi.
Węzły negatywne produkowane są na bazie konwencjonalnych prawo
skrętnych helis B-DNA, natomiast węzły pozytywne powstają z lewoskrętnych
helis Z-DNA. Rysunek 5A przedstawia węzeł negatywny, a rysunek 5C węzeł
pozytywny. Rycina 5B przedstawia strukturę złożoną z dwóch pozytywnych
i dwóch negatywnych węzłów. Wszystkie z tych węzłów zostały
wyprodukowane z jednej nici DNA, w zależności od zastosowanych
warunków ligacji [44, 45].
Rysunek 5D ilustruje pierścienie Borromean`a zbudowane z kombinacji
prawoskrętnego trójramiennego B-DNA połączonego z lewoskrętnym
trójramiennym Z-DNA. Pierścienie Borromean’a mają szczególną właściwość:
gdy dowolny pierścień w zestawie jest cięty, wszystkie pierścienie rozpadają
się. Jest to niezwykle trudna topologia do produkcji metodami
konwencjonalnymi, ale struktura ta jest stosunkowo łatwa do wykonania
z DNA [46, 47].
Rysunek 5. Schemat węzłów DNA: A – węzeł negatywny; C – węzeł pozytywny; B – struktura
złożona z dwóch pozytywnych i dwóch negatywnych węzłów; D – pierścienie Borromean’a [2]
8. Początek DNA origami – Badania Rothemund’a
Prekursorem techniki DNA origami był Rothemund (2006r.). Idea
wspomnianej metody jest bardzo prosta i opiera się na składaniu długiej
nici rusztowania w pożądany kształt. Kształt ten osiąga się wykorzystując
211
Arkadiusz Goede, Maciej Gawroński, Tomasz Wandtke
specjalnie zaprojektowane krótkie odcinki DNA w postaci spinek, czy
zszywek. Rothemund w swoim badaniu użył nici DNA genu bakteriofaga
M13mp18 o długości 7,249 pz. Wykorzystana przez niego cząsteczka DNA
była pojedynczą i kolistą nicią kwasu deoksyrybonukleinowego. Wybór tej
konkretnie cząsteczki był nieprzypadkowy. Genom bakteriofaga M13 był
dobrze poznany, a wykorzystana przez Rothemunda sekwencja wykazywała niewielką strukturę drugorzędową. Krótkie 30 nukleotydowe odcinki
DNA, będące spinkami, zaprojektowano by były komplementarne do
dwóch różnych domen w nici będącej rusztowaniem. Połączenie domen
przez spinki utrzymuje i stabilizuje strukturę nici-rusztowania. Sukces
Rothemunda można zawdzięczyć wykorzystaniu stu-krotnego nadmiaru
każdej ze spinek DNA, minimalnej strukturze drugorzędowej M13 i selekcji
spinek w taki sposób, aby nie były względem siebie komplementarne [48, 49].
Obecnie w celu uzyskania dowolnego kształtu DNA origami, otrzymuje
się najpierw przybliżony kształt zewnętrzny. Następnie kształt ten jest
wypełniany cylindrami o średnicy równej średnicy spirali DNA i długości
równej całkowitej wielokrotności skoku linii śrubowej. Cylindry są
następnie łączone ze sobą w określonych punktach rozgałęzień. Należy
zauważyć, że punkty rozgałęzień muszą być oddalone od siebie o 1,5
obrotu, aby utrzymać płaskość całej struktury. Następnie nić rusztowania
jest „tkana” przez cylindry – (Rysunek 6).
Rysunek 6. Schemat metody DNA origami [48]
9. Problemy w technice DNA origami
Metody oparte na wykorzystaniu techniki DNA origami nadal posiadają
szereg poważnych wad i niedogodności. Struktury DNA origami nie są
stabilne w zmiennych warunkach i wymagają specjalnego traktowania.
Drastyczny wpływ na strukturę DNA origami wywiera np. pH. W roztworach
charakteryzujących się niskim pH może dojść do depurynacji, czyli hydrolizy
zasady purynowej (adeniny lub guaniny) od reszty nukleotydu (deoksyrybozy
i reszty fosforanowej). W wysokim pH natomiast wiązanie wodorowe
pomiędzy nićmi DNA może ulec zniszczeniu. Podwyższona temperatura, czy
organiczne rozpuszczalniki doprowadzają do denaturacji podwójnych nici
212
Technika DNA origami – potencjalne zastosowania
DNA. Deoksyrybonukleazy katalizują rekcję niszczenia nici DNA. Również
jony obecne w roztworze mają silny wpływ na omawiane struktury DNA. Przy
niskiej sile jonowej ww. struktury DNA ulegają rozkładowi, natomiast
wysokie stężenia soli prowadzą do ich agregacji. Dodatkowo molekularne
napięcia i siły mechaniczne mogą mieć negatywny wpływ w szczególności na
długie i rozbudowane struktury. W związku z powyższym przechowywanie,
jak i prace z wykorzystaniem próbek zawierających struktury DNA muszą być
prowadzone bardzo ostrożnie i pod specjalnym nadzorem [50].
Najczęściej wykorzystywana w technice DNA origami sekwencja M13
o długości ok. 7000 par zasad posiada jednak pewne ograniczenia. Duże
i bardzo skomplikowane projekty wymagają znacznie dłuższej nici tworzącej
rusztowanie. Jedną z głównych przyczyn, dla których sekwencja M13 jest
szeroko stosowana jest jej niski koszt, duża dostępność oraz brak struktury
drugorzędowej. Istnieje więc potrzeba opracowania taniej procedury
stworzenia pojedynczej, długiej nici DNA, z minimalną strukturą
drugorzędową lub jej brakiem, w celu zastąpienia sekwencji M13[48, 49].
10. Nanotechnologia DNA – próby wykorzystywania
Struktura krystalicznej klatki zbudowana z DNA może posłużyć do
orientowania w przestrzeni innych molekuł uwięzionych w jej wnętrzu. Siatki
krystaliczne z DNA mogą zostać użyte w celu pozycjonowania i orientowania
w przestrzeni elementów molekularnych z ogromną precyzją [51‚53].
Urządzenia oparte na DNA przyczyniają się do rozwoju robotyki
w nanoskali jak również do stworzenia nowych inteligentnych materiałów,
które np. odpowiadają na konkretne bodźce poprzez przemiany przestrzenne
w ich strukturze.
10.1. Sondy na bazie DNA origami
Wykorzystując technikę DNA origami można zbudować prostokątną
płytkę rusztowania, zawierającą zestaw lepkich sond komplementarnych do
cząsteczek RNA. Mogą one posłużyć do ich wykrywania. Lepkie sondy
mają postać wiszących łańcuchów i nie są widoczne podczas obrazowania
w mikroskopii sił atomowych, jednak gdy RNA wiąże się z sondą, ich
struktura ulega usztywnieniu i zostają uwidocznione w AFM (ang. atomic
force microscope). Prostokątna płytka DNA z sondami posiada kilka osi
symetrii. W związku z tym pewien region każdej płytki, (konkretnie,
w lewym górnym rogu), zawiera kilka spinek, które wskazują orientacje
płytki, i pozwalają określić dokładną lokalizację na płytce. Różne płytki
posiadają unikalne sondy komplementarne do specyficznych sekwencji
RNA, zatem RNA może wiązać się tylko do jednej płytki. Płytki są
oznaczone kodami kreskowymi dla zmultipleksowanego wykrywania
sekwencji RNA.
213
Arkadiusz Goede, Maciej Gawroński, Tomasz Wandtke
10.2. Mapowanie struktury białek
Shih po raz pierwszy wykorzystał nanotechnologię DNA do mapowania
struktury białka podczas spektroskopii magnetycznego rezonansu
jądrowego NMR (ang. nuclear magnetic resonance). Technika ta polega na
identyfikacji magnetycznej sygnatury atomów białek w stosunku do swoich
sąsiadów. Poprzez poznanie sąsiadów każdego atomu, możliwe jest
złożenie struktury ogólnej białka. Technika działa tylko dla niewielkich
rozmiarów białek, dla których uporządkowanie interakcji między sąsiadami
nie nastręcza zbyt wielu trudności. Modyfikacje standardowych NMR
dostarczyły naukowcom dodatkowych informacji pomocnych w rozwiązywaniu struktury białek. Zastosowanie ciekłych kryształów w roztworze
NMR częściowo rozwiązało problem szybkiej zmiany konformacji
badanych białek. Niestety ciekłe kryształy są wrażliwe na działanie
detergentów, niezbędnych w roztworze NMR podczas badania białek błon
komórkowych. W 2007r. Shih zastąpił ciekłe kryształy nanorurkami DNA
origami, które wykazują sporą odporność na działanie detergentów. Dzięki
zastosowaniu techniki DNA origami możliwe stało się rozwiązanie
struktury przezbłonowej domeny białka receptora komórek T, jak również
struktury białka błonowego UCP2, które pomaga regulować wydzielanie
insuliny w komórkach trzustki [54].
10.3. Badanie reakcji między cząsteczkami w czasie
rzeczywistym
Sugiyama jako pierwszy zaproponował wykorzystanie nanotechnologii
DNA w celu obserwacji białkowych katalizatorów w czasie rzeczywistym.
Przy użyciu DNA origami skonstruowano miniaturową „ramkę”, która
została rozpięta pomiędzy dwoma prawie identycznymi nićmi dwuniciowego DNA. Jej zastosowanie pozwoliło na stworzenie sztucznego
kompartymentu, do którego została ograniczona analizowana reakcja
enzymatyczna. Dietz i wsp. użyli DNA origami w celu stworzenia lepszego
narzędzia do obserwacji DNA i białek w procesie ich rozrywania, czy
oddzielania od siebie. W standardowej procedurze używa się laserów
molekularnych do uwięzienia plastikowych koralików w danym miejscu
w roztworze. Następnie do koralików dołącza się linkery umożliwiające
przyłączenie białek lub innych molekuł, które są akurat badane. Poprzez
regulowanie promienia lasera możliwe jest oddalanie i zbliżanie koralików
względem siebie, w celu zaobserwowania jak zmiany naprężeń wpływają
na właściwości badanego białka takie jak zdolność do fałdowania się.
Niestety technika oparta na wykorzystaniu koralików ma pewne
ograniczenia. W wielu przypadkach na łączniki musi być wywarta duża
siła, aby rozdzielić od siebie białka. Podczas gdy białko jest rozciągane,
214
Technika DNA origami – potencjalne zastosowania
łączniki odpływają od siebie, więc eksperyment nie może być odwrócony
ani powtórzony [55]. Zespół badawczy Dietz’a postanowił więc zastąpić
zwykłe łączniki sztywnymi prętami wykonanymi w technice origami DNA,
zawierającymi aż 18 spiralnych rurek. Początkowe próby wykazały, że
sztywne wiązki DNA są lepsze w przenoszeniu siły przemieszczającej na
rozdzielane molekuły, a co za tym idzie wymagana siła, którą należy
wywrzeć w celu rozdziału molekuł jest o połowę mniejsza. Sztywne
łączniki powinny również pozostawać w miejscu podczas przeprowadzania
eksperymentu, co stwarza możliwość jego odwrócenia [56].
10.4. Sensory pH
W ostatnim czasie opracowano nanomechaniczne urządzenia origami
DNA takie jak: DNA Origami szczypce czy DNA Origami kleszcze.
Powstały one z połączenia dwóch elementów podobnych do wydłużonych
walców o długości 170 nm, licząc od punktu ich podparcia. DNA Origami
Szczypce mogą zatem występować w trzech konformacjach: postać
otwartego krzyża, w której obie połączone jedynie w punkcie podparcia ze
sobą dźwignie tworzą kształt litery X; postać równoległa i antyrównoległa
zamknięta forma, w której dwa ramiona są ustawione horyzontalnie za
pomocą dwóch lub więcej mostków między ramionami. Dziewięć par sekwencji 12-nukleotydowych obecnych w strukturze szczypiec może dimeryzować w czteroniciową, drugorzędową strukturę DNA podczas protonowania cytozyny. W takim wypadku następuje zmiana konformacji i przejście
z otwartej formy krzyża w zamkniętą formę równoległą. Taka zmiana formy
zależy od pH i jest bardzo łatwa do zaobserwowania stosując mikroskopię sił
atomowych (AFM). Pokazuje to potencjalne zastosowanie powyższego
systemu jako pojedynczych molekularnych czujników pH [57‚59].
10.5. Nanopory
Nanopory od niedawna wykorzystuje się w celu wykrywania,
oznaczania i określania fizycznych właściwości pojedynczych molekuł.
Nanopory stały się przedmiotem dużego zainteresowania w takich
dziedzinach jak sekwencjonowanie DNA [60]. Podstawowa koncepcja
wykrywania pojedynczej cząsteczki polega na zastosowaniu napięcia
przebiegającego przez dwa roztwory elektrolitów rozdzielonych strukturą
z nanoporami, oraz zmierzeniu powstałego prądu jonowego. Seminal
w 1990r. po raz pierwszy pokazał, że pojedyncze cząsteczki, takie jak
kwasy nukleinowe mogą być wykryte w ten sposób. W ciągu ostatnich
dwóch dekad nanopory zostały zastosowane do wykrywania wielu
cząsteczek biologicznych takich jak DNA, RNA i białka [61]. Badania nad
nanoporami można podzielić na te dotyczące stałych nanoporów
215
Arkadiusz Goede, Maciej Gawroński, Tomasz Wandtke
i nanoporów biologicznych. Stałe nanopory są całkowicie syntetyczne
i mogą być wytworzone za pomocą technik takich jak wiercenie jonowo
cienkich otworów w błonach izolacyjnych lub przeciąganie przez błonę
szklanych kapilar za pomocą lasera [62]. Nanopory biologiczne powstają
poprzez modyfikowanie dwuwarstwy lipidowej. Kluczowym aspektem
działania nanoporów zarówno stałych, jak i biologicznych, jest możliwość
uzyskania konkretnej struktury i właściwości pod względem geometrii
i powierzchni funkcjonalnej. Geometria determinuje sygnał pomiarów
i umożliwia selekcjonowanie na podstawie wielkości fizycznej.
Funkcjonalność powierzchni pozwala na osiągnięcie specyficzności
chemicznej w eksperymentach. Nanopory biologiczne są ograniczone do
badania małych molekuł, co najwyżej cząsteczek jednoniciowego DNA.
Natomiast średnica stałych nanoporów może zostać dostosowana do
badania większych molekuł w tym dsDNA i białek [63]. Nanopory
biologiczne znacząco wyprzedzają swoich stałych odpowiedników pod
względem funkcjonalności powierzchni. Inżynieria genetyczna nanoporów
biologicznych pozwala na precyzyjne pozycjonowanie grup chemicznych,
które wiążą się do analitów. W stałych nanoporach precyzyjne
pozycjonowanie pojedynczego miejsca wiążącego pozostaje niezwykle
trudne, dlatego DNA origami zdaje się być bardzo atrakcyjną techniką
formowania nanoporów. Szczególnie cenna jest możliwość budowy
trójwymiarowych konstrukcji, umożliwiających precyzyjną kontrolę
geometrii jak i funkcjonalności. Grupy funkcyjne, z zastosowaniem technik
DNA origami, mogą być umieszczone w konstrukcji z dokładnością do
kilku nanometrów [49].
10.6. Organizowanie nanocząsteczek
Nanocząstki plazmoniczne wykazują różne właściwości pochłaniania,
rozpraszania i sprzęgania, które są zależne od kształtów, rozmiarów
i odległości między cząstkami. Właściwości te są szeroko stosowane do
pomiarów, diagnozowania w leczeniu, obrazowaniu komórek i budowie
nanoelektroniki. Właściwość fototermiczna plazmonicznych nanocząsteczek
może być również stosowana w leczeniu raka. Właściwości optyczne
nanocząsteczek plazmoniczncyh silnie zależą od morfologii, składu
chemicznego oraz środowiska. Dlatego też dąży się do osiągnięcia
indywidualnych właściwości optycznych cząsteczek, gdzie każdy element
jest precyzyjnie rozmieszczony. DNA wydaje się być obiecującym
materiałem do organizowania funkcjonalnych nanoobiektów takich jak
nanocząsteczki metali. Organizowanie nanoczasteczek na tablicach DNA
origami polega na zastępowaniu standardowych zszywek DNA,
w strukturze DNA origami, modyfikowanymi nićmi DNA zawierającymi
216
Technika DNA origami – potencjalne zastosowania
nanoczasteczki. W taki sposób można precyzyjnie organizować nanoczasteczki takie jak AuNSs, AuNRs i AgNPs [64].
10.7. Nanoroboty
Nanoroboty DNA należy postrzegać jako swoistego rodzaju trójwymiarowe kontenery zbudowane z DNA. Ich powierzchnie są w pełni
adresowalne, pozwalając na przyłączenie różnych ligandów, znaczników
dla bioobrazownia, przeciwciał, hormonów. Najważniejsze jest jednak to,
że nanoroboty mogą być używane do skutecznego dostarczania i uwalniania leków w konkretnym miejscu. Zwiększona specyficzność w dostarczaniu leków pozwala na rozwiązanie problemu ich toksyczności, gdyż lek
w założeniu ma trafiać wyłącznie w miejsce docelowe. Douglas ze swoim
zespołem badawczym zaproponował stworzenie nanorobotów DNA
mających możliwość wyszukiwania i niszczenia komórek nowotworowych.
Robot Douglas’a wyglądem przypomina wydrążony cylinder o długości 60
nanometrów i szerokości 25 nanomentrów. Zbudowany jest z origami DNA
i zamknięty poprzez aptamer zaprojektowany tak, aby wiązał się do
cząsteczek charakterystycznych dla komórek nowotworowych. Połączenie
się aptameru z cząsteczką na komórce nowotworowej powoduje uwolnienie
wyznakowanych fluorescencyjnie białek układu odpornościowego, które po
związaniu się z komórkami nowotworowymi indukują apoptozę. W testach
in vitro wykazano 40% skuteczność w zabijaniu komórek zmienionych
nowotworowo, co wydaje się być dobrym wynikiem [65‚68].
11. Podsumowanie
Technika DNA origami pozwala na stworzenie wysoce zaawansowanych
struktur, które znajdują zastosowanie w wielu gałęziach nauk biomedycznych.
Przełomowym etapem w rozwoju omawianej techniki było stworzenie
sztywnych struktur DX, które dały podwaliny do stworzenia trójwymiarowych
obiektów, wykorzystywanych do tworzenia nanonarzędzi, takich jak
nanoszczypce, będące w istocie czujnikiem pH. Ciekawą i atrakcyjną aplikacją
przestrzennych obiektów DNA jest pozycjonowanie poszczególnych molekuł
w przestrzeni z niezwykłą dokładnością, co jest szczególnie istotne
w badaniach nad funkcjonowaniem cząsteczek takich jak kwasy nukleinowe
i białka. W podobnym celu wykorzystano tablice DNA, a także utworzone
w technice DNA origami porowate nanostruktury, które charakteryzują się
znacznie większą specyficznością niż materiały standardowo stosowane
w takich analizach. Przy wykorzystaniu dwuwymiarowych płytek DNA,
wyposażonych w sondy molekularne stworzono również wysoce specyficzne
narzędzia do wykrywania i rozpoznawania pojedynczych cząsteczek kwasów
nukleinowych i innych cząsteczek, których zasada działania w dużej mierze
217
Arkadiusz Goede, Maciej Gawroński, Tomasz Wandtke
przypomina standardowo wykorzystywane mikromacierze DNA. Najciekawszym, a zarazem najbardziej skomplikowanym przykładem wykorzystania
DNA origami, są nanoroboty DNA, które pozwalają na dostarczenie różnego
rodzaju biomolekuł, takich jak leki antynowotworowe, do zdefiniowanych
celów w postaci antygenów występujących na powierzchni komórek
nowotworowych. Budzą one ogromne zainteresowanie świata naukowego,
który upatruje w nich alternatywy dla obecnie stosowanych strategii
terapeutycznych, która pozwoliłaby na selektywne niszczenie komórek
nowotworowych, przy jednoczesnym uniknięciu poważnych, ogólnoustrojowych skutków ubocznych, jakie towarzyszą chemioterapii i radioterapii.
Literatura
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
Seeman N. C., In the nick of space: Generalized nucleic acid complementarity
and the development of DNA nanotechnology, Synlett., (2000), s. 1536-1548
Seeman N. C., An overview of structural DNA nanotechnology, Molecular
Biotechnology., 37 (2007), s. 246-257
Seeman N. C., Nucleic acid junctions and lattices, Journal of Theoretical Biology.,
99 (1982), s.237-247
Seeman N. C., DNA nanotechnology: novel DNA constructions, Annual Review
of Biophysics and Biomolecular Structure., 27 (1998), s. 225-248
Fu T. J., Seeman N. C., DNA double crossover structures, Biochemistry.,
32 (1993), s. 3211-3220
Chen J. H., Kallenbach N. R., Seeman N. C., A specific quadrilateral synthesized
from DNA branched junctions, Journal of the American Chemical Society.,
111 (1989), s. 6402-6407
Zhang Y., Seeman N. C., The construction of a DNA truncated octahedron,
Journal of the American Chemical Society., 116 (1994), s.1661-1669
Li X. J., Yang X. P., Qi J., Seeman N. C., Antiparallel DNA double crossover
molecules as components for nanoconstruction, Journal of the American Chemical
Society., 118 (1996), s. 6131-6140
LaBean T. H., Yan H., Kopatsch J., Liu F. R., Winfree E., Reif J. H., Seeman N.
C., The construction of DNA triple crossover molecules, Journal of the American
Chemical Society., 122 (2000), s.1848-1860
Winfree E., Liu F., Wenzler L.A ., Seeman N. C., Design and selfassembly of twodimensional DNA crystals, Nature., 394 (1998), s. 539-544
Liu Y., Lin C., Li H., Yan H., Aptamer directed self-assembly of proteins on
a DNA nanostructure, Angewandte Chemie International Edition., 44 (2005),
s. 4333-4338
Lin C., Liu Y., Rinker S., Yan H., DNA tile based self-assembly: building complex
nanoarchitectures, ChemPhysChem., 7 (2006), s. 1641-1647
Cohen S. N., Chang A. C. Y., Boyer H. W., Helling R. B., Construction
of biologically functional bacterial plasmids in vitro, Proceedings of the National
Academy of Sciences of the United States of America., 70 (1973), s. 3240-3244
218
Technika DNA origami – potencjalne zastosowania
14. Zhang X., Yan H., Shen Z., Seeman N. C., Paranemic cohesion of topologicallyclosed DNA molecules, Journal of the American Chemical Society., 124 (2002),
s. 12940-12941
15. Shih W. M., Quispe J. D., Joyce G. F., A 1.7-kilobase single-stranded DNA that
folds into a nanoscale octahedron, Nature., 427 (2004), s. 618-621
16. Shen Z., Yan H., Wang T., Seeman N. C., Paranemic crossover DNA:
A generalized Holliday structure with applications in nanotechnology, Journal
of the American Chemical Society., 126 (2004), s. 1666-1674
17. Yan H., Seeman N. C., Edge-sharing motifs in DNA nanotechnology, Journal
of Supramolecular Chemistry., 1. (2003), s. 229-237
18. Kuzuya A., Wang R., Sha R., Seeman N.C., Sixhelix and eight-helix DNA
nanotubes assembled from half-tubes, NanoLetters., 6 (2007), s. 1757-1763
19. Holliday R., A mechanism for gene conversion in fungi, Genetical Research.,
5 (1964), s. 282-304
20. Fu T. J., Seeman N.C., DNA double crossover structures, Biochemistry.,
32 (1993), s. 3211-3220
21. Schwacha A., Kleckner N., Identification of double Holliday junctions as
intermediates in meiotic recombination, Cell., 83 (1995), s. 783-791
22. LaBean T., Yan H., Kopatsch J., Liu F., Winfree E., Reif J. H., Seeman N. C.,
The construction, analysis, ligation and self-assembly of DNA triple crossover
complexes, Journal of the American Chemical Society., 122 (2000), s.1848-1860
23. Seeman N. C., DNA nicks and nodes and nanotechnology, NanoLetters., 1 (2001),
s. 22-26
24. Mathieu F., Liao S., Mao C., Kopatsch J., Wang T., Seeman N. C., Six-helix
bundles designed from DNA, NanoLetters., 5 (2005), s. 661-665
25. Zhang Y., Seeman N. C., A solid-support methodology for the construction
of geometrical objects from DNA, Journal of the American Chemical Society.,
114 (1992), s. 2656-2663
26. Chen J., Seeman N. C., The synthesis from DNA of a molecule with the
connectivity of a cube, Nature., 350 (1991), s. 631-633
27. Qi J., Li X., Yang X., Seeman N. C., The ligation of triangles built from bulged
three-arm DNA branched junctions, Journal of the American Chemical Society.,
118 (1996), s. 6121-6130
28. Seeman N. C., Kallenbach N. R., Design of immobile nucleic acid junctions,
Biophysical Journal., 44 (1983), s. 201-209
29. Ma R. I., Kallenbach N. R., Sheardy R. D., Petrillo M. L., Seeman N. C., Three
arm nucleic acid junctions are flexible, Nucleic Acids Research., 14 (1986),
s. 9745-9753
30. Kallenbach N. R., Ma R. I., Seeman N. C., An immobile nucleic acid junction
constructed from oligonucleotides, Nature., 305 (1983), s. 829-831
31. Wang Y., Mueller J. E., Kemper B., Seeman N. C., The assembly and
characterization of 5-Arm and 6-Arm DNA junctions, Biochemistry., 30 (1991),
s. 5667-5674
32. Wang X., Seeman N. C., The assembly and characterization of 8-arm and 12-arm
DNA branched junctions, Journal of the American Chemical Society., 26 (2007),
s. 8169-8176
219
Arkadiusz Goede, Maciej Gawroński, Tomasz Wandtke
33. Petrillo M. L., Newton C. J., Cunningham R. P., Ma R. I., Kallenbach N. R.,
Seeman N. C., Ligation and flexibility of four-arm DNA junctions, Biopolymers.,
27 (1988), s. 1337-1352
34. Eis P. S., Millar D. P., Conformational distributions of a four-way DNA junction
revealed by time-resolved fluorescence resonance energy transfer, Biochemistry.,
32 (1993), s. 13852-13860
35. Sa-Ardyen P., Vologodskii A. V., Seeman N. C., The flexibility of DNA double
crossover molecules, Biophysical Journal., 84 (2003), s. 3829-3837
36. Yan H., Zhang X., Shen Z., Seeman N. C., A robust DNA mechanical device
controlled by hybridization topology, Nature., 415 (2002), s. 62-65
37. Liu F., Sha R., Seeman, N. C., Modifying the surface features of two-dimensional
DNA crystals, Journal of the American Chemical Society., 121 (1999), s. 917-922
38. Mao C., Sun W., Seeman, N. C., Designed twodimensional DNA Holliday
junction arrays visualized by atomic force microscopy, Journal of the American
Chemical Society., 121 (1999), s. 5437-5443
39. Sha R., Liu F., Millar D. P., Seeman N. C., Atomic force microscopy of parallel
DNA branched junction arrays, Chemical Biology., 7 (2000), s. 743-751
40. Sha R., Liu F., Seeman N. C., Atomic force measurement of the interdomain angle
in symmetric Holliday junctions, Biochemistry., 41 (2002), s. 5950-5955
41. Constantinou P. E., Wang T., Kopatsch, J., Israel L.B., Zhang X., Ding B.,
Sherman W. B., Wang X., Zheng J., Sha R., Seeman N. C., Double cohesion in
structural DNA nanotechnology, Organic & Biomolecular Chemistry., 4 (2006),
s. 3414-3419
42. Chen J., Seeman N. C., The electrophoretic properties of a DNA cube and its substructure catenanes, Electrophoresis., 12 (1991), s. 607-611
43. Goodman R. P., Schaap I. A. T., Tardin C. F., Erben C. M., Berry R. M., Schmidt
C. F., Turberfield A. J., Rapid chiral assembly of rigid DNA building blocks from
molecular fabrication, Science., 310 (2005), s.1661-1664
44. Seeman N. C., The design of single-stranded nucleic acid knots, Molecular
Engineering., 2 (1992), s. 297-307
45. Du S. M., Stollar B. D., Seeman N. C., A synthetic DNA molecule in three knotted
topologies, Journal of the American Chemical Society., 117 (1995), s. 1194-200
46. Mao C., Sun W., Seeman N. C., Assembly of Borromean rings from DNA, Nature.,
386 (1997), s. 137-138
47. Chichak K. S., Cantrill S. J., Pease A. R., Chiu S. H., Cave G. W .V., Atwood J.
L., Stoddart J. F., Molecular Borromean rings, Science., 304 (2004), s. 1308-1312
48. Rothemund P., Design of DNA origami, (2005), s. 471-478
49. Rothemund P., Folding DNA to create nanoscale shapes and patterns, Nature.,
440 (2006), s. 297-302
50. Zadegan R. M., Norton M. L., Structural DNA nanotechnology: from deign to
applications, International Journal of Molecular Sciences., 6 (2012), s. 7149-7162
51. Yan H., Park S. H., Ginkelstein G., Reif J. H., LaBean T. H., DNAtemplated selfassembly of protein arrays and highly conductive nanowires, Science., 301 (2003),
s. 1882-1884
220
Technika DNA origami – potencjalne zastosowania
52. Deng Z. X., Tian Y., Lee S. H., Ribbe A. E., Mao C. D., DNA-encoded
selfassembly of gold nanoparticles into one-dimensional arrays, Angewandte
Chemie International Edition., 44 (2005), s. 3582-3585
53. Sharma J., Ke Y., Lin C., Chhabra R., Wang Q., Nangreave J., Liu Y., Yan H.,
DNA tile directed self-assembly of quantum dots into two-dimensional
nanopatterns, Angewandte Chemie International Edition., 47 (2008), s. 5157-5159
54. Douglas S. M., Chou J. J, Shih W. M., DNA-nanotube-induced alignment of
membrane proteins for NMR structure determination, Proceedings of the National
Academy of Sciences of the United States of America., 16 (2007), s. 6644-6648
55. Endo M., Katsuda Y., Hidaka K., Sugiyama H., Regulation of DNA methylation
using different tension of double strands constructed In a defined DNA
nanostructure, Journal of American Society., 5 (2010), s. 1592-1597
56. Kim D. M., Kilchherr F., Dietz H., Bathe M., Quantitative prediction of 3D
solution shape and flexibility of nucleic acid nanostructures, Nucleic Acids
Research., 7 (2012), s. 2862-2868
57. Kuzuya A., Sakai Y., Yamazaki T., Xu Y., Komiyama M., Nanomechanical DNA
Origami ―Single-Molecule Beacons‖ Directly Imaged by Atomic Force
Microscopy, Nature Communicates., 2 (2011), doi:10.1038/ncomms1452
58. Yamazaki T., Aiba Y., Yasuda K., Sakai Y., Yamanaka Y., Kuzuya A., Ohya Y.,
Komiyama M., Clear-Cut Observation of PNA Invasion Using Nanomechanical
DNA Origami Devices, Chemical Communications., 48 (2012), s. 11361-11363
59. Kuzuya A., Watanabe R., Hashizume M., Kaino M., Minamida S., Kameda K.,
Ohya Y., Precise Structure Control of Three-State Nanomechanical DNA Origami
Devices, Methods., 67 (2014), s. 250-255
60. Pennisi E., Search for pore-fection, Science., 336 (2012), s. 536-537
61. Wanunu M., Nanopores: a journey towards DNA sequencing, Physics of Life
Reviews., 9 (2012), s. 125-158
62. Bell N. A. W., Thacker V. V., Hernández-Ainsa S., Fuentes-Perez M. E., MorenoHerrero F., Liedl T., Keyser U. F., Multiplexed ionic current sensing with glass
nanopores, Lab on a Chip., 13 (2013), s. 1859-1862
63. Dekker C., Solid-state nanopores, Nature Nanotechnology., 2 (2007), s. 209-215
64. Liu Q., Song C., Wang Z. G., Li N., Ding B., Precise organization of metal
nanoparticles on DNA origami template, Methods., 67 (2014), s. 205-214
65. Douglas S. M., Dietz H., Liedl T., Hogberg B., Graf F., Shih W. M., Selfassembly
of DNA into nanoscale three-dimensional shapes, Nature., 459 (2010), s. 414-418
66. Andersen E. S., Dong M., Nielsen M. M., Jahn K., Subramani R., Mamdouh W.,
Golas M. M., Sander B., Stark H., Oliveira C. L., Self-assembly of a nanoscale
DNA box with a controllable lid, Nature., 459 (2009), s. 73-76
67. Moghimi S. M., Hunter A. C., Murray J. C., Nanomedicine: current status and
future prospects, FASEB Journal., 19 (2005), s. 311-330
68. Douglas S. M., Bachelet I., Church G. M., A logic-gated nanorobot for targeted
transport of molecular payloads, Science., 335 (2012), s.831-834
221
Arkadiusz Goede, Maciej Gawroński, Tomasz Wandtke
Technika DNA origami – potencjalne zastosowania
Technika DNA origami bazuje na zdolności cząsteczek DNA do formowania wieloniciowych
struktur przestrzennych, wynikającej z komplementarności zasad. Pozwala ona na uzyskanie
sztywnych obiektów 2D i 3D, które mogą zostać użyte do stworzenia wielu nanonarzędzi.
Szczególnie ważny jest motyw DX, który zapewnia sztywność i stabilność konstruktów DNA.
Dzięki odpowiedniemu zaprogramowaniu reakcji syntezy składowych elementów omawianych
struktur można stworzyć nano-szczypce działające jak wysoce czuły sensor pH. Siatki i tabliczki
wykonane w technice DNA origami pozwalają na niezwykle dokładne umiejscowienie
cząsteczek w przestrzeni, a także analizę ich funkcji. Ma to szczególne znaczenie w badaniach
nad właściwościami białek. Płytki stworzone za pomocą DNA origami posłużyły do stworzenia
niezwykle czułych mikromacierzy DNA, zdolnych do detekcji pojedynczych cząsteczek kwasów
nukleinowych. Najbardziej zaawansowaną formą tej techniki jest konstruowanie trójwymiarowych nanorobotów DNA, które potrafią rozpoznać komórki docelowe, na przykład komórki
nowotworowe i dostarczać do nich cząsteczki leków przeciwnowotworowych. Budzą one
ogromne nadzieje na wykorzystanie ich w przyszłości jako alternatywy dla obecnie stosowanych
strategii terapeutycznych.
DNA origami technique – potential aplications
DNA Origami technology is based on the ability of DNA molecules to form the multi-strand
spatial structures. Such ability arises from the rule of base complementarily. It allows to obtain
stiff 2D and 3D objects that can be used to create many nanodevices. Especially important is DX
motive which provides stiffness and stability of the DNA constructs. By appropriate
programming of synthesis reaction constituent elements of aforementioned structures can be
created to build nano-pliers that act as highly sensitive pH sensor. Lattices and arrays made in the
DNA origami technology allow for extremely accurate positioning of molecules in space, as well
as an enable analysis of their functions. It is particularly important in research on the properties of
proteins. Arrays that were developed by using the DNA origami technique were used to create
highly sensitive DNA microarrays capable of detecting single molecules of nucleic acids. The
most advanced form of this technique is the construction of three-dimensional DNA nanorobots
that can recognize the target cells such as cancer cells and deliver molecules of anticancer drugs
into them. It is hoped that their usage in the future will be an alternative to currently used
therapeutic strategies.
222
Małgorzata Sieradzka1, Joanna Kołodziejczyk-Czepas2, Paweł Nowak3
Nowe kierunki w badaniach biomedycznych
kwasów hydroksycynamonowych
New trends in biomedical research
on hydroxycinnamic acids
1. Wprowadzenie
Kwasy hydroksycynamonowe stanowią najliczniejszą grupę kwasów
fenolowych i fenylopropanoidów pochodzenia naturalnego. Są to wtórne
metabolity roślinne, powstające z fenyloalaniny lub tyrozyny, na szlaku
przemian kwasu szikimowego [1]. W roślinach występują głównie
w formie złożonej – glikozydów lub depsydów, w mniejszym natomiast
stopniu w postaci wolnej. Fenolokwasy w formie estrów z glukozą lub
kwasu chinowego obecne są przeważnie w owocach, a w ziarniakach zbóż
większość fenolokwasów związana jest z arabinoksylanami. Wolne kwasy
hydroksycynamonowe występują w tkankach roślinnych na ogół
w niewielkich ilościach [2]. W organizmach roślin fenolokwasy pełnią
funkcję ochronną [3], a ze względu na aktywność biologiczną wykazywaną
w organizmach zwierząt i człowieka związki te stanowią także przedmiot
wielu badań naukowych. Do niedawna, większość prac badawczych
dotyczących roślinnych kwasów fenolowych dotyczyła aktywności
przeciwutleniającej – wykazano m.in., że związki te posiadają zdolność
zmiatania wolnych rodników, chelatowania jonów metali, a także modulowania aktywności enzymów i białek nieenzymatycznych [4]. W ostatnich
latach obserwuje się jednak znaczącerozszerzenie zakresu prac badawczych
dotyczących kwasów fenolowych [5], obejmujących ocenę ich właściwości
przeciwzapalnych i przeciwnowotworowych, a także syntezę nowych
pochodnych fenolokwasów oraz opracowywanie formulacji preparatów
1
[email protected], Katedra Biochemii Ogólnej, Wydział Biologii i Ochrony
Środowiska, Uniwersytet Łódzki, www.biol.uni.lodz.pl/biochogl
2
[email protected], Katedra Biochemii Ogólnej, Wydział Biologii i Ochrony Środowiska,
Uniwersytet Łódzki, www.biol.uni.lodz.pl/biochogl
3
[email protected], Katedra Biochemii Ogólnej, Wydział Biologii i Ochrony Środowiska,
Uniwersytet Łódzki, www.biol.uni.lodz.pl/biochogl
223
Małgorzata Sieradzka, Joanna Kołodziejczyk-Czepas, Paweł Nowak
zawierających kwasy fenolowe, umożliwiających uzyskanie pożądanej
aktywności farmakologicznej tych związków.
2. Cel pracy
Przedmiotem prezentowanej pracy jest omówienie aktualnego stanu wiedzy
i najnowszych kierunków w badaniach biomedycznych, dotyczących
perspektyw wykorzystania biologicznej aktywności wybranych fenolokwasów
roślinnych z grupy kwasów hydroksycynamonowych (kwas kawowy,
kumarowy, chlorogenowy, ferulowy, rozmarynowy i synapinowy). Praca
obejmuje przegląd najnowszego piśmiennictwa (głównie z ostatnich 5 lat), ze
szczególnym uwzględnieniem najnowszych doniesień na temat właściwości
przeciwutleniających, przeciwzapalnych oraz przeciwnowotworowych
wymienionych kwasów fenolowych.
3. Charakterystyka kwasów hydroksycynamonowych
Kwasy hydroksycynamonowe stanowią grupę związków fenylopropanoidowych o ogólnym wzorze szkieletu węglowego C6-C3, syntetyzowanych
w procesie deaminacji fenyloalaniny lub tyrozyny [6, 2].
Głównymi przedstawicielami fenolokwasów hydroksycynamonowych są
kwasy: kawowy, kumarowy, ferulowy, synapinowy [4] oraz pochodne kwasu
kawowego: estry utworzone z kwasem chinowym (kwas chlorogenowy),
α-hydroksydihydrokawowym (kwas rozmarynowy) oraz ester fenetylowy
kwasu kawowego (CAPE, ang. caffeic acid phenethyl ester) (Ryc.1). Obecność
kwasów hydroksycynamonowych stwierdzono m.in. w zbożach, warzywach,
owocach, nasionach i orzechach, a także licznych produktach spożywczych,
np. napojach (Tabela 1).
224
Nowe kierunki w badaniach biomedycznych kwasów hydroksycynamonowych
Ryc. 1. Wzory strukturalne wybranych kwasów hydroksycynamonowych.
Tabela 1. Występowanie kwasów fenolowych w wybranych roślinach i produktach spożywczych
(kompilacja danych wg [4, 7]; zmodyfikowano)
Kwas
kawowy
kumarowy
ferulowy
synapinowy
chlorogenowy
rozmarynowy
Występowanie
piwo, wino, jęczmień, owies, ryż, żyto, pszenica, jagody,
fasola, groszek, orzech laskowy, orzech włoski, len,
musztarda, krokosz, słonecznik, seler, ziemniaki, pomidory
piwo, wino, herbata, jęczmień, kukurydza, owies, ryż, żyto,
pszenica, jagody, winogrona, fasola, groszek, orzech laskowy,
orzechy pekan, orzech ziemny, orzech włoski, len, musztarda,
krokosz, słonecznik, seler, pomidory
piwo, wino, jęczmień, kukurydza, owies, ryż, żyto, pszenica,
jagody, fasola, groszek, orzech laskowy, orzech ziemny,
orzech włoski, len, musztarda, rzepak, krokosz, słonecznik,
seler, pomidory
piwo, owies, żyto, pszenica, fasola, orzech laskowy, orzech
ziemny, orzech włoski, musztarda, rzepak
kawa, wino, herbata, jęczmień, jabłka, gruszki, fasola,
migdały, słonecznik, seler, sałata, ziemniaki, pomidory
melisa lekarska, rozmaryn lekarski, mięta pieprzowa
3.1. Aktywność przeciwutleniająca
Główne molekularne mechanizmy przeciwutleniającego działania kwasów
fenolowych obejmują przejęcie przez rodnik elektronu odłączonego od
fenolokwasu lub przekazanie przez fenolokwas atomu wodoru z utwo-
225
Małgorzata Sieradzka, Joanna Kołodziejczyk-Czepas, Paweł Nowak
rzeniem stabilnych rodników fenoksylowych. Poza zmiataniem rodnikowych
i nierodnikowych reaktywnych form tlenu (RFT), związki te mogą wykazywać działanie przeciwutleniające także poprzez chelatowanie jonów
metali przejściowych, hamowanie aktywności enzymów pro-oksydacyjnych,
a także modulację ekspresji genów, w tym wpływ na działanie szlaku
ARE/Nrf-2 (element odpowiedzi antyoksydacyjnej, ang. antioxidant
response element/czynnik transkrypcyjny Nrf-2, ang. nuclear erythroid 2related factor), aktywujący mechanizmy cytoprotekcyjne [6].
Właściwości przeciwutleniające kwasów fenolowych badane są obecnie
pod kątem zastosowania tych związków jako bioaktywnych składników
żywności funkcjonalnej oraz suplementów diety i innych nutraceutyków.
Wiedza na temat aktywności antyoksydacyjnej kwasów hydroksycynamonowych, obserwowanej zarówno w układach in vitro, jak i in vivo
została kilka lat temu podsumowana m.in. w obszernej publikacji
poglądowej [4]. Również w ciągu ostatnich lat pojawiły się kolejne
doniesienia, potwierdzające aktywność przeciwutleniającą fenolokwasów
oraz opisujące mechanizmy tego działania w różnych układach
badawczych (dane zebrano w tabeli 2), a także porównawcze analizy
działania różnych fenolokwasów lub ich pochodnych. Na przykład, wyższą
aktywność przeciwutleniającą kwasu kawowego w porównaniu do
efektywności działania kwasu chlorogenowego (w zakresie stężeń 0,01-10
mM) wykazano w badaniach na zwierzęcym modelu niedokrwienia/
reperfuzji [45].
Najnowsze kierunki w badaniach dotyczących właściwości antyoksydacyjnych kwasów hydroksycynamonowych dotyczą syntezy nowych
pochodnych tych związków, obejmujących połączenia ze związkami
naturalnymi (np. biopolimerami), substancjami syntetycznymi, a także
składnikami nieorganicznymi. Stwierdzono m.in., że kwas rozmarynowy
w kompleksach z różnymi pochodnymi dekstryn wykazuje silniejszą
zdolność redukującą (ocenianą testem redukcji jonów miedzi – CUPRAC,
ang. cupric reducing antioxidant capacity) niż zastosowany samodzielnie
[46]. Pochodne 4-winylowe kwasów hydroksycynamonowych (p-kumarowego, synapinowego, ferulowego oraz kawowego) wykazują wyższą
aktywność antyoksydacyjną (oznaczenia zmiatania DPPH oraz O2), niż
same kwasy hydroksycynamonowe [47]. Badane są też możliwości
zastosowania fenolokwasów w formie pochodnych chitozanu. Wykorzystanie chitozanu w tego typu badaniach wynika z faktu, że jest on jest
biopolimerem oszerokim spektrum potencjalnego zastosowania w naukach
biomedycznych, ze względu na zdolność tworzenia związków chelatowych,
możliwość tworzenia żeli, nietoksyczność oraz biozgodność z organizmem
ludzkim [48]. Utworzenie koniugatu kwasu ferulowego i chitozanu nadaje
powstałej pochodnej silniejsze od substratów właściwości przeciwrodnikowe, co wykazano na przykład przy zastosowaniu rodników
226
Nowe kierunki w badaniach biomedycznych kwasów hydroksycynamonowych
DPPH[49] i ABTS+[50]. Natomiast badania porównawcze działania
antyoksydacyjnego chitozanu oraz jego koniugatów z kwasem ferulowym
lub kawowym prowadzone w innych układach doświadczalnych in vitro
wykazały, że największą zdolność przeciwutleniającą (zmiatanie rodników
nadtlenkowych, rodnika hydroksylowego i nadtlenku wodoru oraz
hamowanie peroksydacji lipidów) posiada chitozanowa pochodna kwasu
kawowego, mniej efektywnym przeciwutleniaczem był koniugat kwasu
ferulowego, a najsłabiej działał chitozan [51]. Aktywność przeciwutleniającą
hydroksycynamonowych pochodnych chitozanu oceniano także w warunkach
in vivo. Przez 42 dni myszom (przyjmującym 100 mg/kg/dzień D-galaktozy)
podawano 200 mg/kg/dzień chitozanu, chitozanu skoniugowanego z kwasem
kawowym lub pochodnej chitozanu z kwasem ferulowym. Zaobserwowano
zwiększenie aktywności enzymów antyoksydacyjnych: dysmutazy
ponadtlenkowej (SOD, ang. superoxide dismutase), katalazy (CAT, ang.
catalase) oraz peroksydazy glutationowej (GPx, ang. glutathione peroxidase)
oraz zmniejszenie poziomu dialdehydu malonowego (MDA, ang.
malonyldialdehyde) zarówno w surowicy krwi, jak i próbkach wątroby myszy,
które otrzymywały chitozan skoniugowany z kwasem kawowym lub kwasem
ferulowym.
Dane dotyczące efektywności działania przeciwutleniającego różnych
pochodnych fenolokwasowych są jednak niejednorodne. Chociaż
głównymzałożeniem tworzenia pochodnych kwasów fenolowych lub
opracowywania różnych formuł ich stosowania/podawania jest uzyskanie
wzrostu aktywności przeciwutleniającej, w ostatnich latach pojawiły się także
prace, sugerujące, że niektóre pochodne mogą być znacznie mniej efektywne
niż związki wyjściowe. Wykazano m.in., że alkilowe estry kwasu kawowego
(metylowy, etylowy, propylowy i butylowy słabiej zmiatają rodniki DPPH,
ale wykazują większą zdolność redukcyjną (mierzoną w teście FRAP,
ang. ferric reducing ability) niż kwas kawowy. Natomiast estry ferulowe
(metylowy, etylowy, propylowy i butylowy) słabiej zmiatają rodniki DPPH,
mają też mniejszą zdolność redukcyjną (FRAP) niż kwas ferulowy [52].
Wyższą aktywność redukującą i przeciwrodnikową w porównaniu do związku
wyjściowego posiada natomiast acyloglukuronid kwasu ferulowego, ale inne
pochodne fenolokwasowe, takie jak 4’-O-siarczany i 4’-O-glukuroniany kwasu
kawowego i ferulowego mają słabsze właściwości przeciwutleniające niż same
fenolokwasy [53]. Ponadto, wprawdzie w oznaczeniach zmiatania rodnika
DPPH i zdolności redukującej (FRAP) wykazano aktywność antyoksydacyjną
zarówno kwasu synapinowego, jak i jego alkilowego estru na podobnym
poziomie efektywności działania [54], ale dostępne są też doniesienia,
wskazujące, że alkilowe pochodne kwasu kawowego wykazują słabszą
zdolność zmiatania rodników DPPH niż kwas kawowy[55].
227
Małgorzata Sieradzka, Joanna Kołodziejczyk-Czepas, Paweł Nowak
Tabela 2. Ocena właściwości antyoksydacyjnych wybranych fenolokwasów przy zastosowaniu
różnych modeli doświadczalnych
Kwas
fenolowy
kawowy
Badania in vitro
Badania in vivo
 ograniczanie peroksydacji
lipidów, zmiatanie reaktywnych
form tlenu (NO, H2O2) oraz
redukcja kationorodnika ABTS+
– ale także efekt prooksydacyjny
w badaniach redukcji jonów
żelaza (przy stężeniach 5µM)
i zmiatania DPPH (przy
stężeniach 20 µM) [8]
 hamowanie peroksydacji
lipidów przez CAPE w roztworze
kwasu linolowego, zmiatanie
wolnych rodników (ABTS+,
DPPH, DMPD+ oraz O2) przez
CAPE. Ponadto, zdolność
redukcji jonów żelaza i miedzi
(test FRAP i CUPRAC),
chelatowanie jonów metali
przejściowych [9]
 aktywność antyoksydacyjna
kwasu kawowego w oznaczeniach zmiatania ABTS+ oraz
pomiarach FRAP [10]
 zdolność zmiatania rodników
DPPH oraz NO przez koniugat
kwasu kawowego
z chitooligosacharydem [11]
 chelatowanie jonów metali,
przeciwdziałanie powstawaniu
rodników hydroksylowych
wytwarzanych w reakcji Fentona;
hamowanie powstawania
uszkodzeń wywołanych
działaniem produktów reakcji
Fentona (badania in vitro na
wątrobach szczurów [12]
 hamowanie generowania
wolnych rodników, ale
brak wpływu na
aktywność SOD
w badaniach na
homogenatach z kory
mózgowej myszy
z epilepsją [18]
 hamowanie powstawania
rodnika 1-hydroksyetylowego w badaniach na
mikrosomach ze szczurzej
wątroby, prawdopodobnie
będące wynikiem chelatowania jonów metali [19]
 hamowanie peroksydacji
lipidów (oznaczenia
poziomu MDA) oraz
aktywności SOD, CAT,
GPx przez CAPE
w badaniach z użyciem
homogenatów tkanki jąder
szczurów z zaburzeniami
czynności jąder indukowanymi kadmem [20]
 ograniczanie stresu
oksydacyjnego
(oznaczenia SOD i CAT
w homo-genacie
z hipokampu) u szczurów
z napadami padaczkowymi
induko-wanymi
pilokarpiną [21]
obniżenie całkowitego
potencjału oksydacyjnego
w tkance mózgowej
w badaniachna szczurach
z ostrym zatruciem
środkiem owadobójczym
(chloropiryfosem) [22]
hamujący efekt CAPE na
228
Nowe kierunki w badaniach biomedycznych kwasów hydroksycynamonowych
aktywność SOD oraz tworzenie
RFT w komórkach nabłonkowych
ucha środkowego, w warunkach
stresu oksydacyjnego
indukowanego H2O2 [13]
 zmiatanie DPPH oraz NO;
spadek tworzenia TBARS
w badaniach na fibroblastach
płucnych poddanych działaniu
H2O2[14]
 zahamowanie powstawania
rodników 7karboksyheptylowych, zmiatanie
1
O2[15]
hamowanie peroksydacji lipidów
przez CAPE (badania z użyciem
homogenatów komórek tarczycy
i wątroby szczurów [16]
 hamowanie aktywności
cytochromu P450 w badaniach na
mikrosomach wątroby (hLMs)
[17]
kumarowy
 hamowanie peroksydacji
lipidów (lipoprotein frakcji LDL),
zmiatanie rodników ABTS+,
DPPH, O2, OH; redukcja
i chelatowanie jonów żelaza [23]
 zdolność zmiatania wolnych
rodników w następującej
efektywności działania:

OHOCH3>OOH>OOCH3[24]
229
Małgorzata Sieradzka, Joanna Kołodziejczyk-Czepas, Paweł Nowak
ferulowy
synapinowy
 aktywność antyoksydacyjna
w badaniach peroksydacji
lipidów (w badaniach na
frakcjach mikrosomalnych
wątroby myszy); zmiatanie
ABTS oraz NO i H2O2
w badaniach in vitro na
śledzionie myszy, ale także
prooksydacyjne działanie
w badaniach redukcji żelaza
(dla stężeń 5 µM) i zmiatania
DPPH (dla stężeń 20 µM) [8]
 wzrost aktywności SOD
i CAT oraz obniżenie poziomu
MDA w komórkach
embrionalnych nerki(linia
HEK293), traktowanych
H2O2[25]
 hamowanie generowania RFT
ispadek stężenia MDA,
zwiększenie aktywności SOD
i GPx oraz obniżenie ekspresji
NADPH w szczurzych
komórkach mięśni gładkich
naczyń krwionośnych,
traktowanych H2O2[26]
 hamowanie generowania OH,
NO oraz spadek poziomu
TBARS przez ferulan
izopentenylu [27]
 przeciwdziałanie peroksydacji
lipidów w ludzkich
erytrocytach, w warunkach
stresu oksydacyjnego
wywołanego hiperglikemią [28]
 obniżenie poziomu
peroksydacji lipidów
w kardiomioblastach
poddanych działaniu H2O2[31]
230
 cofnięcie
zmian/uszkodzeń
morfologicznych
wywołanych powstawaniem
amyloidu β, zależne od
neutralizacji RFT, wykazane
obserwacjami
mikroskopowymi na modelu
badawczym zarodków
jeżowca Paracentrotus
lividus[29]
 zmniejszenie poziomu
MDA, wzrost poziomu
glutationu całkowitego oraz
zmniejszenie aktywności
GPx oraz SOD u szczurów
z sepsą [30]
Nowe kierunki w badaniach biomedycznych kwasów hydroksycynamonowych
+
chlorogenowy
rozmarynowy
 zmiatanie rodników ABTS
i
DPPH, zdolność redukcji
jonów żelaza (FRAP) oraz
chelatowanie jonów metali
przejściowych przez izomery
kwasu chlorogenowego [32]
 zmiatanie DPPH, O2, OH
oraz wewnątrzkomórkowych
RFT w badaniach na linii
komórkowej HaCaT [33]
 hamowanie aktywności
CYT450, obniżenie stężenia
MDA, spadek generowania
RFT oraz hamowanie ekspresji
NFκB (ang. nuclear factor-κB)
hepatocytach linii L-02,
traktowanych acetaminofenem
(paracetamolem) [34]
 zmiatanie rodnika DPPH[37]
 anty- i prooksydacyjna aktywność kwasu rozmary-nowego
w badaniach in vitro z użyciem
H2O2 oraz rodnika ABTS+[38]
 hamowanie peroksydacji
lipidów w badaniach na modelu
błony komórkowej [39]
spadek stężenia MDA oraz
zwiększenie całkowitej pojemności antyoksydacyjnej (TAC,
ang. total antioxidant capacity)
u szczurów, u których stres
oksydacyjny powodowany był
ekspozycją na działanie pola
elektromagnetycznego [40]
 zmiatanie rodnika DPPH[41]
 hamowanie aktywności SOD,
CAT, GPx, GSH oraz GST (Stransferaza glutationowa, ang.
glutathione-S-transferase) oraz
ekspresji NFκB u szczurów
z cukrzycą indukowaną
streptozotocyną [42]
231
 hamowanie peroksydacji
lipidów u szczurów
z niedokrwieniem/reperfuzją
wywołaną zamknięciem
mikrokrążenia w lewym
płacie wątroby [35]
 inhibicja peroksydacji
lipidów (pomiar MDA)
w surowicy krwi oraz
wątrobie i tkance mózgowej
szczurów; przywrócenie
prawidłowego stężenia
globulin i albumin, współczynnika albuminowoglobulinowego, poziomu
serotoniny, noradrenaliny,
dopaminy w surowicy oraz
aktywności SOD i GPx
w krwi oraz wątrobie
myszy, którym podawano
metamfetaminę [36]
 spadek generowania
wolnych rodników, ale brak
wpływu na aktywność SOD
(w badaniach na
homogenatach z kory
mózgowej myszy
z epilepsją) [18]
 hamowanie aktywności
SOD i CAT – badania
z użyciem homogenatów
tkanek z nerek lub wątroby
szczurów z cukrzycą
wywołaną streptozotocyną
[43]
 obniżenie poziomu MDA,
a zwiększenie aktywności
SOD, CAT i GPx
w badaniach z użyciem
homogenatów z wątroby
i nerek starzejących się
myszy [44]
Małgorzata Sieradzka, Joanna Kołodziejczyk-Czepas, Paweł Nowak
3.2. Aktywność przeciwzapalna
Najnowsza literatura dostarcza informacji na temat przeciwzapalnych
właściwości kwasów hydroksycynamonowych (tabela 3), a także
ekstraktów bogatych w kwasy hydroksycynamonowe. W badaniach tych
zwraca się uwagę przede wszystkim na aktywność kwasu rozmarynowego,
którego działanie może być porównywalne lub nawet silniejsze od
niektórych niesteroidowych leków przeciwzapalnych. Efektywność
przeciwzapalnego oraz immunomodulującego działania tego fenolokwasu
wynika głównie ze zdolności hamowania aktywności lipooksygenaz,
cyklooksygenaz oraz białek układu dopełniacza. Kwas rozmarynowy
badany jest obecnie zarówno pod kątem zastosowania leczniczego, jak
i profilaktycznego w postaci nutraceutyków [80]. Zainteresowanie
naukowców tym związkiem obejmuje doskonalenie metod jego produkcji,
tworzenie nowych, aktywnych farmakologicznie pochodnych [81], a także
badania naturalnych ekstraktów bogatych w ten związek. W ostatnich
latach, oceniano m.in. przeciwzapalną aktywność kwasu rozmarynowego
z Prunella vulgaris iThunbergia laurifolia. Ekstrakt z nadziemnych części
P. vulgaris zawierający kwas rozmarynowy hamuje produkcję prostaglandyny E2(PGE2 ang. prostaglandin E2) oraz tlenku azotu in vitro.
Ekstrakt ten hamował ponadto ekspresję genów dla cyklooksygenazy 2
(COX-2, ang. cyclooxygenase-2) oraz indukowalnej syntazy tlenku azotu
(iNOS, ang. inducible nitric oxide synthase) w komórkach stymulowanych
lipopolisacharydem bakteryjnym (LPS) [82].Natomiast kwas rozmarynowy
z liści T. laurifoliapodawany myszom drogą pokarmową w dawkach 50,
100 i 150 mg/kg wykazywał działanie przeciwzapalne in vivo, wyraźnie
hamując występowanie indukowanego PGE2obrzęku [83]. Silne działanie
przeciwzapalne mogą również wykazywać inne kwasy hydroksycynamonowe.
Badania działania farmakologicznego kwasu chlorogenowego zawartego
w ekstrakcie z części nadziemnych T. diversifoliawykazały, że ekstrakt (10, 50,
100 i 150 mg/kg) wykazuje wyższą aktywność przeciwzapalną niż niesteroidowy lek przeciwzapalny (indometacyna, 10 mg/kg) w badaniach in vivo [84].
Naukowcy poszukują ponadto kolejnych związków o działaniu
terapeutycznym, opartych na strukturze kwasów hydroksycynamonowych.
W 2014 roku, zespół badawczy Park i wsp. [85] opublikował wyniki
wstępnych badań z zastosowaniem nowej pochodnej kwasu kawowego
(acetyl-caffeic acid–1-piperonylpiperazine), jako związku o działaniu
przeciwzapalnym. Doświadczenia na makrofagach poddawanych stymulacji
LPS-em wykazały, że badana pochodna hamuje aktywność iNOS, COX-2 oraz
syntezę interleukiny 6 i 1β. Ponadto, zaobserwowano supresję działania
czynnika transkrypcji NFκB oraz genów zależnych od NFκB.
232
Nowe kierunki w badaniach biomedycznych kwasów hydroksycynamonowych
W najnowszej literaturze, można także znaleźć wyniki badań
aktywności przeciwzapalnej nowych hybryd estru CAPE (CAPE-aspiryna
i CAPE-indometacyna). Stosując zwierzęcy model badawczy, wykazano,
że połączenie CAPE-aspiryna hamuje proces zapalny indukowany
paracentezą, którego nasilenie oceniano mierząc poziom TNF-α (ang.
tumor necrosis factor) oraz PGE2[86]. Również wyniki innych prac
badawczych, obejmujących analizę porównawczą aktywności przeciwzapalnej kwasu ferulowego, kumarynowego i ich pochodnych, prowadzone
na makrofagach (Raw 264.7) stymulowanych LPS-em wskazują, że
najsilniejszą aktywność przeciwzapalną (hamowanie ekspresji iNOS oraz
tworzenia NFκB) wykazuje diferuloiloputrescyna, następnie p-dikumaroiloputrescyna, kwas ferulowy i p-kumarynowy izolowane z otrąb
kukurydzianych [87].
Jednocześnie, należy także wspomnieć, że pojawiają się doniesienia na
temat prozapalnych właściwości kwasu chlorogenowego. W badaniach
in vivo (na szczurach) wykazano, że wysokie dawki kwasu chlorogenowego
(7 mg/kg)powodują zwiększoną adhezję leukocytów, tworzenie nadtlenków
i wyciek albuminy z naczyń krwionośnych. Ponadto, zaobserwowano
wzrost poziomu MDA,nasilenie aktywności mieloperoksydazy i uwalniania
cytokin prozapalnych oraz zwiększenie aktywności oksydazy NADPH,
SOD oraz CAT [88].
233
Małgorzata Sieradzka, Joanna Kołodziejczyk-Czepas, Paweł Nowak
Tabela 3.Ocena właściwości przeciwzapalnych wybranych fenolokwasów przy zastosowaniu
różnych modeli doświadczalnych
Kwas
kawowy
Badania in vitro
 hamowanie aktywacji
i ekspresji NFκB pod
wpływem działania TNF-α
w ludzkich keratynocytach
[56]
 obniżenie poziomu IL-1β,
TNF-α oraz MCP-1 (ang.
monocyte chemoattractant
protein) w makrofagach,
w których stan zapalny
indukowano LPS-em [57]
 przeciwzapalna aktywność
CAPE wykazana w badaniach
z użyciem ludzkich komórek
nabłonkowych z ucha
środkowego (hamowanie
ekspresji TNF-α i COX-2)
– stan zapalny indukowano
H2O2 [58]
 hamowanie generowania
NO oraz PGE2
w makrofagach
stymulowanych LPS-em.
Hamowanie ekspresji TNF-α,
iNOS oraz COX-2 [59]
 hamowanie produkcji NO,
IL-6 oraz IL-1β
w makrofagach pobudzanych
LPS-em [60]
kumarowy
234
Badania in vivo
 działanie przeciwzapalne
w badaniach na szczurzym
modelu zapalenia opłucnej
wywołanej karagenem (66%
redukcja migracji białych
krwinek przy stężeniu
kwasu 5mg/kg i 92,9%10mg/kg) [61]
 zmniejszenie poziomu
TNF-α i IL-1β u szczurów
po ostrym urazie rdzenia
kręgowego [62]
 hamowanie aktywacji
i ekspresji NFκB
indukowanej przez TNF-α
w komórkach ludzkich
keratynocytów. Ponadto,
stwierdzono hamowanie
ekspresji TNF-α, iNOS oraz
COX-2 w badaniach na
myszach [63]
 hamowanie wydzielania
IL-1β, IL-6 i TNF-α,
zmniejszenie ekspresji
iNOS, COX-2 i GFAP (ang.
glial fibrillary acidic
protein) oraz obniżenie
produkcji NO oraz PGE2
u myszy, którym podawano
1-metylo-4-fenylo-1,2,3,6tetrahydropirydynę [64]
 hamowanie syntezy TNFα u szczurów z zapaleniem
stawów, wywołanym
adjuwantem [65]
 zmniejszenie aktywności
enzymów lizosomalnych
oraz peroksydacji lipidów
u szczurów ze stanem
zapalnym indukowanym
moczanem sodu [66]
Nowe kierunki w badaniach biomedycznych kwasów hydroksycynamonowych
ferulowy
chlorogenowy
 hamowanie ekspresji genów
dla NFκB i iNOS oraz
zmniejszenie produkcji TNFα, IL-6, IL-1β i NO
w szczurzych komórkach
mięśni gładkich, w których
stan
zapalnywywoływanoH2O2[26]
 hamowanie translokacji
NFκB z cytoplazmy do jądra
komórkowegooraz
hamowanie ekspresji MCP-1
i IL-6 w komórkach
gwiaździstych wątroby (kom.
Browicza-Kupffera),
stymulowanych LPS-em [68]
 hamowanie syntezy NO, IL1β, IL-6 oraz TNF-α oraz
ekspresji COX-2 i iNOS.
Hamowanie translokacji
NFκB w makrofagach
i komórkach mikgogleju
stymulowanych LPS-em [69]
 hamowanie NO i PGE2 oraz
ekspresji iNOS i COX-2
w ludzkich chondrocytach
poddanych stymulacji
IL-1β [70]
Obniżenie poziomu TNF-α
i IL-6 oraz ekspresji genów
dla NFκB w komórkach
mikrogleju stymulowanych
HSV [71]
hamowanie adhezji
i migracji neutrofili
w badaniach na liniach
komórkowych śródbłonka
(ang. primary culture of
microvascular endothelial cell
– PMEC)w których stan
zapalny indukowano formyloleucyno-metioninofenyloalaniną [72]
235
 obniżenie poziomu TNF-α
i IL-1β u szczurów
z zapaleniem stawów,
indukowanym kolagenem
[67]
 obniżenie poziomu TNF-α
oraz aktywności COX-2
i iNOS w surowicy
u szczurów z niedokrwieniem/reperfuzją
spowodowanym
umieszczeniem klamry
uniemożliwiającej przepływ
krwi w płucach [35]
 hamowanie ekspresji
białka zapalnego
makrofagów 2 oraz IL-1β
u myszy, u których stan
zapalny wywoływano
dekstranem siarczanu
sodu [73]
Małgorzata Sieradzka, Joanna Kołodziejczyk-Czepas, Paweł Nowak
rozmarynowy
 hamowanie syntezy NFκB
w neuronach stymulowanych
TNF-α [74]
 hamowanie odpowiedzi
zapalnej zależnej od
niehistonowego białka
chromosomalnego HMGB1
(ang. high mobility group box
1 protein) i czynnika NFκB
w ludzkich komórkach
śródbłonka, w warunkach
stanu zapalnego
indukowanego cytokiną
HMGB1 (ang. high mobility
group box 1) [75]
 obniżenie poziomu TNF-α,
IL-1β, Il-6, NO oraz ekspresji
NFκB u szczurów z cukrzycą,
wywołaną działaniem
streptozotocyny [76]
236
działanie przeciwzapalne
na szczurzym modelu
uszkodzenia płuc
indukowanego LPS-em
(spadek wydzielania cytokin
prozapalnych: TNF-α, IL-6
i IL-1) [77]
 ograniczenie uszkodzeń
widocznych w obrazowaniu
histopatologicznym,
zmniejszenie obrzęku
mózgu, hamowanie
ekspresjiHMGB1 (ang.
high-mobility group box1)
i aktywności NFκB
u szczurów z cukrzycą,
u których indukowano stan
zapalny streptozotocyną
(Luan i wsp., 2013)
 hamowanie migracji
leukocytów u myszy ze
stanem zapalnym
wywołanym LPS-em [75]
 spadek aktywności
aminotransferaz ALAT
(ang. alanine
aminotransferase) i AspAT
(ang. aspartate
aminotransferase) oraz
stężenia MDA w surowicy
szczurów
z niedokrwieniem/reperfuzją
wywołanym założeniem
klamry blokującej przepływ
krwi w naczyniach
krwionośnych wątroby [78]
 łagodzenie ostrego stanu
zapalnego trzustki,
indukowanego u myszy
taurocholanem sodu – kw.
rozmarynowy zastosowano
w dawce50 mg/kg masy
ciała [79]
Nowe kierunki w badaniach biomedycznych kwasów hydroksycynamonowych
3.3. Przeciwnowotworowe właściwości kwasów
hydroksycynamonowych
Dostępne są liczne prace oryginalne, wskazujące na chemoprewencyjne,
antyproliferacyjne i anty-adhezyjne właściwości różnych kwasów
fenolowych, a także prace poglądowe podsumowujące aktualny stan
wiedzy (np. [89,90]). Molekularne mechanizmy działania tych związków
pozostają jednak nie w pełni wyjaśnione, stąd też, w ostatnich latach
obserwuje się liczne badania, prowadzone w oparciu o doświadczenia na
różnych liniach komórkowych lub modelach zwierzęcych, mające na celu
ustalenie głównych biochemicznych szlaków działania fenolokwasów
(Tabela 4). Badania porównawcze pozwalają natomiast na uzyskanie
szerszego obrazu efektywności działania przeciwnowotworowego kwasów
hydroksycynamonowych. W pracach badawczych tego typu potwierdzono
m.in. przeciwnowotworowe właściwości kwasu kawowego, p-kumarowego
i ferulowego, wykorzystując model doświadczalny komórek raka płuca
(A549) oraz linii komórek raka jelita grubego (HT29-D4). Wymienione
fenolokwasy (50-200 μM) hamowały nie tylko proliferację komórek obu
linii, ale także ich wiązanie się z różnymi białkami adhezyjnymi (lamininą
1, witronektyną i fibronektyną), co sugeruje, że związki te mogłyby działać
na różnych etapach rozwoju choroby nowotworowej, hamując zarówno
namnażanie komórek transformowanych, jak i ich adhezję [109]. Również
w innych badaniach wykazano, że kwasy: kawowy, chlorogenowy
i ferulowy (w zakresie stężeń ≥100 μM) mogą hamować proliferację oraz
adhezję komórek A549, stymulowanych zastosowaniem estru forbolu
(PMA, ang. phorbol-12-myristate-13-acetate). Biochemiczne mechanizmy
obserwowanych efektów obejmują hamowanie szlaków przekazywania
sygnału z udziałem kinaz MAPK, kinazy 3-fosfatydyloinozytolu (PI3K)
oraz Akt, a także inaktywacji regulatorów transkrypcji, takich jak NF-κB
(ang. nuclear factor kappa-light-chain-enhancer of activated B cells),
kompleksu AP-1 (ang. activator protein 1) oraz STAT (ang. signal
transducer and activator of transcription 3) [110]. W przypadku kwasu
kawowego, najnowsze badania wskazują, że dla przeciwnowotworowego
działania tego związku in vitro i in vivo istotne znaczenie ma także
zdolność hamowania podziałów macierzystych komórek nowotworowych
(CSCs, ang. cancer stem cells). Molekularny mechanizm tego efektu
obejmuje blokowanie przez kwas kawowy szlaków przekazywania
sygnałów zależnych od czynnika TGFβ i receptora Smad2 [111].
Omawiając postęp w badaniach nad przeciwnowotworowym działaniem
fenolokwasów należy jednak przede wszystkim wymienić syntezę nowych
pochodnych różnych kwasów fenolowych w celu zwiększenia skuteczności
ich działania farmakologicznego oraz ocenę działania tych pochodnych. Do
niedawna, większość badań nad pochodnymi kwasów hydroksycynamonowych dotyczyła estru fenetylowego kwasu kawowego (CAPE),
237
Małgorzata Sieradzka, Joanna Kołodziejczyk-Czepas, Paweł Nowak
stanowiącego jeden z bioaktywnych składników miodów i propolisu. Jako
główny mechanizm działania biologicznego tego związku wskazuje się
zdolność specyficznego hamowania czynnika transkrypcyjnego NF-κB. Z
uwagi na zdolność NF-κB do hamowania apoptozy, indukcji proliferacji
oraz nasilania procesu angiogenezy, czynnik ten odgrywa ważną rolę
w onkogenezie i progresji zmian nowotworowych – dlatego też może
stanowić cel działania terapii przeciwnowotworowych [112]. Obecnie,
wśród najnowszych doniesień dotyczących pochodnych fenolokwasów
również można znaleźć kolejne prace na temat przeciwnowotworowego
działania CAPE (np. [113,114,115]), ale zauważalny jest wyraźny wzrost
zainteresowania nowymi, syntetycznymi pochodnymi kwasów fenolowych,
takimi jak np. heterocykliczne estry kwasu kawowego[116] lub połączenia
z chitozananem. Wiadomo, że koniugaty kwas kawowy-chitooligosacharyd
posiadają m.in. właściwości przeciwrodnikowe [117], ale ostatnio
zwrócono również uwagę na fakt, że chitozanowe pochodne fenolokwasów
mogą działać przeciwnowotworowo. W badaniach na linii komórkowej
CT26 (raka jelita grubego) stwierdzono, że koniugaty kwasu kawowego
i chitozanu (kw. kawowy przyłączony do grup aminowych chitozanu)
charakteryzują się silniejszymi właściwościami anty-proliferacyjnymi
i pro-apoptotycznymi niż chitozan. Opisywane pochodne ograniczały także
inwazję komórek nowotworowych w testach z użyciem podłoża Matrigel®
[118], stanowiącego zrekonstruowaną błonę podstawną. Ponadto, chitozan
w połączeniu z kwasem kawowym może stanowić bazę do tworzenia
nanocząsteczek służącychjako nośniki leków przeciwnowotworowych.
Ostatnio badane jest m.in. zastosowanie samoorganizujących się
nanocząsteczek zbudowanych z koniugatów chitozanu i kwasu kawowego
oraz karboksymetylodekstranu i glikolu polietylenowego (CMD-PEG),
jako formy precyzyjnego dostarczania doksorubicyny do komórek
nowotworowych in vitro [119]. Stosując model eksperymentalny raka płuc
(doświadczenia in vitro i in vivo) wykazano z kolei przeciwnowotworowe
właściwości kwasu 4-O-(2″-O-acetylo-6″-O-p-kumaroilo-β-D-gluko-piranozylo)-p-kumarynowego [120]. Opublikowano także prace na temat
właściwości przeciwnowotworowych kawoilo- i feruilopochodnych wanilliny oraz metylowaniliny pochodzące z badań in vitro oraz in vivo.
W testach in vitro wyraźny efekt cytotoksyczny stwierdzono w przypadku
kilku pochodnych, natomiast w badaniach na myszach, najsilniejszym
efektem przeciwnowotworowym charakteryzował się 5-nitro kawoilan
adamantylu, zmniejszający wagę guzów o ok. 36,7% (przy zastosowaniu
dawki 40 mg/kg masy ciała) [121].
Wśród najnowszych odkryć w dziedzinie potencjalnego zastosowania
kwasu kawowego w terapii nowotworów warto również wspomnieć
możliwość zastosowania tego związku w formie stałych nanocząstek
lipidowych [122]. Ponadto, trwają badania nad przeciwnowotworowymi
właściwościami nieorganicznych pochodnych kwasu ferulowego, o charak-
238
Nowe kierunki w badaniach biomedycznych kwasów hydroksycynamonowych
terze nanohybryd. W doświadczeniach na komórkach linii HeLa stwierdzono, że takie pochodne wykazują dwukrotnie silniejszą aktywność
przeciwproliferacyjną w porównaniu do samego fenolokwasu [123].
Z kolei kompleksy kwasu chlorogenowego i oksowanadu (Na[VO(kw.
chlorogenowy)(H2O)3]4H2O) są badane pod kątem zastosowania
w leczeniu raka sutka. W warunkach in vitro wykazano selektywną
cytotoksyczność tych związków w stosunku do komórek linii raka sutka
(SKBR3) [124].
Inną możliwością terapeutycznego wykorzystania i wzmocnienia
przeciwnowotworowego działania kwasów fenolowych jest opracowanie
terapii opartych na synergistycznym działaniu tych związków z innymi
substancjami lub lekami. Oddziaływania synergistyczne pomiędzy
chemoterapeutykami przeciwnowotworowymi i naturalnymi związkami
fenolowymi, a także synergizm przeciwnowotworowy między roślinnymi
(poli)fenolami są obecnie intensywnie badane. Efekt taki wykazano dla
wielu związków fenolowych lub ekstraktów bogatych w polifenole (w tym
fenolokwasy), w badaniach z zastosowaniem cytostatyków przeciwnowotworowych o różnych mechanizmach działania, takich jak np.
doksorubicyna (antybiotyk antracyklinowy), tamoksyfen (modulator
receptora
estrogenowego),5-fluorouracyl
(antymetabolit),docetaksel
ipaklitaksel (taksany, inhibitory mitozy), czy winkrystyna (alkaloid,
inhibitor mitozy) [125]. W przypadku zastosowania fenolokwasów jako
wzmocnienia terapii przeciwnowotworowejoceniane są takżemożliwości
ich stosowania w połączeniu z inhibitorami polimeraz poli-ADP-rybozy
(PARP, ang.poly (ADP-ribose) polymerase). Ze względu na kluczową rolę
PARP w procesach naprawy DNA, blokowanie ich aktywności
w komórkach nowotworowych stanowi cel terapii nowotworów uwarunkowanych niedoborem aktywności BRCA1/2, takich jak rak piersi czy
jajnika. Zahamowanie aktywności PARP prowadzi zjawiska tzw. sztucznie
wywołanej letalności (ang. synthetic lethality), stanowiącej podstawę
działania leków z grupy inhibitorów PARP [126]. Ocena działania
kombinacji kwasu ferulowego oraz ABT-888 (inhibitor PARP) wykazała,
że kwas ferulowy uwrażliwia komórki raka sutka (linia MDA-MB-231) na
działanie tego inhibitora PARP[127]. Ponadto, działanie kwasu ferulowego
może być również wzmocnione poprzez podawanie go z kwasem
acetylosalicylowym (aspiryna) w formie nanokapsułek pokrytych
chitozanem. W doświadczeniach na liniach komórkowych raka trzustki
wykazano, że połączenie kwasu ferulowego i aspiryny w formie takich
nanokapsułek znacząco redukuje przeżywalność komórek linii MIA PaCa-2
oraz Panc-1, a in vivo ogranicza wzrost guzów u zwierząt objętych
badaniem[128]. Synergistyczny efekt antyproliferacyjny zaobserwowano
także stosując kwas ferulowy w połączeniu z δ-tokotrienolem (badania na
komórkach linii DU-145, MCF-7 oraz PANC-1) [129].
239
Małgorzata Sieradzka, Joanna Kołodziejczyk-Czepas, Paweł Nowak
Tabela 4. Ocena właściwości przeciwnowotworowych wybranych fenolokwasów przy zastosowaniu różnych modeli doświadczalnych
Kwas
ferulowy
Badania in vitro
 radiouczulające działanie na
komórki raka szyki macicy
(linii HeLa oraz ME-180) [91]
 efekt antyproliferacyjny
i hamowanie zdolności
tworzenia kolonii komórek
linii TT (raka rdzeniastego
tarczycy na skutek ekspresji
genu URG4/URGCP [92]
 hamowanie cyklu
komórkowego w komórkach
raka prostaty linii PC-3 oraz
działanie proapoptotyczne
w komórkach linii LNCaP [93]
 działanie antyangiogenne –
hamowanie odpowiedzi
komórkowej na czynnik
wzrostu fibroblastów 1 (FGF1, ang. basic fibroblast growth
factor 1); kwas ferulowy
wykazuje zdolność
hamowania/blokowania
funkcji receptora dla czynnika
FGF-1, powoduje
zahamowanie szlaków
przekazywania sygnału
z udziałem kinazy 3fosfatydyloinozytolu (PI3K)
oraz kinazy Akt [94]
 zastosowanie kombinacji
kw. ferulowego oraz weliparybu (ABT-888) – inhibitora
receptorów PARP, zwiększa
wrażliwości komórek raka
sutka na działanie tego
inhibitora (linie MDA-MB231 oraz MCF-7) [95]
 zaobserwowano spadek
przeżywalności i hamowanie
tworzenia kolonii komórek
linii MIA PaCa-2 traktowanych kw. ferulowym [96]
240
Badania in vivo
 hamowanie karcynogenezy
(zapobieganie tworzeniu
guza w badaniu na
zwierzętach) poprzez
modulowanie ekspresji
i aktywności
cyklooksygenazy 2, NF-B
oraz czynnika wzrostu
śródbłonka naczyń (VEGF,
ang. vascular endothelial
growth factor[97]
 ochrona przed
hepatotoksycznością
diosbulbiny B
i wzmocnienie
przeciwnowotworowego jej
działania – badania na
myszach [98]
 hamowanie angiogenezy
i wzrostu guzów
indukowanych u myszy
poprzez wprowadzenie
komórek linii czerniaka
B16F10 [94]
Nowe kierunki w badaniach biomedycznych kwasów hydroksycynamonowych
kawowy
o-kumarowy
p-kumarowy
chlorogenowy
rozmarynowy
 hamowanie proliferacji
komórek włókniakomięsaka
(linia HT-1080) [99]
 działanie proapoptotyczne
w komórkach białaczkowych
(linii HEL) [100]
 efekt chemoprewencyjny
w doświadczeniach na
komórkach raka sutka (linia
MCF-7) [101]
 działanie antyangiogenne
(linia ECV304) na skutek
hamowania szlaków przekazywania sygnałów z udziałem
kinaz AKT i ERK [102]
 indukcja apoptozy
w komórkach białaczki U937
na skutek stymulacji wzrostu
ekspresji kaspazy 3, 7, 8 oraz
9, a także poprzez zmiany
(redukcję) potencjału błony
mitochondrialnej [103]
 hamowanie proliferacji
i proapoptotyczne działanie na
komórki linii HL-60 (ostrej
białaczki promielocytowej)
[104]
 efekt anty-angiogenny,
będący wynikiem inhibicji
szlaku przekazywania sygnału
z udziałem czynnika HIF-1α
(czynnika transkrypcyjnego
indukowany hipoksją) oraz
kinazy AKT [105]
 wzmocnienie
przeciwnowotworowego
działania 5-fluorouracylu na
komórki raka
wątrobowokomórkowego
(linie HepG2 i Hep3B) [106]
 radiouczulające działanie na
komórki czerniaka (linia
B16F10) [107]
241
 hamowanie wzrostu
guzów, indukowanych
u myszy poprzez iniekcję
komórkami RENCA [102]
 hamowanie indukowanej
7,12dimetylobenzo[a]antracenem
karcynogenezy komórek
skóry myszy [108]
Małgorzata Sieradzka, Joanna Kołodziejczyk-Czepas, Paweł Nowak
4. Podsumowanie
W odróżnieniu od flawonoidów badanych bardzo intensywnie od ponad 25
lat, wzrost zainteresowania biologiczną aktywnością fenolokwasów roślinnych
stanowi stosunkowo nowe zagadnienie w naukach biomedycznych.
Szczególnie w ostatnich kilku latach obserwuje się znaczący postęp
i rozszerzenie zakresu prac badawczych tych związków oraz ich pochodnych.
Dostępna literatura dostarcza najwięcej danych dotyczących właściwościach kwasu kawowego (głównie aktywności antyoksydacyjnej) oraz
o jego naturalnej pochodnej – estru fenetylowego kwasu kawowego (CAPE)
potwierdzonych w badaniach in vitro jak i in vivo. Ponadto, znaleźć można
prace dotyczące działania antyoksydacyjnego, przeciwzapalnego oraz
przeciwnowotworowego kwasu ferulowego, chlorogenowego i rozmarynowego. Najmniej poznanymi fenolokwasami pozostają nadal kwas kumarynowy oraz synapinowy.
Główne kierunki badań dotyczących możliwego zastosowania
farmakologicznego fenolokwasów dotyczą przeciwzapalnej i przeciwnowotworowej aktywności różnych pochodnych kwasów hydroksycynamonowych (m.in. koniugatów z naturalnymi biopolimerami, substancjami
syntetycznymi oraz składnikami nieorganicznymi), projektowanych w celu
zwiększenia efektywności potencjalnego działania leczniczego. Warto również
wspomnieć, że badania tego typu obejmują również opracowanie
odpowiednich formulacji preparatów fenolokwasowych, w tym użycie ich
w postaci nanocząstek lipidowych, a także, jako składników mieszanin
o synergistycznym efekcie terapeutycznym.
Literatura
1.
2.
3.
4.
5.
6.
7.
Maeda H., Dudareva N., The Shikimate Pathway and Aromatic Amino Acid
Biosynthesis in Plants, The Annual Review of Plant Biology 63 (2010), s. 73-105
Gawlik-Dziki U., Fenolokwasy jako bioaktywne składniki żywności, Żywność.
Nauka. Technologia. Jakość 4 (2004), s. 29-40
Budryn G., Nebesny E., Fenolokwasy – ich właściwości, występowanie
w surowcach roślinnych, wchłanianie i przemiany metaboliczne, Bromatologia
i Chemia Toksykologiczna 2 (2006), s. 103-110
Shahidi F., Chandrasekara A., Hydroxycinnamates and their in vitro and
in vivo antioxidant activities, Phytochemistry Reviews 9 (2010), s. 147-170
Saibabu V., Fatima Z., Khan L. A, Hameed S,. Therapeutic Potential
of Dietary Phenolic Acids, Advances in Pharmacological Sciences 2015, doi:
doi:10.1155/2015/823539
Teixeira J., Gaspar A., Garrido E. M., Garrido J., Borges F., Hydroxycinnamic
Acid Antioxidants: An Electrochemical Overview (2013)
http://dx.doi.org/10.1155/2013/251754
Petersen M., Simmonds, Rosmarinic acid, Phytochemistry 62 (2003), s. 121-125
242
Nowe kierunki w badaniach biomedycznych kwasów hydroksycynamonowych
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
Maurya D. K., Devasagayam T. P. A., Antioxidant and prooxidant nature
of hydroxycinnamic acid derivatives ferulic and caffeic acids, Food and
Chemical Toxicology 48 (2010), s. 3369-3373
Gocer H., Gulcin I., Caffeic acid phenethyl ester (CAPE): correlation
of structure and antioxidant properties, International Journal of Food Sciences
and Nutrition, 62(8) (2011), s. 821-825
Jeong Ch-H., Jeong H. R., Choi G. N., Kim D-O., Lee U., Heo H. J.,
Neuroprotective and anti-oxidant effects of caffeic acid isolated from Erigeron
annuus leaf, Chinese Medicine 6:25 (2011) s. 1-9
Eom T-K., Senevirathne M., Kim S-K., Synthesis of phenolic acid conjugated
chitooligosaccharides and evaluation of their antioxidant activity,
Environmental Toxicology And Pharmacology 34 (2012), s. 519-527
Genaro-Mattos T. C., Maurício A. Q., Rettori D., Alonso A., Hermes-Lima
M., Antioxidant Activity of Caffeic Acid against Iron-Induced Free Radical
Generation – A Chemical Approach, PLoS ONE 10(6) (2015) e0129963
Song J-J., Lim H. W., Kim K., Kim K-M., Cho S., Chae S-W., Effect of caffeic
acid phenethyl ester (CAPE) on H2O2 induced oxidative and inflammatory
responses in human middle ear epithelial cells, International Journal
of Pediatric Otorhinolaryngology 76 (2012), s. 675-679
Santos J. L. A., Bispo V. S., Filho A. B. C., Pinto I. F. D., Dantas L. S.,
Vasconcelos D. F., Abreu F. F., Melo D. A., Matos I. A., Freitas F. P., Gomes
O. F., Medeiros M. H. G., Matos H. R., Evaluation of Chemical Constituents
and Antioxidant Activity of Coconut Water (Cocus nucifera L.) and Caffeic
Acid in Cell Culture, Annals of the Brazilian Academy of Sciences 85(4)
(2013), s. 1235-1246
Asano M., Iwahashi H., Caffeic Acid Inhibits the Formation of 7Carboxyheptyl Radicals from Oleic Acid under Flavin Mononucleotide
Photosensitization by Scavenging Singlet Oxygen and Quenching the Excited
State of Flavin Mononucleotide, Molecules 19 (2014), s. 12486-12499
Kokoszko-Bilska A., Stepniak J., Lewinski A., Karbownik-Lewinska M.,
Protective antioxidative effects of caffeic acid phenethyl ester (CAPE) in the
thyroid and the liver are similar to those caused by melatonin, Thyroid
Research 7:5 (2014)
Rastogi H., Jana S., Evaluation of Inhibitory Effects of Caffeic acid and
Quercetin on Human Liver Cytochrome P450 Activities, Phytotherapy
Research 28 (2014), s. 1873-1878
Coelho V. R., Vieira C. G., de Souza L. P., Moysés F., Basso C., Papke D. K.
M., Pires T. R., Siqueira I. R., Picada J. R., Pereira P., Antiepileptogenic,
antioxidant and genotoxic evaluation of rosmarinic acid and its metabolite
caffeic acid in mice, Life Sciences 122 (2015), s. 65-71
Ikeda H., Kimura Y., Masaki M., Iwahashi H., Caffeic acid inhibits the
formation of 1 hydroxyethyl radical in the reaction mixture of rat liver
microsomes with ethanol partly through its metal chelating activity, Journal
of Clinical Biochemistry and Nutrition 48 (3) (2011), s.187-193
Erboga M., Kanter M., Aktas C., Donmez Y. B., Erboga Z. F., Aktas E., Gurel
A., Anti-Apoptotic and Anti-Oxidant Effects of Caffeic Acid Phenethyl Ester
243
Małgorzata Sieradzka, Joanna Kołodziejczyk-Czepas, Paweł Nowak
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
on Cadmium-Induced Testicular Toxicity in Rats, Biological Trace Element
Research (2015) DOI 10.1007/s12011-015-0509-y
dos Santos Sales I. M., do Nascimento K. G., Feitosa Ch. M., Saldanha G. B.,
Feng D., de Freitas R. M., Caffeic acid effects on oxidative stress in rat
hippocampus after pilocarpine-induced seizures, Neurological Sciences 32
(2011), s. 375-380
Ozkan U., Osun A., Basarslan K., Senol S., Kaplan I., Alp H., Effects
of intralipid and caffeic acid phenethyl ester on neurotoxicity, oxidative stress,
and acetylcholinesterase activity in acute chlorpyriphos intoxication,
International Journal of Clinical and Experimental Medicine 7(4) (2014),
s. 837-846
Kilic I., Yesiloglu Y., Spectroscopic studies on the antioxidant activity
of p-coumaric acid, Spectrochimica Acta Part A: Molecular and Biomolecular
Spectroscopy 115 (2013), s. 719-724
Garzón A., Bravo I., Barbero A. J., Albaladejo J., Mechanistic and Kinetic
Study on the Reactions of Coumaric Acids with Reactive Oxygen Species:
A DFT Approach, Journal od Agricultural and Food Chemistry 62 (2014),
s. 9705-9710
Bian Y-Y., Guo J., Majeed H., Zhu K-X., Guo X-N., Peng W., Zhou H-M.,
Ferulic acid renders protection to HEK293 cells against oxidative damage
and apoptosis induced by hydrogen peroxide, In Vitro Cellular &
Developmental Biology – Animal 51 (2015), s. 722-729
Cao Y-J., Zhang Y-M., Qi J-P., Liu R., Zhang H., He L-Ch., Ferulic acid
inhibits H2O2-induced oxidative stress and inflammation in rat vascular
smoothmuscle cells via inhibition of the NADPH oxidase and NF-κB pathway,
International Immunopharmacology 28 (2015), s. 1018-1025
Machado K. C., Oliveira G. L. S., de Sousa E. B. V., Costa I. H. F., Machado
K. C., de Sousa D. P., Satyal P., de Freitas R. M., Spectroscopic studies on the
in vitro antioxidant capacity of isopentyl ferulate, Chemico-Biological
Interactions 225 (2015), s. 47-53
Sompong W., Cheng H., Adisakwattana S., Glucose-Induced Protein
Glycation, Lipid Peroxidation, and Membrane Ion Pump Activity in Human
Erythrocytes, PLoS ONE 10(6): e0129495
Picone P., Nuzzo D., Di Carlo M., Ferulic Acid: a Natural Antioxidant
Against Oxidative Stress Induced by Oligomeric A-beta on Sea Urchin
Embryo, The Biological Bulletin 224 (2013), s. 18-28
Bacanlı M., Aydın S., Taner G., Göktas H. G., Sahin T., Basaran A. A.,
Basaran N., The protective role of ferulic acid on sepsis-inducedoxidative
damage in Wistar albino rats, Environmental Toxicology and Pharmacology
38 (2014), s. 774-782
Silambarasan T., Manivannan J., Priya M. K., Suganya N., Chatterjee S., Raja
B., Sinapic acid protects heart against ischemia/reperfusion injury and H9c2
cardiomyoblast cells against oxidative stress, Biochemical and Biophysical
Research Communications 456 (2015), s. 853-859
244
Nowe kierunki w badaniach biomedycznych kwasów hydroksycynamonowych
32. Xu J-G., Hu Q-P., Liu Y., Antioxidant and DNA-Protective Activities
of Chlorogenic Acid Isomers, Journal of Agricultural and Food Chemistry
60 (2012), s. 11625 -11630
33. Cha J. W., Piao M. J., Kim K. Ch., Yao Ch. W., Zheng J., Kim S. M., Hyun
Ch. L., Ahn Y. S., Hyun J. W., The Polyphenol Chlorogenic Acid Attenuates
UVB-mediated Oxidative Stress in Human HaCaT Keratinocytes,
Biomolecules and Therapeutics 22(2) (2014), s. 136-142
34. Pang Ch., Sheng Y-cC, Jiang P., Wei H., Ji L-l., Chlorogenic acid prevents
acetaminophen-induced liver injury: the involvement of CYP450 metabolic
enzymes anD some antioxidant signals, Biomedicine & Biotechnology 16(7)
(2015), s. 602-610
35. Yun N., Kang J-W., Lee S-M., Protective effects of chlorogenic acid against
ischemia/reperfusion injury in rat liver: molecular evidence of its antioxidant
and anti-inflammatory properties, Journal of Nutritional Biochemistry 23
(2012), s. 1249-1255
36. Koriem K. M. M., Soliman R. E., Chlorogenic and Caftaric Acids in Liver
Toxicity and Oxidative Stress Induced by Methamphetamine, Journal
of Toxicology (2015), http://dx.doi.org/10.1155/2014/583494
37. Mehni F., Sharififar F., Ansari M., Antioxidant activity and rosmarinic acid
content of ten medicinal plants, Research in Pharmaceutical Sciences 7(5) (2012)
38. Muñoz-Muñoz J. L., Garcia-Molina F., Ros E., Tudela J., García-Canovas F.,
Rodriguez-Lopez J. N., Prooxidant and antioxidant activities of rosmarinic
acid, Journal of Food Biochemistry (2011) doi:10.1111/j.17454514.2011.00639.x
39. Fadel O., Kirat K. E., Morandat S., The natural antioxidant rosmarinic acid
spontaneously penetrates membranes to inhibit lipid peroxidation in situ,
Biochimica et Biophysica Acta 1808 (2011), s. 2973-2980
40. Hajhosseini L., Khaki A., Merat E., Ainehchi N., Effect Of Rosmarinic Acid
On Sertoli Cells Apoptosis And Serum Antioxidant Levels In Rats After
Exposure To Electromagnetic Fields, African Journal of Traditional,
Complementary and Alternative Medicines 10(6) (2013), s. 477-480
41. Zhu F., Asada T., Sato A., Koi Y., Nishiwaki H., Tamura H., Rosmarinic Acid
Extract for Antioxidant, Antiallergic, and α‑Glucosidase Inhibitory Activities,
Isolated by Supramolecular Technique and Solvent Extraction from Perilla
Leaves, Journal of Agricultular and Food Chemistry 62 (2014), s. 885−892
42. Govindaraj J., Pillai S. S., Rosmarinic acid modulates the antioxidant status
and protects pancreatic tissues from glucolipotoxicity mediated oxidative
stress in high-fat diet: streptozotocin-induced diabetic rats, Molecular and
Cellular Biochemistry 404 (2015), s. 143-159
43. Mushtaq N., Schmatz R., Ahmed M., Pereira L. B., da Costa P., Reichert K.
P., Dalenogare D., Pelinson L. P., Vieira J. M., Stefanello N., de Oliveira L.
S., Mulinacci N., Bellumori M., Morsch V. M., Schetinger M. R., Protective
effect of rosmarinic acid against oxidative stress biomarkers in liver and
kidney of strepotozotocin-induced diabetic rats, Journal of Physiology and
Biochemistry (2015) DOI 10.1007/s13105-015-0438-4
245
Małgorzata Sieradzka, Joanna Kołodziejczyk-Czepas, Paweł Nowak
44. Zhang Y., Chen X., Yang L., Zu Y., Lu Q., Effects of rosmarinic acid on liver
and kidney antioxidant enzymes, lipid peroxidation and tissue ultrastructure
in aging mice, Food and Function 6 (2015), s. 927-931
45. Sato Y., Itagaki S., Kurokawa T., Ogura J., Kobayashi M., Hirano T.,
Sugawara M., Iseki K., In vitro and in vivo antioxidant properties
of chlorogenic acid and caffeic acid, International Journal of Pharmaceutics
403 (2011), s. 136-138
46. Celik S. E., Özyürek M., Tufan A. N., Güclü K., Apak R., Spectroscopic study
and antioxidant properties of the inclusion complexes of rosmarinic acid with
natural and derivative cyclodextrins, Spectrochimica Acta Part A 78 (2011),
s. 1615-1624
47. Terpinc P., Polak T., Ńegatin N., Hanzlowsky A., Ulrih N. P., Abramovic H.,
Antioxidant properties of 4-vinyl derivatives of hydroxycinnamic acids, Food
Chemistry 128 (2011), s. 62-69
48. Modrzejewska Z., Formy chitozanowe do zastosowań w inżynierii
biomedycznej, Inżynieria i Aparatura Chemiczna 50 (2011), s. 74-75
49. Woranuch S., Yoksana R., Preparation, characterization and antioxidant
property of water-soluble ferulic acid grafted chitosan, Carbohydrate
Polymers 96 (2013), s. 495-502
50. Lee D-S., Woo J-Y., Ahn Ch-B., Je J-Y., Chitosan – hydroxycinnamic acid
conjugates: Preparation, antioxidant and antimicrobial activity, Food
Chemistry 148 (2014), s. 97-104
51. Liu J., Wen X-Y., Lu J-F., Kan J., Jin Ch-H., Free radical mediated grafting
of chitosan with caffeic and ferulicacids: Structures and antioxidant activity,
International Journal of Biological Macromolecules 65 (2014), s. 97-106
52. Garrido J., Gaspar A., Garrido E. M., Miri R., Tavakkoli M., Pourali S., Saso
L., Borges F., Firuzi O., Alkyl esters of hydroxycinnamic acids with improved
antioxidant activity and lipophilicity protect PC12 cells against oxidative
stress, Biochimie 94 (2012), s. 961-967
53. Piazzon A., Vrhovsek U., Masuero D., Mattivi F., Mandoj F., Nardini M.,
Antioxidant Activity of Phenolic Acids and Their Metabolites: Synthesis and
Antioxidant Properties of the Sulfate Derivatives of Ferulic and Caffeic Acids
and of the Acyl Glucuronide of Ferulic Acid, Journal of Agricultural and Food
Chemistry 60 (2012), s. 12312−12323
54. Gaspar A., Martins M. Silva P., Garrido E.M., Garrido J., Firuzi O., Miri R.,
Saso L., Borges F., Dietary Phenolic Acids and Derivatives. Evaluation of the
Antioxidant Activity of Sinapic Acid and Its Alkyl Esters, Journal Agricultural
and Food Chemistry 58 (2010), s. 11273-11280
55. Wang J., Gu S-S., Pang N., Wang F-Q,, Pang F., Cui H-S., Wu X-Y., Wu FA., Alkyl Caffeates Improve the Antioxidant Activity, Antitumor Property and
Oxidation Stability of Edible Oil, PLoS ONE 9(4) (2014) e95909
56. Lim K-M., Bae S., Koo J. E., Kim E-S., Bae O-N, Lee J. Y., Suppression
of skin inflammation in keratinocytes and acute/chronic disease models by
caffeic acid phenethyl ester, Archives of Dermatological Research 307 (2015),
s. 219-227
246
Nowe kierunki w badaniach biomedycznych kwasów hydroksycynamonowych
57. Juman S., Yasui N., Ikeda K., Ueda A., Sakanaka M., Negishi H., Mikia T.,
Caffeic Acid Phenethyl Ester Suppresses the Production of Proinflammatory
Cytokines in Hypertrophic Adipocytes through Lipopolysaccharide-Stimulated
Macrophages, Biological and Pharmaceutical Bulletin 35(11) (2012),
s. 1941-1946
58. Song J-J., Lim H. W., Kim K., Kim K-M., Cho S., Chae S-W., Effect of caffeic
acid phenethyl ester (CAPE) on H2O2 induced oxidative and inflammatory
responses in human middle ear epithelial cells, International Journal
of Pediatric Otorhinolaryngology 76 (2012), s. 675-679
59. Yang W. S., Jeong D.,1 Yi Y-S., Park J. G., Seo H., Moh S. H., Hong S., Cho
J. Y., IRAK1/4-Targeted Anti-Inflammatory Action of Caffeic Acid (2013)
http://dx.doi.org/10.1155/2013/518183
60. Choi E-Y., Choe S-H., Hyeon J-Y., Choi J-I., Choi I. S., Kim S-J., Effect
of caffeic acid phenethyl ester on Prevotella intermedia lipopolysaccharideinduced production of proinflammatory mediators in murine macrophages,
Journal of Periodontal Research (2015), doi:10.1111/jre.12260
61. Gamaro G. D., Suyenaga E., Borsoi M., Lermen J., Pereira P., Ardenghi P.,
Effect of Rosmarinic and Caffeic Acids on Inflammatory and Nociception
Process in Rats, (2011), doi:10.5402/2011/451682
62. Ak H., Gülşen I., Karaaslan T., Alaca I., Candan A., Koçak H., Atalay T.,
Çelikbilek A., Demir I., Yılmaz T., The effects of caffeic acid phenethyl ester
on inflammatory cytokines after acute spinal cord injury, Journal of Trauma
and Emergency Surgery 21(2) (2015), s. 96-101
63. Lim K-M., Bae S., Koo J.E., Kim E-S., Bae O-N., Lee J. Y., Suppression
of skin inflammation in keratinocytes and acute/chronic disease models by
caffeic acid phenethyl ester, Archives of Dermatological Research 307 (2015),
s. 219-227
64. Tsai S-J., Chao Ch-Y., Yin M-Ch., Preventive and therapeutic effects
of caffeic acid against inflammatory injury in striatum of MPTP-treated mice,
European Journal of Pharmacology 670 (2011), s. 441-447
65. Pragasam S. J., Venkatesan V., Rasool M., Immunomodulatory and Antiinflammatory Effect of p-Coumaric Acid, a Common Dietary Polyphenol on
Experimental Inflammation in Rats, Inflammation 36 (1) (2013)
66. Pragasam S. J., Rasool M .K., Dietary component p-coumaric acid suppresses
monosodium urate crystal-induced inflammation in rats, Inflammation
Research 62 (2013), s. 489-498
67. Zhu H., Liang Q-H., Xiong X-G., Chen J., Wu D., Wang Y., Yang B., Zhang
Y., Zhang Y., Huang X., Anti-Inflammatory Effects of the Bioactive
Compound Ferulic Acid Contained in Oldenlandia diffusa on CollagenInduced Arthritis in Rats (2014) http://dx.doi.org/10.1155/2014/573801
68. Shi H., Dong L., Dang X., Liu Y., Jiang J., Wang Y., Lu X., Guo X., Effect
of chlorogenic acid on LPS-induced proinflammatory signaling in hepatic
stellate cells, Inflammation Research 62 (2013), s. 581-587
69. Hwang S.J., Kim Y-W., Park Y., Lee H-J., Kim K-W., Anti-inflammatory
effects of chlorogenic acid in lipopolysaccharide-stimulated RAW 264.7 cells,
Inflammation Research 63 (2014), s. 81-90
247
Małgorzata Sieradzka, Joanna Kołodziejczyk-Czepas, Paweł Nowak
70. Chen W-P., Wu L-D., Chlorogenic acid suppresses interleukin-1β-induced
inflammatory mediators in human chondrocytes, International Journal of
Clinical and Experimental Pathology 7(12) (2014), s. 8797-8801
71. Guo Y-J., Luo T., Wu F., Mei Y-W., Peng J., Liu H., Li H-R., Zhang S-L.,
Dong J-H., Fang Y., Zhao L., Involvement of TLR2 and TLR9 in the antiinflammatory effects of chlorogenic acid in HSV-1-infected microglia, Life
Sciences 127 (2015), s. 12-18
72. Hebeda C. B., Bolonheis S. M., Nakasato A., Belinati K., Souza P. D. C.,
Gouvea D. R., Lopes N. P., Farskya S. H. P., Effects of chlorogenic acid on
neutrophil locomotion functions in response to inflammatory stimulus, Journal
of Ethnopharmacology 135 (2011), s. 261-269
73. Shin H. S., Satsu H., Bae M-J., Zhao Z., Ogiwara H., Totsuka M., Shimizu M.,
Anti-inflammatory effect of chlorogenic acid on the IL-8 production in Caco-2
cells and the dextran sulphate sodium-induced colitis symptoms in C57BL/6
mice, Food Chemistry 168 (2015), s. 167-175
74. Luan H., Kan Z., Xu Y., Lv Ch., Jiang W., Rosmarinic acid protects against
experimental diabetes with cerebral ischemia: relation to inflammation
response, Journal of Neuroinflammation 10:28 (2013)
75. Yang E-J., Ku S-K., Lee W., Lee S., Lee T., Song K-S., Bae J-S., Barrier
Protective Effects of Rosmarinic Acid on HMGB1- Induced Inflammatory
Responses In Vitro and In Vivo, Journal of Cellular Physiology 228 (2013),
s. 975-982
76. Govindaraj J., Pillai S. S. Rosmarinic acid modulates the antioxidant status
and protects pancreatic tissues from glucolipotoxicity mediated oxidative
stress in high-fat diet: streptozotocin-induced diabetic rats, Molecular and
Cellular Biochemistry 404 (2015), s.143-159
77. Chu X., Ci X., He J., Jiang L., Wei M., Cao Q., Guan M., Xie X., Deng X., He
J., Effects of a Natural Prolyl Oligopeptidase Inhibitor, Rosmarinic Acid, on
Lipopolysaccharide-Induced Acute Lung Injury in Mice, Molecules 17 (2012),
s. 3586-3598
78. Rocha J., Eduardo-Figueira M., Barateiro A., Fernandes A., Brites D., Bronze
R., Duarte C. M. M., Serra A. T., Pinto R., Freitas M., Fernandes E., SilvaLima B., Mota-Filipe H., Sepodes B., Anti-inflammatory Effect of Rosmarinic
Acid and an Extract of Rosmarinus officinalis in Rat Models of Local and
Systemic Inflammation, Basic & Clinical Pharmacology & Toxicology 116
(2015), s. 398-413
79. Fan Y. T., Yin G..J, Xiao W.Q., Qiu L., Yu G., Hu Y. L., Xing M., Wu D. Q.,
Cang X. F., Wan R., Wang X. P., Hu G. Y.. Rosmarinic acid attenuates
sodium taurocholate-induced acute pancreatitis in rats by inhibiting nuclear
factor-κB activation, The American Journal of Chinese Medicine 43 (2015),
s. 1117-35
80. Nunes S., Madureira R., Campos D., Sarmento B., Gomes A.M., Pintado M.,
Reis F.,Therapeutic and Nutraceutical Potential of Rosmarinic Acid
– Cytoprotective Properties and Pharmacokinetic Profile,Critical Reviews
in Food Science and Nutrition (2015), DOI: 10.1080/10408398.2015.1006768
248
Nowe kierunki w badaniach biomedycznych kwasów hydroksycynamonowych
81. Kim G. D., Park Y. S., Jin Y. H., Park C. S., Production and applications
of rosmarinic acid and structurally related compounds, Applied Microbiology
and Biotechnology 99(5) (2015), s. 2083-92
82. Huang N., Hauck C., Yum M-Y., Rizshsky L., Widrlechner M. P., McCoy JA., Murphy P. A., Dixon P. M., Nikolau B. J., Birt D. F., Rosmarinic Acid
in Prunella vulgaris Ethanol Extract Inhibits Lipopolysaccharide-Induced
Prostaglandin E2 and Nitric Oxide in RAW 264.7 Mouse Macrophages,
Journal Agricultural and Food Chemistry 57 (2009), s. 10579-10589
83. Boonyarikpunchai W., Sukrong S., Towiwat P., Antinociceptive and antiinflammatory effects of rosmarinic acid isolated from Thunbergia laurifolia
Lindl., Pharmacology, Biochemistry and Behavior 124 (2014), s. 67-73
84. Chagas-Paula D. A., de Oliveiraa R. B., da Silva V. C., Gobbo-Neto L.,
Gasparotoc T. H., Campanellic A. P., Faccioli L. H., Da Costaa F. B.,
Chlorogenic acids from Tithonia diversifolia demonstrate better antiinflammatory effect than indomethacin and its sesquiterpene lactones, Journal
of Ethnopharmacology 136 (2011), s. 355-362
85. Park S-Y., Hwang J-S., Jang M., Lee S. H., Park J-H., Han I-O., A novel
caffeic acid-1-piperonylpiperazine hybridization compound HBU-47 inhibits
LPS-mediated inflammation in RAW264.7 macrophage cells, International
Immunopharmacology 19 (2014), s. 60-65
86. Pittalà V., Salerno L., Romeo G., Siracusa M. A., Modica M. N., Romano G.
L., Salomone S., Drago F., Bucolo C., Effects of novel hybrids of caffeic acid
phenethyl ester and NSAIDs on experimental ocular inflammation, European
Journal of Pharmacology752 (2015), s. 78-83
87. Kim E. O., Min K. J., Kwon T. K., Um B. H., Moreau R. A., Choi S. W., Antiinflammatory activity of hydroxycinnamic acid derivatives isolated from corn
bran in lipopolysaccharide-stimulated Raw 264.7 macrophages, Food and
Chemical Toxicology 50 (2012), s. 1309-1316
88. Du W-Y., Chang Ch., Zhang Y., Liu Y-Y., Sun K., Wang Ch-S., Wang M-X.,
Liu Y., Wang F., Fan J-Y., Li P-T., Han J-Y., High-dose chlorogenic acid
induces inflammation reactions and oxidative stress injury in rats
withoutimplication of mast cell degranulation, Journal
ofEthnopharmacology147(2013), s. 74-83
89. Rocha L. D., Monteiro M. C., Teodoro A. J., Anticancer properties of hydroxycinnamic acids – a review, Cancer and Clinical Oncology 1 (2012), s. 109-121
90. Su P., Shi Y., Wang J., Shen X., Zhang J., Anticancer agents derived from
natural cinnamic acids, Anti-Cancer Agents in Medicinal Chemistry 15
(2015), s. 980-987
91. Karthikeyan S., Kanimozhi G., Prasad N. R., Mahalakshmi R.,
Radiosensitizing effect of ferulic acid on human cervical carcinoma cells
in vitro, Toxicology in Vitro 25 (2011), s. 1366-1375
92. Dodurga Y., Eroğlu C., Seçme M., Elmas L., Avcı Ç.B., Şatıroğlu-Tufan N.
L., Anti-proliferative and anti-invasive effects of ferulic acid in TT medullary
thyroid cancer cells interacting with URG4/URGCP, Tumour Biology 2015
(artykuł w druku)
249
Małgorzata Sieradzka, Joanna Kołodziejczyk-Czepas, Paweł Nowak
93. Eroğlu C., Seçme M., Bağcı G., Dodurga Y., Assessment of the anticancer
mechanism of ferulic acid via cell cycle and apoptotic pathways in human
prostate cancer cell lines, Tumor Biology 2015; doi:10.1007/s13277-015-3689-3
94. Yang G.-W., Jiang J.-S., Lu W.-Q., Ferulic acid exerts anti-angiogenic and
anti-tumor activity by targeting fibroblast growth factor receptor 1-mediated
angiogenesis, International Journal of Molecular Sciences 16 (2015),
s. 24011-24031
95. Choi Y. E., Park E., Ferulic acid in combination with PARP inhibitor
sensitizes breast cancer cells as chemotherapeutic strategy, Biochemical and
Biophysical Research Communications 458 (2015), s. 520-524
96. Fahrioğlu U., Dodurga Y., Elmas L., Seçme M., Ferulic acid decreases cell
viability and colony formation while inhibiting migration of MIA PaCa-2
human pancreatic cancer cells in vitro, Gene (2015) artykuł w druku
97. Manoharan S., Rejitharaji T., Prabhakar M. M., Manimaran A., Singh R. B.,
Modulating effect of ferulic acid on NF-κB, COX-2 and VEGF expression
pattern during 7,12-Dimethylbenz(a)anthracene induced oral carcinogenesis,
The Open Nutraceuticals Journal 7 (2014), s. 33-38
98. Wang J.-M., Sheng Y.-C., Ji L.-L., Wang Z.-T., Ferulic acid prevents liver
injury and increases the anti-tumor effect of diosbulbin B in vivo, Journal of
Zhejiang University SCIENCE B 15 (2014), s. 540-547
99. Prasad N. R., KarthikeyanA., Karthikeyan S., Reddy B. V., Inhibitory effect
of caffeic acid on cancer cell proliferation by oxidative mechanism in human
HT-1080 fibrosarcoma cell line, Molecular and Cellular Biochemistry 349
(2011), s. 11-19
100. Zambonin L., Caliceti C., Dalla Sega F. V., Fiorentini D., Hrelia S., Landi L.,
Prata C., Dietary phenolic acids act as effective antioxidants in membrane
models and in cultured cells, exhibiting proapoptotic effects in leukaemia
cells, Oxidative Medicine and Cell Longevity (2012),
doi:10.1155/2012/839298
101. Sen A., Atmaca P., Terzioglu G., Arslan S., Anticarcinogenic effect and
carcinogenic potential of the dietary phenolic acid: o-coumaric acid, Natural
Product Communications 8 (2013), s. 1269-1274
102. Kong C.-S., Jeong C.-H., Choi J.-S., Kim K.-J., Jeong J.-W., Antiangiogenic
effects of p-coumaric acid in human endothelial cells, Phytotherapy Research
27 (2013), s. 317-323
103. Yang J. S., Liu C. W., Ma Y. S., Weng S. W., Tang N. Y., Wu S. H., Ji B. C.,
Ma C. Y., Ko Y. C., Funayama S., Kuo C. L., Chlorogenic acid induces
apoptotic cell death in U937 leukemia cells through caspase- and
mitochondria-dependent pathways, In Vivo 26 (2012), s. 971-978
104. Liu Y.-J., Zhou C.-Y, Qiu C.-H., Lu X.-M., Wang Y.-T. Chlorogenic acid
induced apoptosis and inhibition of proliferation in human acute
promyelocytic leukemia HL-60 cells, Molecular Medicine Reports 8 (2013),
s. 1106-1110
105. Park J. J., Hwang S. J., Park J.-H., Lee H.-J., Chlorogenic acid inhibits
hypoxia-induced angiogenesis via down-regulation of the HIF-1α/AKT
pathway, Cellular Oncology 38 (2015), s. 111-118
250
Nowe kierunki w badaniach biomedycznych kwasów hydroksycynamonowych
106. Yan Y., Li J., Han J., Hou N., Song Y., Dong L., Chlorogenic acid enhances
the effects of 5-fluorouracil in human hepatocellular carcinoma cells through
the inhibition of extracellular signal-regulated kinases, Anti-Cancer Drugs 26
(2015), s. 540-546
107. Alcaraz M., Alcaraz-Saura M., Achel D. G., Olivares A., López-Morata J.A.,
Castillo J. Radiosensitizing effect of rosmarinic acid in metastatic melanoma
B16F10 cells, Anticancer Research 34 (2014), s. 1913-1921
108. Sharmila R., Manoharan S., Anti-tumor activity of rosmarinic acid in 7,12dimethylbenz(a)anthracene (DMBA) induced skin carcinogenesis in Swiss
albino mice. Indian Journal of Experimental Biology (50) 2012, s. 187-194
109. Nasr Bouzaiene N., Kilani Jaziri S., Kovacic H., Chekir-Ghedira L., Ghedira
K., Luis J., The effects of caffeic, coumaric and ferulic acids on proliferation,
superoxide production, adhesion and migration of human tumor cells in vitro,
European Journal of Pharmacology (2015) doi: 10.1016/j.ejphar.2015.09.044
110. Tsai C. M., Yen G. C., Sun F. M., Yang S. F., Weng C. J., Assessment of the
anti-invasion potential and mechanism of select cinnamic acid derivatives
on human lung adenocarcinoma cells, Molecular Pharmaceutics 10 (2013),
s. 1890-1900
111. Li Y., Jiang F., Chen L., Yang Y., Cao S., Ye Y., Wang X., Mu J., Li Z., Li L.,
Blockage of TGFα-SMAD2 by demethylation-activated miR-148a is involved
in caffeic acid-induced inhibition of cancer stem cell-like properties in vitro
and in vivo, FEBS Open Bio 5 (2015) 466-475
112. Skórka K., Giannopoulos K., Budowa i funkcje jądrowego czynnika
transkrypcyjnego NF kappa B (NF-κB) oraz jego znaczenie w przewlekłej
białaczce limfocytowej, Acta Haematologica Polonica 43 (2012) 54-62
113. Ozturk G., Ginis Z., Akyol S., Erden G., Gurel A., Akyol O., The anticancer
mechanism of caffeic acid phenethyl ester (CAPE): review of melanomas, lung
and prostate cancers, European Review for Medical and Pharmacological
Sciences 16 (2012), s. 2064-2068
114. Akyol S., Ozturk G., Ginis Z., Armutcu F., Yigitoglu M. R., Akyol O., In vivo
and in vitro antıneoplastic actions of caffeic acid phenethyl ester (CAPE):
therapeutic perspectives, Nutrition and Cancer 65 (2013), s. 515-526
115. Omene C., Kalac M., Wu J., Marchi E., Frenkel K., O’Connor O. A., Propolis
and its active component, caffeic acid phenethyl ester (CAPE), modulate
breastcancer therapeutic targets via an epigenetically mediated mechanism
of action, Journal of Cancer Sciences and Therapy 5 (2013), s. 334-342
116. Ketabforoosh H. E., Amini M., Vosooghi M., Shafee A., Azizi E., Kobarfard
F. Synthesis, evaluation of anticancer activity and QSAR study of heterocyclic
esters of caffeic acid, Iranian Journal of Pharmaceutical Research 12 (2013),
s. 705-719
117. Eom T. K., Senevirathne M., Kim S. K., Synthesis of phenolic acid conjugated
chitooligosaccharides and evaluation of their antioxidant activity,
Environmental Toxicology and Pharmacology 2 (2012), s. 519-527
118. Lee S.J., Kang M.-S., Oh J.-S., Na H.S., Lim Y.J., Jeong Y.-I., Lee H.-C.,
Caffeic acid-conjugated chitosan derivatives and their anti-tumor activity,
Archives of Pharmacal Research 36 (2013), s. 1437-1446
251
Małgorzata Sieradzka, Joanna Kołodziejczyk-Czepas, Paweł Nowak
119. Lee S. J., Choi K. C., Kang M. S., Oh J. S., Jeong Y. I., Lee H. C., Selforganized nanoparticles of caffeic acid cConjugated polysaccharide and its
anticancer activity, Journal of Nanoscience and Nanotechnology 15 (2015),
s. 1130-1134
120. Peng W., Wu J. G., Jiang Y. B., Liu Y. J., Sun T., Wu N., Wu C. J., Antitumor
activity of 4-O-(2″-O-acetyl-6″-O-p-coumaroyl-β-D-glucopyranosyl)-pcoumaric acid against lung cancers via mitochondrial-mediated apoptosis,
Chemico-Biological Interactions 233 (2015), s. 8-13
121. Chen H. Z., Chen Y. B., Lv Y. P., Zeng F., Zhang J., Zhou Y. L., Li H. B.,
Chen L. F., Zhou B. J., Gao J. R., Xia C. N., Synthesis and antitumor activity
of feruloyl and caffeoyl derivatives, Bioorganic & Medicinal Chemistry
Letters 24 (2014), s. 4367-4371
122. Dikmen G., Güney G., Genç L., Characterization of solid lipid nanoparticles
containing caffeic acid and determination of its effects on MCF-7 cells, Recent
Patents on Anti-Cancer Drug Discovery 10 (2015), s. 224-232
123. Kim H.-J., Ryu K., Kang J.-H., Choi A.-J., Kim T., Oh J.-M., Anticancer
activity of ferulic acid-inorganic nanohybrids synthesized via two different
hybridization routes, reconstruction and exfoliation-reassembly, The
Scientific World Journal (2013) doi:10.1155/2013/421967
124. Naso L. G., Valcarcel M., Roura-Ferrer M., Kortazar D., Salado C., Lezama
L., Rojo T., González-Baró A. C., Williams P. A., Ferrer E. G., Promising
antioxidant and anticancer (human breast cancer) oxidovanadium(IV)
complex of chlorogenic acid. Synthesis, characterization and spectroscopic
examination on the transport mechanism with bovine serum albumin, Journal
of Inorganic Biochemistry 135 (2014), s. 86-99
125. Lewandowska U., Gorlach S., Owczarek K., Hrabec E., Szewczyk K.,
Synergistic Interactions Between Anticancer Chemotherapeutics and Phenolic
Compounds and Anticancer Synergy Between Polyphenols, Postępy Higieny
i Medycyny Doświadczalnej 68 (2014), s. 528-540
126. Dębska S., Kubicka J., Czyżykowski R., Habib M., Potemski P., Inhibitory
PARP – podstawy teoretyczne i zastosowanie kliniczne, Postepy Higieny
i Medycyny Doświadczalnej 66 (2012), s. 311-321
127. Choi Y. E., Park E., Ferulic acid in combination with PARP inhibitor
sensitizes breast cancer cells as chemotherapeutic strategy, Biochemical
and Biophysical Research Communications 458 (2015), s. 520-524
128. Thakkar A., Chenreddy S., Wang J., Prabhu S., Ferulic acid combined with
aspirin demonstrates chemopreventive potential towards pancreatic cancer
when delivered using chitosan-coated solid-lipid nanoparticles,
Cell & Bioscience (2015) doi:10.1186/s13578-015-0041-y
129. Eitsuka T., Tatewaki N., Nishida H., Kurata T., Nakagawa K., Miyazawa T.,
Synergistic inhibition of cancer cell proliferation with a combination
of α-tocotrienol and ferulic acid, Biochemical and Biophysical Research
Communications 453 (2014), s. 606-611
252
Nowe kierunki w badaniach biomedycznych kwasów hydroksycynamonowych
Nowe kierunki w badaniach biomedycznych kwasów
hydroksycynamonowych
W literaturze znaleźć można wiele informacji na temat biologicznej aktywności związków
polifenolowych, głównie flawonoidów. Mniej poznaną grupą związków pozostają natomiast
roślinne kwasy fenolowe, w tym kwasy hydroksycynamonowe. W ostatnich latach wzrasta
jednak znacząco zainteresowanie naukowców tymi związkami. Najnowsze dane dostarczają
informacji na temat przeciwutleniającego, przeciwzapalnego oraz przeciwnowotworowego
działania fenolokwasów. Szeroki zakres działania biologicznego, jak również możliwość
modulowania i zwiększania farmakologicznej aktywności fenolokwasów sprawia, że związki te
stały się przedmiotem wielu badań biomedycznych.
New trends in biomedical research on hydroxycinnamic acids
Current literature provides a lot of information about biological activity of polyphenolic
compounds, mainly flavonoids. Plant phenolic acids, including hydroxycinnamic acids
(hydroxycinnamates), remain a less known group of compounds. However, scientific interest in
these compounds has increased significantly in recent years. The newest data provide information
on antioxidant, anti-inflammatory and anti-tumor activities of phenolic acids.
These compounds have become subjects of numerous biomedical investigations owing to a broad
range of biological action as well as the possibility of modulation and enhancement of their
pharmacological activity.
253
Aleksandra Kruk1, Agnieszka Gadomska-Gajadhur2, Paweł Ruśkowski3
Wpływ prekursorów porów
na morfologię membran półprzepuszczalnych
przeznaczonych do hodowli komórkowych
1. Wstęp
Hodowle komórkowe w ostatnich latach zyskały bardzo dużą
popularność w naukach medycznych oraz przyczyniły się do rozwoju
inżynierii tkankowej, dziedziny, której głównym celem jest regeneracja
uszkodzonych, trudno odnawiających się tkanek.
Przez wiele lat tradycyjne badania in vitro, dotyczące komórek
prowadzono wykorzystując modele dwuwymiarowe. Komórki były
hodowane w podłożach mikrobiologicznych umieszczonych na płytkach,
szlakach Petriegolub w podłożu płynnym. Wraz z upływem czasu zaczęto
się zastanawiać nad słusznością tych badań. Stwierdzono, że warunki jakie
panują w hodowlach płaskich znacznie odbiegają od tych, które występują
w tkance. W modelach tych nie dochodzi do interakcji międzykomórkowe,
jakie mają miejsce w rzeczywistości w przestrzeni trójwymiarowej.
Oddziaływania te są odpowiedzialne za wzajemną komunikację komórek
w obrębie jednej tkanki, jak i sąsiadujących oraz za dostarczanie odpowiednich substancji odżywczych, czy cząsteczek sygnałowych niezbędnych
do wzrostu.
Na tej podstawie stwierdzono, że tkankę należy traktować jako skomplikowaną, trójwymiarową sieć połączeń, w której kluczowym elementem jest
struktura przestrzenna. Ponadto dowiedziono, że komórki wyhodowane
w modelach 2D mają zmieniony wzrost, metabolizm i ekspresję genów,
w porównaniu do komórek wyhodowanych naturalnie.
To wszystko spowodowało, że zaczęto poszukiwać metod hodowli
komórek oddających możliwie jak najlepiej trójwymiarową strukturę
tkanki. Jedną z technik pozwalających na prowadzenie hodowli 3D, są
1
[email protected], Laboratorium Procesów Technologicznych, Wydział Chemiczny,
Politechnika Warszawskaprzypisie zachowujemy zasadę od komórki organizacyjnej najniższego
stopnia do wyższych
2
[email protected], Laboratorium Procesów Technologicznych, Wydział Chemiczny,
Politechnika Warszawska
3
[email protected], Laboratorium Procesów Technologicznych, Wydział
Chemiczny, Politechnika Warszawska
254
Wpływ prekursorów porów na morfologię membran półprzepuszczalnych
przeznaczonych do hodowli komórkowych
rusztowania polimerowe, znane również pod angielskojęzyczną nazwą
Scaffolds. Rusztowania te stanowią przestrzenną sieć wzajemnie połączonych ze sobą porów, której głównym zadaniem jest fizyczne utrzymanie
komórekw przestrzeni [1‚4].
Rusztowania do hodowli komórkowych mają często formę membran
półprzepuszczalnych. Oznacza to, że do ich wnętrza mogą jedynie
przedostawać się cząstki o określonym, maksymalnym rozmiarze. Z tej
przyczyny do hodowli określonego typu komórek, membrana musi
posiadać pory o danej wielkości, występujące nie tylko we wnętrzu, ale
także i na powierzchni. W przeciwnym przypadku, komórki nie dostaną się
do środka rusztowania, pozostaną na jego powierzchni, czyli powstanie
hodowla 2D.
Do wytwarzania rusztowań wykorzystuje się przede wszystkim
polimery, zarówno pochodzenia naturalnego, jak i syntetyczne oraz
ulegającelub nieulegające biodegradacji. Wśród polimerów syntetycznych
często wykorzystywanym jest polilaktyd (PLA). Jest to alifatyczny
poliester pozyskiwany ze źródeł odnawialnych (kukurydza, trzcina
cukrowa). Zbudowany jest z połączonych ze sobą liniowo cząsteczek
kwasu mlekowego (LAc).LAcwystępuje w postaci dwóch enancjomerów,
w wyniku czego mogą powstawać polimery różniące się konfiguracją
centrów chiralnych, o odmiennych właściwościach fizycznych (Rysunek
1). Polilaktydhomochiralny, zbudowany jedynie z cząsteczek kwasu L- lub
D-mlekowego (PLLA, PDLA) charakteryzuje się wysoką wytrzymałością
mechaniczną oraz długim czasem biodegradacji, wzrastającym wraz z masą
molową polimeru. Inne właściwości ma polilaktydheterochiralny,
zawierający w strukturze oba enancjomery kwasu mlekowego. Jest on
bardziej elastyczny oraz ulega szybszej degradacji. Przez organizm
przyswajalny jest jedynie izomer kwasu L-mlekowego. Enancjomer
o konfiguracji D może odkładać się w ustroju, powodując w konsekwencji
jego zakwaszenie. Z tych względów największe znaczenie w zastosowaniu
farmaceutycznym ma PLLA o małej masie molowej oraz PLA
z kilkuprocentowym dodatkiem centrów o konfiguracji D.
Polilkatyd jest polimerem biodegradowalnym, który ulega w organizmie
enzymatycznemu, dwuetapowemu rozkładowi. W pierwszym etapie
następuje hydroliza PLA do oligomerów kwasu mlekowego, które
następnie są przekształcane w cyklu kwasu cytrynowego do dwutlenku
węgla i wody [5‚9].
255
Aleksandra Kruk, Agnieszka Gadomska-Gajadhur, Paweł Ruśkowski
H3C
H
H
CH3
OH
OH
HO
HO
O
O
kwas D-mlekowy
kwas L-mlekowy
Rysunek 1.Enancjomery kwasu mlekowego
Innymi popularnymi,biodegradowlnymi polimerami syntetycznymi są poliε-kaprolakton, poliglikolid oraz ich kopolimery (także z PLA). Spośród
polimerów nieulegających biodegradacji, stosuje się m.in.polisulfon oraz
polieterosulfon.
W inżynierii tkankowej stosuje się także polimery naturalne tj. chitozan,
elastyna, kolagen czy kwas hialuronowy. Związki te oprócz tego, że stanowią
materiał budujący rusztowanie, to również mogą być substancjami
odżywczymi dla komórek, co jest ich niewątpliwą zaletą. Mimo to, nie są one
najlepszym materiałem do wytwarzania rusztowań,ze względu na niższą
wytrzymałość mechaniczną w porównaniu do polimerów syntetycznych.
Ponadto są one niestabilne w warunkach zmiany temperatury oraz odczynu
środowiska, co stwarza poważne problemy technologiczne. Zaletą polimerów
syntetycznych w porównaniu do naturalnych, jest możliwość sterowana
czasem degradacji rusztowania, poprzez dobieranie odpowiedniej długości
łańcucha polimerowego [10‚13].
Istnieje wiele technik otrzymywania rusztowań komórkowych. Jedną z nich
jest metoda inwersji faz (Rysunek 2). Charakteryzuje się ona łatwością
i prostotą wykonania. Ponadto nie wymaga skomplikowanej aparatury, co
z kolei nie generuje wysokich kosztów inwestycyjnych. Ograniczenia tej
techniki to przede wszystkim konieczność dokładnej kontroli warunków
otoczenia oraz ryzyko pozostałości rozpuszczalników i prekursorów porów.
Metoda ta polega na wylaniu roztworu polimeru membrantwórczego na
obojętny podkład (np. szklaną płytkę), równomiernym rozprowadzeniu,
a następnie zanurzeniu w kąpieli żelującej, składającej się z nierozpuszczalnika
polimeru [14, 15]. Wariantem tej metody jest dodatek prekursora porów
(Rysunek 3), którego zadaniem jest wniknięcie między łańcuchy polimeru
i odkształcenie tam porów. Na końcu procesu prekursor usuwa się ze struktury
membrany, poprzez wypłukanie (w kąpieli żelującej lub w dodatkowej kąpieli
płuczącej). Jako prekursory porów stosuje się głównie kryształy soli
nieorganicznych (np. NaCl, LiCl, LiF) oraz polimery tj. poliwinylopirolidon
(PVP) czy poli(glikol etylenowy) (PEG). Oprócz wyżej wymienionych
polimerowych substancji porotwórczych, popularny jest także trójblokowy
256
Wpływ prekursorów porów na morfologię membran półprzepuszczalnych
przeznaczonych do hodowli komórkowych
kopolimerpoli (oksyetylen-b-oksypropylen-b-oksyetylen), znany pod handlową nazwą Pluronic®.Dzięki swej amfifilowej budowie zwiększa on hydrofilowość membran, co obniża ryzyko foulingu białkowego (zapychania
porów związkami białkowymi, występującymi w organizmach) [14, 16].
Rysunek 2. Metoda inwersji faz [15]
Rysunek 3. Metoda inwersji faz z zastosowaniem prekursora porów [16]
2. Cel pracy
Celem niniejszej pracy było zbadanie wpływu dodatku prekursorów
porów takich jak: PVP, Pluronic® oraz NaCl, na morfologię membran
półprzepuszczalnych przeznaczonych do hodowli komórkowych.
3. Materiały i metody
W badaniach użyto poli-L-laktydo Mn 86 000 g/mol (Nature Works NW
2003D), PVP o Mn 10 000 g/mol (Sigma Aldrich, Pluronic® f127) Mn3 600
g/mol(Sigma Aldrich) oraz NaCl (Cenos). Użytymi rozpuszczalnikami
były: chloroform (cz.d.a. POCh SA)i metanol (cz.d.a. POCh SA). Wodę
destylowaną otrzymano we własnym zakresie.
Przygotowanie roztworów
Roztwory PLLA w chloroformieo stężeniu 6%wagotrzymano, poprzez
rozpuszczanie polimeru przez 24h w rozpuszczalniku organicznym (ChCl3).
Podczas rozpuszczania poli-L-laktydu zapewniono ciągłe mieszanie, przy
użyciu mieszadła magnetycznego bez grzania. Roztwory zawierające
prekursory porów otrzymano w analogiczny sposóbz tą różnicą, że po
całkowitym rozpuszczeniu PLLA, dodano substancje porotwórcze
257
Aleksandra Kruk, Agnieszka Gadomska-Gajadhur, Paweł Ruśkowski
w stosunku wagowym 1:1 do poli-L-laktydu. W przypadku mieszanin
prekursorów porów stosunek wagowy substancji w roztworze wynosił
10:5:5 (PLLA:prekursor1:prekursor2). Po dodaniu prekursorów porów,
mieszanie kontynuowano przez kolejne 24 h. W przypadku NaCl, kryształy
soli przed dodaniem do roztworu membranotwórczego, rozdrobniono za
pomocą moździerza i przesiano przy użyciu sit mikrobiologicznych, po
czym zebrano frakcję o rozmiarze <70 µm.
Otrzymanie membran polilaktydowych
Membrany otrzymano metodą inwersji faz. Sporządzone roztwory wylano
na szklany podkład, a następnie rozprowadzono po całej powierzchni. Po
uformowaniu roztworu, membranę żelowano wmetanolu.
Z membran otrzymanych z dodatkiem polimerowych prekursorów
porów (PVP, Pluronic®), substancje te usunięto jeszcze w kąpieli żelującej,
gdyż oba te polimery rozpuszczają się w metanolu. W przypadku membran
otrzymanych z dodatkiem NaCl, sól usunięto poprzez zastosowanie kąpieli
płuczącej, składającej się z wody destylowanej. Podobnie postąpiono
z membranami otrzymanymi z wykorzystaniem NaClwraz z PVP (obie
substancje rozpuszczają się w wodzie).
Po wyżelowaniu polimeru membranotwórczego i usunięciu substancji
porotwórczych, membrany wysuszono na powietrzu.
Metody analityczne
Morfologię otrzymanych membran zbadano za pomocą skaningowego
mikroskopu elektronowego (ang. Scanning Electron Microscopy, SEM)
Hitachi TM1000. Próbki membran przed badaniem zanurzono w etanolu,
a następnie połamano w ciekłym azocie. Po wysuszeniu, próbki membran
pokryto warstwą złota 7-10 nm przy użyciu aparatu K550X Sputter Coater.
Pokryte złotem próbki badano w różnych powiększeniachpod napięciem
przyspieszania 15 kV.
4. Wyniki
W Tabeli 1 przedstawiono morfologię membran z poli-L-laktydu
otrzymanych bez dodatku prekursorów porów.Można zaobserwować, że
powierzchnia I zawiera nieliczne, bardzo małe pory (poniżej 5 µm) oraz lekkie
pofałdowania. W przełomie (wnętrzu) membrany występują liczne, małe pory
których średnica wynosi około 10-15 µm. Na powierzchni II obserwuje się
pory przykryte cienką warstwą naskórkową, uniemożliwiającą dostęp do
wnętrza membrany, a więc powierzchnię tą można traktować jako litą.
258
Wpływ prekursorów porów na morfologię membran półprzepuszczalnych
przeznaczonych do hodowli komórkowych
Tabela 1. Morfologia membran otrzymanych bez dodatku prekursorów porów
powierzchnia I
przełom
powierzchnia II
W Tabeli 2 przedstawiono morfologię membran, otrzymanych z dodatkiem PVP jako prekursora porów. Na powierzchni I obecne pory mają
rozmiar (średnicę) 5-20µm, dodatkowo pomiędzy nimi występują małe
pory, przykryte warstwą naskórkową. Wnętrze membrany jest silnie porowate. Najmniejsze pory, których rozmiar wynosi 10-15 µm występują
w samym środku przełomu. Wraz ze zbliżaniem się do obu powierzchni ich
rozmiar wzrasta i osiąga średnicę 30-50 µm. Na powierzchni II pory są
duże, ich średnica wynosi 20-50 µm. Należy jednak zauważyć, że
porowatość obu powierzchni jest niewielka.
Tabela 2. Morfologia membranotrzymanych z dodatkiem PVP jako prekursora porów
powierzchnia I
przełom
powierzchnia II
W Tabeli 3 zamieszczono membranę, otrzymaną z dodatkiem Pluronic®.
Powierzchnia I nie zawiera porów. Podobnie jest w przypadku powierzchni
II. Co prawda widoczne są na niej pory, lecz są przykryte cienką warstwa
naskórkową, który czyni ją praktycznie nieprzepuszczalną. Pory w przełomie są rozmieszone bardzo nieregularnie, ich średnica waha się od 10 do
60 µm. Ponadto, można zaobserwować także skupiskabardzo małych
porów, których rozmiar wynosi kilka µm.
259
Aleksandra Kruk, Agnieszka Gadomska-Gajadhur, Paweł Ruśkowski
Tabela 3. Morfologia membranotrzymanych z dodatkiem Plurtonic® jako prekursora porów
powierzchnia I
przełom
powierzchnia II
W Tabeli 4 przedstawiono membranę, otrzymaną z zastosowaniem
NaCl, będącego prekursorem porów. Powierzchnia I zawiera bardzo nieliczne pory, rzędu 15-40 µm oraz pofałdowania. Wnętrze membrany
posiada pory o średnicy 10-15 µm, między którymi występują większe,
o rozmiarze 30-40 µm. Przy jednej z powierzchni można zaobserwować
bardzo duże pory, których wielkość przekracza 100 µm. Powierzchnia II
jest bardzo nieregularna i zwiera pory o średnicy 10-20 µm
Tabela 4. Morfologia membranotrzymanych z dodatkiem NaCl jako prekursora porów
powierzchnia I
przełom
powierzchnia II
W Tabeli 5 zamieszczono membranę, otrzymaną z dodatkiem PVP
i Pluronic® jako prekursorów porów. Na powierzchni I są obecne pory
ośrednicy 10-15 µm, pomiędzy którymi występują bardzo małe pory (kilka
µm), w większości pokryte warstwą naskórkową. W silnie porowatym
przełomie pory mają przeważnie średnicę 10-15 µm, przy czym pomiędzy
nimi występują większe, o rozmiarze 30-50 µm. Przy powierzchni II jest
najwięcej tych ostatnich porów, poza tym występują też nieregularnie
rozmieszczonepory rzędu 10-40 µm.
260
Wpływ prekursorów porów na morfologię membran półprzepuszczalnych
przeznaczonych do hodowli komórkowych
Tabela 5. Morfologia membranotrzymanych z dodatkiem PVP oraz Plurtonic® jako prekursora
porów
powierzchnia I
przełom
powierzchnia II
W Tabeli 6 znajdują sięobrazy membrany, otrzymanej z zastosowaniem
NaCl oraz PVP jako prekursorów porów. PowierzchniaI posiada rzadko
występujące pory o średnicy 10-20 µm. W samym środku przełomu obecne
są pory o rozmiarze około 5 µm, między którymi znajdują się większe,
o średnicy sięgającej 15-25 µm. Wraz zezbliżaniem się do obu powierzchni, wewnętrzumembrany pojawiają się pory o średnicy 30-80 µm.
Powierzchnia II posiada dość licznie występujące pory o rozmiarze 15-30 µm.
Tabela 6. Morfologia membranotrzymanych z dodatkiem NacCloraz PVP jako prekursora porów
powierzchnia I
przełom
powierzchnia II
5. Dyskusja
Membrany otrzymane bez dodatku prekursorów porów, wykazują dużą
porowatość przełomu (Tabela 1). Jedna z powierzchni zawiera nieliczne
pory, natomiast druga jest lita. Taka morfologia uniemożliwia wniknięcie
komórek do wnętrza membrany.
W przypadku membran otrzymanych z dodatkiem PVP obserwuje się
występowanie porów na obu powierzchniach (Tabela 2). Dodatkowo, pory
261
Aleksandra Kruk, Agnieszka Gadomska-Gajadhur, Paweł Ruśkowski
występujące w przełomie, zwłaszcza przy powierzchniach, mają większy
rozmiar, w porównaniu do membrany otrzymanej bez dodatku PVP.
W przypadkach, w których substancją porotwórczą jest Pluronic®, obie
powierzchnie są pozbawione porów (Tabela 3). Przełom jest silnie
porowaty, przy czym występujące pory są małych rozmiarów.
Zastosowanie NaCl sprzyja powstawaniu bardzo dużych porów we
wnętrzu membrany, które są nieregularnie rozmieszczone pomiędzy porami
o małych średnicach (Tabela 4). Pory o największych rozmiarach są
rozłożone wzdłuż jednej z powierzchni. Mimo dobrej porowatości
przełomu, obie powierzchnie membran mają za mało porów.
Dodatek dwóch prekursorów porów jednocześnie (PVP oraz Pluronic®)
sprzyja powstawaniu porów, szczególnie na jednej z powierzchni(Tabela
5). Ponadto w przełomie membrany, oprócz małych porów, pojawiają się
także posiadającewiększe średnice.
Użycie NaCl wraz z PVP (Tabela 6) znacznie zwiększyło porowatość,
szczególnie jednej z powierzchni. W przełomie, wzdłuż obydwu
powierzchni pojawiły się pory o bardzo dużych średnicach. Należy jednak
zauważyć, że przełom membrany zawiera także pory o bardzo niewielkich
rozmiarach.
Spośród prezentowanych przykładów, najkorzystniejszą morfologię
z punktu widzenia prowadzenia hodowli komórkowych, posiada membrana
otrzymana z wykorzystaniem PVP oraz Pluronic®, jako prekursorów
porów. W membranie tej jedna z powierzchni wykazuje porowatość
stwarzającą szanse na wniknięcie komórek do wnętrza. Z kolei druga z nich
ma mało porów, co może zapobiegać „wypadaniu” komórek ze struktury
membrany. Jednak do prowadzenia wydajnej hodowli komórkowej,
wymagane są membrany o regularnie rozmieszczonych,większych porach
w przełomie (20-40 µm) oraz o zwiększonej porowatości jednej
z powierzchni,czego nie stwierdzono w membranach zamieszczonych
wprezentowanych wynikach.Membrana otrzymana z dodatkiem NaCl oraz
PVP,charakteryzuje się dużą porowatością jednej z powierzchni. Jednak
pory występujące w jej przełomie są zbyt małe by móc zmieścić komórki.
6. Podsumowanie i wnioski
Spośród zbadanych substancji, najkorzystniejszy wpływ na porowatość
oraz wielkość porów, mają mieszaniny prekursorów porów, a szczególnie
PVP wraz z Pluronic®. Substancje te zwiększają wielkość porów
występujących w przełomie membran do około 50 µm oraz sprzyjają
powstawaniu porów na jednej z powierzchni. Zaprezentowane w niniejszej
pracy wyniki dostarczają informacji, które wskazują kierunek prowadzenia
dalszych badań nad otrzymywaniem membran, służących do prowadzenia
wydajnych i efektywnych hodowli komórkowych.
262
Wpływ prekursorów porów na morfologię membran półprzepuszczalnych
przeznaczonych do hodowli komórkowych
Literatura
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
Grolik M., Inżynieria tkankowa-nowe narzędzie w rekonstrukcji tkanek, Zeszyty
Naukowe Towarzystwa Doktorantów UJ Nauki Ścisłe, 3 (2011), s. 33-40
Kruk A., Gadomska-Gajadhur A., Ruśkowski P., Zastosowanie
bioresorbowalnych rusztowań w inżynierii tkankowej, Wydawnictwo Tygiel
(2015), s. 91-102
Ma P. X., Scaffolds for tissue fabrication, Materials Today, 7 (2004), s. 30-40
Gadomska-Gajadhur A., Kruk A., Ruśkowski P., Synoradzki L., Wpływ
dodatku porofora na morfologię skafoldów polilaktydowych. TEMPO s.c.,
(2015), s. 294-297
Nowak B., Pająk J., Biodegradacja polilaktydu (PLA), Archiwum Gospodarki
Odpadami i Ochrony Środowiska,12 (2010), s. 1-10
Gupta A. P., Kumar V., New emerging trends in synthetic biodegradable
polymers Polylactide: a critique, European Polymer Journal, 43 (2007), s.
4053-4074
Gadomska A., Warych I., Ruśkowski P., Synoradzki L., Otrzymywanie
nanosfer polilaktydowych,Przemysł Chemiczny, 93(2014), s.1311-1314
Gadomska A., Mierzejewska J., Ruśkowski P, Synoradzki L., Otrzymywanie
sfer polilaktydowych zawierających paracetamol, Przemysł Chemiczny, 10
(2015), s. 1676-1678
Kruk A., Gadomska-Gajadhur A., Ruśkowski P., Przybysz A., Bijak V.,
Synoradzki L., Optymalizacja otrzymywania sfer poliaktydowych
zawierających neomycynę z wykorzystaniem matematycznych metod
planowania doświadczeń, Przemysł Chemiczny, w druku
Ko H. F., Sfeir C., Kumta P. N., Novel synthesis strategies for natural polymer
and composite biomaterials as potential scaffolds for tissue engineering,
Philosophical Translations of the Royal Society A: Mathematical, Physical
& Engineering Sciences, 368 (2009), s. 1981-1997
Kawazoe N., Creation of novel materials for tissue regeneration as next
generation medical technology, National Institute for Materials Science,
on-line (2012)
Kim H. J., Kim K. K., Park I. K., Hybrid Scaffolds Composed of Hyaluronic
Acid and Collagen for Cartilage Regeneration, Tissue Engineering
and Regenerative Medicine, 9 (2012), s. 57-62
Yang C. R., Di Chen J., Preparation and biological evaluation of chitosancollagen-icariin composite scaffolds for neuronal regeneration, Neurological
Sciences, 34 (2013), s. 941-947
Chwojnowski A., Półprzepuszczalne membrany polisulfonowe, Warszawa:
Zespół Wydawniczo – Poligraficzny IBIB PAN, 2011
Wen Y., Lian F., Ren Y., Guan H., Enhanced electrochemical properties
of a novel polyvinyl formal membrane supporting gel polymer electrolyte
by Al2O3 modification, Journal of polymer science part b polymer physics,
52 (2014), s.572-577
Lan Levengood S., Zhang M., Chitosan-based scaffolds for bone tissue
engineering, Journal of Materials Chemistry B, 2 (2014),s. 3161-3184
263
Aleksandra Kruk, Agnieszka Gadomska-Gajadhur, Paweł Ruśkowski
Wpływ prekursorów porów na morfologię membran
półprzepuszczalnych przeznaczonych do hodowli komórkowych
Hodowle komórkowe są ważnym aspektem inżynierii tkankowej, dziedziny której głównym
celem jest wspomaganie regeneracji uszkodzonych, trudnoodnawiających się tkanek. Elementem,
który znacznie zwiększa wydajność hodowli tkankowych są rusztowania komórkowe, będące
fizycznym, trójwymiarowym podłożem. Jedną z form rusztowań są membrany półprzepuszczalne.
W niniejszej pracy przedstawiono doświadczalne wyniki otrzymywania membran, których
przeznaczeniem są hodowle komórkowe. Zbadano wpływ wybranych substancji porotwórczych
(PVP, Pluronic® oraz NaCl) na morfologię otrzymanych membran. Na podstawie przeprowadzonych badań wytypowano substancje, stwarzające możliwości otrzymania membran
o pożądanej porowatości i wielkości porów.
Effect of pore precursors on the morphology of the semi-permeable
membranes for cell cultures
Cell cultures are important aspect of tissue engineering (TE). TE is a field whose main aim is to
support regeneration of damaged, difficult to regeneration tissues. The scaffolds are the main and
the latest issue of this science. Scaffolds are medium for cell culture characterized by a highly
developed, three-dimensional spatial structure. One forms of scaffolds are semi-permeable
membranes.
Experimental results of the preparation of semi-permeable membranes for cell cultures were
obtained. The effect of pore precursors (polyvinylpyrrolidone, Pluronic® and NaCl) on the
morphology of the membranes was studied. The studies were selected substances which gave the
largest porosity of membranes.
264
Bartosz Sikora1, Aleksandra Skubis2, Małgorzata Kimsa3
Ekspresja markerów molekularnych
ABCG2 oraz P63
w świńskich epitelialnych
komórkach macierzystych rąbka rogówki
1. Wprowadzenie
Ślepota rogówkowa to zaburzenie, z którym na całym świecie żyje
około 10 milionów osób. Jest to dysfunkcja wywołana uszkodzeniami
fizycznymi, chemicznymi, ale również biologicznymi tj. zakażeniami
wirusowymi i bakteryjnymi. Jedną ze stosowanych metod leczenia są
przeszczepy rogówki. Jednak liczba transplantacji nadal jest niewystarczająca w odniesieniu do liczby chorych [1, 2, 3].
Nabłonek rogówki jest tkanką posiadającą właściwości samoodnowy
[4]. Dlatego w przypadku uszkodzeń wyłącznie jednej rogówki stosuje się
często metodę polegającą na wykorzystaniu komórek rąbka rogówki
zdrowego oka [2]. Rąbek rogówki to obszar obejmujący cienką
przezroczystą warstwę komórek znajdującą się pomiędzy rogówką,
a twardówką oka. Warstwa ta bogata jest w epitelialne komórki macierzyste rąbka rogówki (LESCs ang. limbalepithelialstemcells), których
zadaniem jest odnawianie sprawności i funkcjonalności rogówki.
W przypadku komórek rąbka rogówki stwierdzono, że posiadają one wolne
tempo cyklu komórkowego oraz niski wskaźnik mitotyczny [3]. Pomimo
wielu zalet przeszczepu autologicznego metoda ta ma pewne ograniczenia.
Jednym z nich jest ryzyko uszkodzenia rogówki prawidłowej w momencie
pobrania fragmentów rąbka rogówki. W efekcie może to doprowadzić do
obuocznej ślepoty [1]. Wśród powikłań obserwuje się zwłóknienie
rogówki, rozrost nieprawidłowego nabłonka i mikrouszkodzenia [3].
1
[email protected], Katedra i Zakład Biologii Molekularnej, Wydział Farmaceutyczny
z Oddziałem Medycyny Laboratoryjnej, Śląski Uniwersytet Medyczny w Katowicach,
www.sum.edu.pl
2
[email protected], Katedra i Zakład Biologii Molekularnej, Wydział
Farmaceutyczny z Oddziałem Medycyny Laboratoryjnej, Śląski Uniwersytet Medyczny
w Katowicach, www.sum.edu.pl
3
[email protected], Katedra i Zakład Biochemii, Wydział Lekarski, Śląski Uniwersytet
Medyczny w Katowicach, www.sum.edu.pl
265
Bartosz Sikora, Aleksandra Skubis, Małgorzata Kimsa
Jednak dzięki rozwojowi medycyny regeneracyjnej istnieje szansa na
terapię do tej pory nieuleczalnych schorzeń rogówki. Jedną z takich metod
może być wykorzystanie komórek LESCs. Potwierdzono między innymi,
żekomórki macierzyste mają zdolność do migracji w kierunku uszkodzonych miejsc i różnicowania w określony typ komórek w odpowiedzi na
warunki środowiska w jakim się znajdują [3].
Głównym problemem wykorzystania komórek macierzystych jest
problem ich identyfikacji. Bardzo często pewne typy komórek
macierzystych nie posiadają w pełni sprecyzowanych markerów, w tym
równieżLESCs. Komórki rogówki posiadają dwa charakterystyczne białka.
Są to cytokeratyny: cytokeratyna-3 (CK3) i cytokeratyna-12 (CK12).
Należy zaznaczyć, że cytokeratyna-3 jest białkiem charakterystycznym dla
już zróżnicowanych komórek nabłonkowych rogówki. Stąd też może ona
być wykorzystywana jako marker negatywny LESCs [4]. Obecnie profil
markerów komórek macierzystych rąbka rogówki opiera się na obecności
białek: p63, ABCG2, integryny-9 i braku ekspresji e-kadheryny, koneksyny-43, inwolukryny, a także cytokeratyny-3 i cytokeratyny-12 [5, 6].
Ważnym czynnikiem mającym wpływ na możliwości wykorzystania
komórek macierzystych rąbka rogówki są warunki w jakich są hodowane
in vitro. Konieczne jest zachowanie przez jak najdłuższy czas ich wzrostu,
proliferacji i potencjału zróżnicowania. W zależności od typu pożywki
komórki te wykazują różne fenotypy i zmienną ekspresję markerów
specyficznych. Oznacza to, że optymalizacja procesu hodowli jest jednym
z ważniejszych celów medycyny regeneracyjnej z wykorzystaniem LESCs.
W zależności od przeznaczenia wykorzystania komórek rąbka rogówki
inne czynniki muszą być dodawane do pożywek w celu szybszego procesu
różnicowania lub też jego zahamowania [7].
W związku z poważnym deficytem rogówek ludzkich do przeszczepów
rozważa się wykorzystanie komórek macierzystych rogówki pochodzących
od zwierząt. Badania wykazały, że kompatybilnym zamiennikiem rogówki
ludzkiej może być rogówka świńska. Bardzo często rogówki pobierane od
dawców ludzkich mają słabą zdolność proliferacji ze względu na zawansowany wiek dawców. Jeżeli rogówki te byłyby pobierane od młodych świń
transgenicznych wtedy zdolności regeneracyjne tego narządu były by też
dużo większe [8]. Jednak do tego celu konieczna jest całkowicie
powtarzalna identyfikacja pobieranych komórek do ksenotransplantacji.
2. Cel pracy
Niniejsza praca miała na celu zidentyfikowanietranskryptów markerów
powierzchniowych p63 oraz ABCG2 metodą QRT-PCR w epitelialnych
komórkach macierzystych rąbka rogówki (LESCs)świni.
266
Ekspresja markerów molekularnych ABCG2 oraz P63
w świńskich epitelialnych komórkach macierzystych rąbka rogówki
3. Materiały i metody
Źródłem materiału biologicznego poddanego analizie były świnie
domowe (łac. Sus scrofa)poddane modyfikacji genetycznej. Transgeneza
obejmowała wyciszenie antygenu galaktozylotransferazy lub wprowadzenie
ludzkiego antygenu fukozylotransferazy. Badany materiał obejmował
tkanki pochodzące ze świń zawierających losową ze wskazanych powyżej
modyfikacji genetycznych.
Ze świńex vivo pobierano gałki oczne i na czas dalszej preparatyki,
przechowywano je w rozworze PBS (ang. phosphate-bufferedsaline;
Lonza, Basel, Switzerland) z dodatkiem antybiotyków: amfoterycyny B,
penicyliny i streptomycyny. Z gałek ocznychmetodami mikrochirurgii
okulistycznej wypreparowywano fragmenty rąbka rogówki usytuowanego
po obu biegunach gałki ocznej. W kolejnym etapie otrzymane fragmenty
rozdrabniano z wykorzystaniem skalpela w celu uzyskania kawałków
o rozmiarze około 2 mm2. Tkankę wysiewano na naczynia hodowlane
w liczbie 2-3 kawałki na jeden dołek hodowlany, w płytkach 6-cio
dołkowych (Nunc, Wiesbaden, Germany). W ten sposób rozmieszczone
kawałki rąbka rogówki odstawiono naczas prawidłowego przywarcia do
podłoża, pod komorą z laminarnym przepływem powietrza (od 15 do 20
minut). Przywarte kawałki tkanki następnie zalewano pożywką
standardową DMEM (Dulbecco'sModifiedEagle Medium) z dodatkiem
10% FBS (bydlęca surowica płodowa, ang. fetalbovine serum) oraz 25 mg /
100 ml antybiotyku – gentamycyny (Lonza, Basel, Switzerland) i wstawiono do inkubatora (Direct Heat CO2 Incubator, ThermoScientific,
Waltham, MA).Epitelialne komórki macierzyste rąbka rogówki były
hodowane w atmosferze wzbogaconej dwutlenkiem węgla do całkowitego
stężenia 5%, w temperaturze 37°C. Hodowlę obserwowano z wykorzystaniem mikroskopu odwróconego (Olympus IX81, Shinjuku, Tokyo,
Japan). Badania zostały przeprowadzone za zgodą Komisji Bioetycznej.
Liczba komórek i ich żywotność była monitorowanametodą zliczania
komórek w komorze Bürker’astosując wybarwianie roztworem 0,2%
błękitu trypanu (BiologicalIndustries, BeitHaEmek, Israel). Komórki były
hodowane aż do czasu osiągnięcia całkowitej konfluencji i następnie
pasażowane.Podczas pasażu wysiewano do nowych naczyńpo około 10 x
104 żywych komórek na dołek. Hodowlę zakończono po drugim pasażu.
Do dokumentacji fotograficznej wykorzystano kamerę DP70 (Olympus,
Shinjuku, Tokyo, Japan) (Rysunek 1).
Całkowity RNA został wyekstrahowany z osadu komórkowego
wykorzystując odczynnik TRIzol (Invitrogen, Carlsbad, CA). Ekstrakty
całkowitego RNA w celu oczyszczenia traktowano DNazą I (MBI
Fermentas, Vilinus, Lithuania), zgodnie z instrukcją zamieszczoną przez
267
Bartosz Sikora, Aleksandra Skubis, Małgorzata Kimsa
producenta. Jakość ekstraktów była weryfikowana elektroforetycznie stosując
0,8% żel agarozowy z dodatkiem bromku etydyny. Wyniki analizowano oraz
dokumentowano wykorzystując system dokumentacji żeli 1D Bas-Sys
(Biotech-Fisher, Perth, Australia). Stężenie kwasów nukleinowych zostało
określone wykorzystując spektrofotometr RNA/DNA GeneQuant II
(Pharmacia Biotech, Cambridge, UK).
Rysunek 1. Epitelialne komórki macierzyste rąbka rogówki w naczyniu hodowlanym (pow. 4x).
Ciemny obiekt w lewym-górnym rogu – fragment rąbka rogówki [opracowanie własne]
W celu identyfikacji transkryptówmarkerów molekularnych p63 oraz
ABCG2 zastosowano ilościową łańcuchową reakcję polimerazy w czasie
rzeczywistym (QRT-PCR) z wykorzystaniem barwnika SYBR Green
(SYBR Green Quantitect RT-PCR Kit, Qiagen) oraz aparatu Opticon™
DNA Engine ContinuousFluorescencedetector (MJ Research) zgodnie
z procedurą opisaną wcześniej (Strzałka i in. 2008). Wszystkie próby
powtarzano trzykrotnie.
ACTB (beta-aktyna) została użyta jako wewnętrzna kontrola endogenna
amplifikacji. Startery oligonukleotydowe specyficzne dla genów: p63
i ABCG2 zostały zaprojektowane w oparciu o sekwencje referencyjne
(GenBankaccession No. XM_003483293.2, NM_214010.1) z wykorzystaniem
oprogramowania PrimerExpressTM Version 2.0 (PE Applied Biosystems,
Foster City, CA) (Tabela 1). Profil termiczny jednego cyklu reakcji
RT-PCR był następujący: odwrotna transkrypcja w temperaturze 50˚C
przez 30 min, denaturacja w temperaturze 95˚C przez 15 min. 40 cykli
reakcji składało się z następujących po sobie temperatur i odstępów
czasowych: 94˚C przez 15 s, 60˚C przez 30 s, i 72˚C przez 30 s. Analiza
268
Ekspresja markerów molekularnych ABCG2 oraz P63
w świńskich epitelialnych komórkach macierzystych rąbka rogówki
każdej próbki była zakończona wyznaczeniem krzywej topnienia w celu
potwierdzenia specyficzności produktu i wykluczenia powstania dimerów
starterów. Produkty RT-PCR zostały rozdzielone na 6% żelu poliakrylamidowym i wybarwione solami srebra.
Przeprowadzono analizę statystyczną wykorzystując program do analiz
Statistica 10.0 (StatSoft Tulsa, Oklahoma, USA). W analizie statystycznej
zastosowano poziom istotności p<0,05. Miarą aktywności transkrypcyjnej
badanych genów była liczba cząsteczek mRNA przeliczona na 1 g
całkowitego RNA.Wyniki przedstawiono za pomocą mediany (Me) wraz
z kwartylemgórnym i kwartylem dolnym, oraz wartościami minimum
i maksimum. W celu wyznaczenia różnic w ekspresji transkryptówp63
i ABCG2 wykorzystano test U manna-Whitney’a.
Tabela 1. Charakterystyka starterów wykorzystanych do reakcji RT-PCR
Sekwencja starterów
Gen
p63
ABCG2
ACTB
Forward:5’GGAATGAACCGCCGTCCAA3’
Reverse:5’CGAGACTTGCTGCTTCCTGATGC3’
Forward:5’TGGGTCTGGATAAAGTGGCCG3’
Reverse:5’GGAGTCTAAGCCAGTCGTGGGC3’
Forward:5’TCACCCACACTGTGCCCATCTACGA3’
Reverse:5’CAGCGGAACCGCTCATTGCCAATGG3’
Długość
produktu(bp)
Tm(oC)
153
82
152
80
295
85
Źródło: Opracowanie własne
4. Analiza wyników
Badaniu molekularnym w kierunku poziomu ekspresji markerów
molekularnych ABCG2 oraz p63 poddano 12 osadów komórkowych. 8
osadów stanowiło materiał zebrany po zakończeniu pasażu 0. Kolejne 6
osadów komórkowych stanowiło materiał zebrany po zakończeniu pasażu 2.
Przy pomocy testu Shapiro-Wilka zbadano zgodność rozkładu
z rozkładem normalnym (Tabela 2)
269
Bartosz Sikora, Aleksandra Skubis, Małgorzata Kimsa
Tabela 2. Test normalności rozkładu Shapiro-Wilka
Marker molekularny
Materiał badany
W
p
ABCG2
pasaż 0
0,983
0,975
p63
pasaż 0
0,962
0,825
ABCG2
pasaż 2
0,740
0,016
p63
pasaż 2
0,779
0,037
Źródło: Opracowanie własne
Wobec niespełnienia w pełni założeń dotyczących normalności rozkładu
zmiennych dla zmiennej ABCG2 i p63 pasaż 2 do wykazania różnic
w wartościach pomiędzy badanymi zmiennymi zastosowano test U Manna
-Whitney’a (Tabela 3)
Tabela 3. Test U Manna-Whitney'a
Marker molekularny
p
ABCG2
0,045
p63
0,001
Źródło: Opracowanie własne
Wykazano istotną statystycznie zwiększoną liczbę kopii mRNA
ABCG2/μg RNA w komórkach LESCsw pasażu 2 (Rysunek 2).
270
Ekspresja markerów molekularnych ABCG2 oraz P63
w świńskich epitelialnych komórkach macierzystych rąbka rogówki
Rysunek 2. Wykres pudełkowy przedstawiający stosunek ekspresji markera ABCG2
w zależności od czasu hodowli [opracowanie własne]
Wynik pomiaru dla poziomu ekspresji genu p63 był odwrotny w stosunku do ABCG2 i wykazał istotne statystycznie zmniejszenie ekspresji
w pasażu 2 (Rysunek 3).
Rysunek 3. Wykres pudełkowy przedstawiający stosunek ekspresji markera p63 w zależności od
czasu hodowli [opracowanie własne]
Wyniki pomiarów przedstawiono w tabeli 4.
271
Bartosz Sikora, Aleksandra Skubis, Małgorzata Kimsa
Tabela 4. Statystyki opisowe badanych prób
Marker
Pasaż
Mediana
Min.
Maks.
Kwartyl-D
Kwartyl-G
Odch.std
ABCG2
0
7359,02
3348,51
11550,00
5203,36
8897,02
2629,28
p63
0
267118,90
39340,00
489778,40
128973,46
331062,65
149834,75
ABCG2
2
11840,00
6719,82
13710,00
9584,81
12430,00
2752,95
p63
2
855,46
605,61
1510,51
689,20
1215,00
379,73
Źródło: Opracowanie własne
5. Dyskusja
Ksenotransplantacja wiąże się z dużym ryzykiem odrzucenia
wszczepianej tkanki. W przeciwieństwie do ksenotransplantacji, problem
odrzutu przeszczepu allogenicznego wydaje się być rozwiązany poprzez
zastosowanie terapii odpowiednimi lekami immunosupresyjnymi. Jednak
w przypadku wykorzystania klinicznego ksenograftów zagrożenie odrzutem przeszczepu jest znacznie większe. Tkanki obcego gatunku posiadają
znacznie więcej czynników zagrażających ludzkiemu organizmowi.
Przeszczepienie niedostosowanych tkanek może wiązać się z natychmiastową ostrą reakcją odrzutu. Jest to spowodowane występowaniem
odmiennej budowy układu dopełniacza [11].
Aby narządy, tkanki lub komórki pochodzące z obcego organizmu
mogłyby zostać wykorzystane w celach leczniczych, konieczne jest
dostosowanie ich do właściwego przyjęcia przez ludzki organizm. Świnia
domowa (łac. Sus scrofa) gabarytami organów oraz wydolnością
fizjologiczną jest bardzo bliska ludzkiemu ciału. Ze względu na to ten
gatunek zwierząt staje się głównym obiektem zainteresowań jako źródło
tkanek do przeszczepu [11].
Nietolerancję organów, tkanek lub komórek świni domowej przez
ludzki organizm można wyeliminować poprzez wykorzystanie technik
biotechnologicznych, które pozwalają na wprowadzenie zmian w genomie
świni. Wykonywane modyfikacje genetyczne zwierząt skupiają się na
trzech kierunkach. Jednym z nich jest wyłączenie genu warunkującego
powstawanie antygenu αGal (α1,3-galaktozylotransferaza). Drugim,
wprowadzanie do świńskiego genomu genów człowieka regulujących
system dopełniacza, do których zaliczamy czynnik CD46, CD55 oraz
CD59 oraz trzecim modyfikowanie białek powierzchniowych komórek
dawcy: α1,2-fukozyotransferazy, α2,6-sjalilotransferazy, α2,3-sjalilotransferazy, α-galaktozydazy [11].
272
Ekspresja markerów molekularnych ABCG2 oraz P63
w świńskich epitelialnych komórkach macierzystych rąbka rogówki
Zagrożenie niosą także inne uwarunkowania. Doniesienia z ostatnich lat
wskazują na obecność retrowirusów endogennych wbudowanych na stałe
w genom każdego gatunku ssaków. Świńskie retrowirusy endogenne
(PERVs – ang. porcine endogenous retroviruses) są wirusami zasiedlającymi genom świni domowej. Podobnie jak HERV (ang. human
endogenous retroviruses) dla człowieka, retrowirusy te nie są patogenne
dla organizmu świni. Należy jednak zapytać czy PERVpo dostaniu się do
organizmu człowieka, nie staną się dla niego przyczyną poważnych
powikłań [11, 12]
Ocena bezpieczeństwa ksenotransplantacji między innymi sprowadza się
do diagnostyki molekularnej w kierunku występowania różnych subtypówPERV, co ma na celu ustalenie jak duże ich stężenie występuje w tkance
oraz czy posiada subtyp tworzący groźny dla człowieka rekombinant [13].
Ocena bezpieczeństwa badanych komórek pod względem zawartości PERV
stanowiła oddzielne badania, które są w trakcie publikacji.
Kontynuując analizę przydatności świńskich epitelialnych komórek
macierzystych, w niniejszej pracy wykonano wstępną analizę mającą na
celu identyfikację markerów powierzchniowych LESCs. Otrzymane wyniki
potwierdzają, że uzyskane w hodowli komórki stanowią pule komórek
macierzystych rąbka rogówki. Analiza statystyczna wykazała, że ekspresja
badanych markerów zmienia się w zależności od czasu trwania hodowli.
Uzyskane wyniki jednoznacznie wskazują na to, że po drugim pasażu tych
komórek wzrasta poziom ekspresji ABCG2. Czas otrzymania osadu
komórek pochodzących z drugiego pasażu od momentu założenia hodowli
pierwotnej obejmował około 4 tygodni hodowli.
ABCG2 (CD338) jest genem kodującym białko będące transporterem
błonowym, należącym do rodziny białek G. Jest białkiem wiążącym kasetę
ATP i zalicza się do białek transportujących (ABC) [14]. ABCG2 jest
obecny w tkankach nabłonkowych, dlatego stanowi marker dla LESCs.
Obecność ABCG2 jest konieczna dla utrzymania właściwego fenotypu
komórek i zaburzenie jego ekspresji może wpłynąć na zmniejszenie
populacji komórek lub zaburzyć przynależność do danej linii komórkowej.
ABCG2 uważa się za białko odpowiedzialne za utrzymanie macierzystości
komórek i zachowanie ich w stanie niezróżnicowanym [15]. Wzrost
ekspresji tego markera w drugim pasażu hodowli wskazuje na
uruchomienie mechanizmów pozwalających na utrzymanie stanu
niezróżnicowania.
Drugi badany marker molekularny stanowi białko kodowane przez gen
p63 (TP63). Jest to czynnik transkrypcyjny zaangażowany w procesy
morfogenetyczne. Obecność p63 jest charakterystyczna dla tkanek
epitelialnych i jest zdefiniowanym markerem epitelialnych komórek
macierzystych rąbka rogówki. Poziom ekspresji p63 wskazuje na
273
Bartosz Sikora, Aleksandra Skubis, Małgorzata Kimsa
aktywność procesu proliferacji i świadczy o żywotności komórek.
Zaproponowany nowy model białka p63 określa je jako „strażnik”
kontrolujący przejście komórki na drogę zaprogramowanej śmierci.
Wykazano, że brak ekspresji tego białka powoduje apoptozę komórek
epitelialnych rąbka rogówki [16, 17]. Zaobserwowany silny spadek
ekspresji p63 w uzyskanych wynikach może świadczyć zatem o wejściu
hodowanych komórek na drogęprogramowanejśmierci.
Wstępna analiza poziomu ekspresji markerów molekularnych ABCG2
i p63 w hodowli pierwotnej świńskich epitelialnych komórek
macierzystych rąbka rogówki, toruje drogę dla dalszych analiz. Ustalenie
poziomów ekspresji większej liczby markerów definiujących LESCs
pochodzących od świni domowej oraz weryfikacja na poziomie translacji
pozwoli na dokładniejsze poznanie procesów zachodzących na różnych
etapach hodowli, a to z kolei przyczyni się do optymalizacji jej warunków
i zwiększenia jej wydajności.
Literatura
1.
2.
3.
4.
5.
6.
7.
8.
9.
Zhang J., Huang C., Feng Y., Li Y., Wang W., Comparison of beneficial
factors for corneal wound-healing of rat mesenchymal stem cells and corneal
limbal stem cells on the xenogeneic acellular corneal matrix in vitro, Mol Vis.
2012;18:161-73. Epub 2012 Jan 20
Yao L., Bai H., Review: mesenchymal stem cells and corneal reconstruction,
Mol Vis. 2013 Nov 7;19:2237-43. eCollection 2013
Acar U., Pinarli F. A., Acar D. E., Beyazyildiz E., Sobaci G., Ozgermen B. B.,
Sonmez A. A., Delibasi T., Effect of allogeneic limbal mesenchymal stem cell
therapy in corneal healing: role of administration route. Ophthalmic Res.
2015;53(2):82-9. doi: 10.1159/000368659. Epub 2015 Jan 20
Sun T. T., Lavker R. M., Corneal epithelial stem cells: past, present, and
future, J InvestigDermatolSymp Proc. 2004 Sep;9(3):202-7
Figueira E. C., Di Girolamo N., Coroneo M. T., Wakefield D., The phenotype
of limbal epithelial stem cells, Invest Ophthalmol Vis Sci. 2007 Jan;48(1):144-56
Li F., Zhao S. Z., Mesenchymal stem cells: Potential role in corneal wound
repair and transplantation, World J Stem Cells. 2014 Jul 26;6(3):296-304
Loureiro R. R., Cristovam P. C., Martins C. M., Covre J. L., Sobrinho J. A.,
Ricardo J. R., Hazarbassanov R. M., Höfling-Lima A. L., Belfort R. Jr, Nishi
M., Gomes J. Á., Comparison of culture media for ex vivo cultivation
of limbal epithelial progenitor cells, Mol Vis. 2013;19:69-77
Lamm V., Hara H., Mammen A., Dhaliwal D., Cooper D. K.,Corneal
blindness and xenotransplantation, Xenotransplantation, 2014 MarApr;21(2):99-114
Nieto-Miguel T., Calonge M., de la Mata A., López-Paniagua M., Galindo S.,
de la Paz M. F., Corrales R. M., A comparison of stem cell-related gene
expression in the progenitor-rich limbal epithelium and the differentiating
central corneal epithelium, Mol Vis. 2011;17:2102-17
274
Ekspresja markerów molekularnych ABCG2 oraz P63
w świńskich epitelialnych komórkach macierzystych rąbka rogówki
10. Nakatsu M. N., González S., Mei H., Deng S. X., Human limbal mesenchymal
cells support the growth of human corneal epithelial stem/progenitor cells,
Invest Ophthalmol Vis Sci. 2014 Oct 2;55(10):6953-9
11. Smorąg Z., Słomski R., Jura J. i in., Transgeniczne świnie jako dawcy tkanek
i narządów do transplantacji u ludzi, Przegląd hodowlany (2011) nr 11: 1-4
12. Gemeniano M., Mpanju O., Salomon D. R. et al., The infectivity and host
range of the ecotropic porcine endogenous retrowirus, PERV-C, is modulated
by residues in the C-terminal region of its surface envelope protein, Virology
346(2006): 108-117
13. Kimsa M. C., Strzałka-Mrozik B., Kimsa M. W., Porcine endogenous retroviruses
in xenotransplantation – molecular aspects, Viruses 201413;6(5): 2062-83
14. Leccia F., Del Vecchio L., Mariotti E., Di Noto R., Morel A. P., Puisieux A.,
Salvatore F., Ansieau S., ABCG2, a novel antigen to sort luminal progenitors
of BRCA1- breast cancer cells, Molecular cancer. 2014 Sep 12;13:213
15. Szabó D. J., Noer A., Nagymihály R., Josifovska N., Andjelic S., Veréb Z.,
Facskó A., Moe M. C., Petrovski G., Long-Term Cultures of Human Cornea
Limbal Explants Form 3D Structures Ex Vivo – Implications for Tissue
Engineering and Clinical Applications, PLoS One. 2015 Nov
18;10(11):e0143053
16. Das P., Pereira J. A., Chaklader M., Law A., Bagchi K., Bhaduri G.,
Chaudhuri S., Law S., Phenotypic alteration of limbal niche-associated limbal
epithelial stem cell deficiency by ultraviolet-B exposure-induced phototoxicity
in mice, Biochemistry and Cell Biology, 2013 Jun;91(3):165-75
17. López-Paniagua M., Nieto-Miguel T., de la Mata A., Galindo S., Herreras J.
M., Corrales R. M., Calonge M., Consecutive expansion of limbal epithelial
stem cells from a single limbal biopsy, CurrentEyeResearch, 2013
May;38(5):537-49
275
Bartosz Sikora, Aleksandra Skubis, Małgorzata Kimsa
Ekspresja markerów świńskich epitelialnych komórek macierzystych
rąbka rogówki
Ślepota spowodowana zaburzeniami funkcji rogówki nadal stanowi poważny problem medyczny.
Pomimo rozwoju medycyny regeneracyjnej, nie ma skutecznej metody leczenia dwustronnego
niedoboru komórek macierzystych rąbka rogówki. Występuje niedobór rogówek dla
przeszczepów. Alternatywnym rozwiązaniem może być wykorzystanie świńskich komórek
rogówki. Opublikowane prace wskazują na to, ze ksenotransplantacja rogówki pochodzącej od
świni może zostać wykorzystana klinicznie. Antygen Gal jest odpowiedzialny za indukcję reakcji
przeszczep przeciw gospodarzowi. Udowodniono, że antygen Gal jest praktycznie nieobecny
w świńskiej rogówce.
LESCs (ang. limbalepithelialstemcells) są komórkami wyizolowanymi z rąbka rogówki. Cienka
warstwa pomiędzy rogówką a twardówką oka jest miejscem, które jest bogate w te komórki.
Komórki te odgrywają potężną rolę w naturalnej rekonstrukcji uszkodzonej rogówki. Są
odpowiedzialne za właściwą wydajność tej części oka. Niestety nie ma w pełni określonych
markerów powierzchniowych LESCs. Część badań sugeruje, że cytokeratyna-3 (CK3),
cytokeratyna-12 (CK12), ABCG-2 charakteryzują epitelialne komórki macierzyste rąbka
rogówki. Innym ważnym markerem jest białko P63, kodowane przez gen TP63, które jest obecne
w tkankach epitelialnych. Pomimo problemów w identyfikacji, innym problemem jest
oczyszczenie i hodowla tych komórek w warunkach in vitro. Przyszłe badania mogą poprawić
obecną wiedzę na temat LESCs, a to z kolei może pozwolić na wykorzystanie tych komórek
macierzystych w terapii.
W tych badaniach przedstawiamy wyniki poziomu ekspresji dwóch markerów molekularnych
sugerowanych przez literaturę. Ekspresję TP63, ABCG-2 zmierzono dzięki metodzie QRT-PCR
w komórkach macierzystych rąbka rogówki zebranych z hodowli in vitro. Komórki były
hodowane w standardowej pożywce DMEM z dodatkiem 10% FBS.
The expression of porcine limbal epithelial stem cells markers.
Blindness caused by disorders of cornea function are still serious problem of medicine. Despite
development of regenerative medicine there is no treatment for bilateral limbal stem cell
deficiency. There is lack of corneal allografts for transplantation. Alternative solution might be
use of porcine corneal cells. Published papers showed that xenotransplantation of cornea obtained
from pigs could be used for clinical applications. Gal antigens are responsible for induction of
graft versus host reaction. It was proven that Gal antigen is almost absent in porcine cornea.
LESCs are cells insulated from corneal limbus. The thin layer between cornea and sclera of eye is
the rich place of stem cells. Those cells play a huge role in cornea reconstruction. They are
responsible for proper efficiency of that part of eye. Unfortunately, there are not fully specified
surface markers of LESCs. Some research suggests that cytokeratin-3 (CK3), cytokeratin-12
(CK12), ABCG-2 characterize limbal epithelial stem cells. Another significant marker is protein
P63 encoded by TP63 gene, which is present in epithelial tissues. Despite problems with
identification, another problem is to purify and culture them at in vitro conditions. Future research
may improve present knowledge about LESCs and thus, this will allow to use them in stem cells
therapy.
In this study we present the results of two molecular markers expression suggested by literature.
The expression of TP63 and ABCG-2 was examined by the use of QRT-PCR method in limbal
epithelial stem cells collected from in vitro culture. Cells were cultivated in standard medium
DMEM with 10% of fetal bovine serum.
276
Magdalena Antonowicz1, Anita Kajzer2, Magdalena Grygiel-Pradelok3
Dobór własności mechanicznych
elementów stabilizatora zewnętrznego
do leczenia kurzej klatki piersiowej
1. Wstęp
Deformacje klatki piersiowej od lat stanowią istotny problem leczniczy.
Do zniekształceń wrodzonych klatki piersiowej występujących najczęściej
zalicza się klatkę lejkowatą, zwaną również szewską oraz rzadziej
występującąklatkę kurzą [1]. Pierwotną przyczynątego typu zniekształceń
mogą być zmiany spowodowane wrodzonymi nieprawidłowościami układu
mięśni przyczepiających się i kształtujących klatkę piersiową. Według
Willitala deformacje klatki piersiowej można sklasyfikować graficznie,
wyróżniając 11 typów (rys.1) [2]:
 typ I: symetryczna lejkowata klatka piersiowa (rys. 1a);
 typ II: asymetryczna lejkowata klatka piersiowa (rys. 1b);
 typ III: symetryczna płasko-lejkowata klatka piersiowa (rys. 1c);
 typ IV: asymetryczna płasko-lejkowata klatka piersiowa (rys. 1d);
 typ V: symetryczna kurza klatka piersiowa (rys. 1e);
 typ VI: asymetryczna kurza klatka piersiowa (rys. 1f);
 typ VII: symetryczna płasko-kurza klatka piersiowa (rys. 1g);
 typ VIII: asymetryczna płasko-kurza klatka piersiowa (rys. 1h);
 typ IX: kombinacja kurzej i lejkowatej klatki piersiowej (rys. 1i);
 typ X: aplazja żeber (rys. 1j);
 typ XI: rozszczep mostka (rys. 1k);
 odsetek występowania wszystkich typów (rys. 1l).
1
[email protected], Katedra Biomateriałów i Inżynierii Wyrobów Medycznych,
Wydział Inżynierii Biomedycznej, Politechnika Śląska
2
[email protected],Katedra Biomateriałów i Inżynierii Wyrobów Medycznych, Wydział
Inżynierii Biomedycznej, Politechnika Śląska
3
[email protected], Katedra Biomateriałów i Inżynierii Wyrobów
Medycznych, Wydział Inżynierii Biomedycznej, Politechnika Śląska
277
Magdalena Antonowicz, Anita Kajzer, Magdalena Grygiel-Pradelok
Rysunek 1. Deformacje klatki piersiowej wg Willitala [2]
Kurza klatka piersiowa (pectus carinatum) jest deformacją przedniej
ściany klatki piersiowej. Wada ta charakteryzuje się zniekształceniem
mostka oraz chrząstek żebrowych, powodując wypchnięcie ich do przodu
[3] (rys. 2).
Rysunek 2. Deformacja klatki piersiowej: a) budowa anatomiczna kurzej klatki piersiowej [4], b)
kurza klatka piersiowa męska [5]
Najważniejszym oraz praktycznie jedynym wskazaniem do leczenia
kurzej klatki piersiowej jest aspekt psychologiczny oraz estetyczny.
Wyróżniane są trzy główne rodzaje kurzej klatki piersiowej: symetryczna,
asymetryczna oraz mieszana o różnym nasileniu i miejscu występowania
[3, 7]. U mężczyzn wada ta występuje czterokrotnie częściej niż u kobiet.
Leczenie jest dostosowywane indywidualnie w zależności od nasilenia
wady, a także od cech anatomicznych i fizjologicznych pacjenta [3].
Obecnie schorzenie to leczy się operacyjnie bądź zachowawczo.
278
Dobór własności mechanicznych elementów stabilizatora zewnętrznego
do leczenia kurzej klatki piersiowej
Operacyjne metody małoinwazyjne stosowane są głównie w leczeniu
pacjentów przy silnie rozwiniętych wadach bądź po nieudanym leczeniu za
pomocą stabilizatora zewnętrznego [8‚10]. W celu przywrócenia
anatomicznego ukształtowania klatki piersiowej podczas zabiegu
operacyjnego wykorzystywane są odpowiednio wyprofilowane implanty
(rys. 3a) [6]. Alternatywą technik operacyjnych jest leczenie zachowawcze
polegające na zastosowaniu ortotycznych stabilizatorów zewnętrznych (rys.
3b). Główną zasadą działania zewnętrznego stabilizatora jest zastosowanie
przez dłuższy czas ciągłego nacisku na występujące zdeformowanie w celu
wymodelowania chrząstek żebrowych. Stabilizator zewnętrzny wykorzystujepasy z klamrami otaczającymi klatkę piersiową. Posiada co
najmniej dwa punkty kontaktu ze ścianami klatki piersiowej. Jeden punkt
styku występuje z przodu i ma na celu dostarczania nacisku na deformację,
drugi punkt występuje od strony pleców. Zakłada się, że podatna klatka
piersiowa dostosowuje się do tej techniki więc stosowanie stabilizatora
zewnętrznego wymaga podatności klatki piersiowej [10].
Stabilizatory ortotyczneze względu na rodzaj występującej wady są
dobierane i projektowane indywidualnie dla każdego pacjenta. Ich
zadaniem jest uzyskanie anatomicznego ukształtowania klatki piersiowej
oraz geometrycznego wyrównania poprzez generowanie sił oddziałujących
na punkty najbardziej uwypuklonego miejsca [11].
Ta metoda leczenia dedykowana jest głównie dla młodych pacjentów
ze względu na plastyczność chrząstek żebrowych oraz dla pacjentów,
u których wada występuje o słabym bądź umiarkowanym nasileniu.
Stabilizator, jako alternatywa dla leczenia chirurgicznego przynosi
pozytywne efekty lecznicze, pozwalając uniknąć pooperacyjnych powikłań,
blizn oraz bólu [12, 13].
Wykorzystanie zasad mechaniki i biomechaniki w połączeniu z metodami
komputerowymi pozwala na stworzenie spersonalizowanych konstrukcji
stabilizatorów stosowanych w leczeniu wad kurzej klatki piersiowej.
Rysunek 3. Materiały wspomagające leczenie kurzej klatki piersiowej: a) płyta stabilizująca
stosowana w leczeniu operacyjnym [6], b) stabilizator zewnętrzny firmy Trulifestosowany
w leczeniu zachowawczym [14]
279
Magdalena Antonowicz, Anita Kajzer, Magdalena Grygiel-Pradelok
Zasadniczym celem pracy było skonstruowanie fizycznego prototypu
stabilizatora zewnętrznego dla mężczyzny w wieku 24 lat.
W ramach pracy przeprowadzono uproszczoną analizę wytrzymałościową
elementów stabilizatora metodą elementów skończonych (MES),
wceluwytypowania obszarów o największych wartościach naprężeń. Na
podstawie uzyskanych wyników dobrano materiały wykorzystywane na
poszczególne jego elementy, dla których w dalszej kolejności przeprowadzono
badania własności wytrzymałościowych. Efektem końcowym prowadzonych
badań było wytworzenie prototypu stabilizatora do leczenia kurzej klatki
piersiowej.
2. Materiały stosowane do konstrukcji stabilizatora zewnętrznego
Stabilizator zewnętrzny do leczenia kurzej klatki piersiowej, zwany
również ortezą,zdefiniowanym w normie dotyczącej biologicznej oceny
wyrobów medycznych ISO 10993-1 jest wyrobem medycznym kontaktującym
się z powierzchnią skóry. Stabilizator zewnętrzny charakteryzuje się
konstrukcją techniczną dopasowaną do całej lub części kończyny górnej bądź
dolnej, tułowia, głowy lub karku, atakże ich pośrednich przegubów. Ma za
zadanie wspomagać lub zastępować funkcje statyczne i ruchowe oraz
zabezpieczać przed powstaniem lub pogłębianiem się zniekształceń. Ortezę
konstruują, opracowują technicy protetycy i ortotycy zakładów
ortopedycznych na podstawie indywidualnych pomiarów[15, 16].
Materiałem, który może być zastosowany do produkcji stabilizatorów
zewnętrznych będący wyrobem medycznym może być każdy polimer
naturalny bądź syntetyczny, metal, stop metali, ceramika lub inna substancja
nieożywiona, włączając w to tkankę pozbawioną funkcji życiowych. Przy
doborze materiałów, które zostaną użyte przy produkcji wyrobu, zalecane jest
rozważenie przydatności do zamierzonego celu. Należy wziąć pod uwagę
cechy i własności materiału, w tym: toksykologiczne, morfologiczne,
mechaniczne, elektryczne, chemiczne oraz fizyczne. Zaleca się również, aby
zwrócić uwagę na materiały biologiczne, przewidziane środki dodatkowe,
zanieczyszczenia z procesu produkcyjnego i ich pozostałości, substancje
wymywalne, produkty degradacji, inne składniki i ich interakcje w produkcie
gotowym oraz własności i charakterystykę produktu końcowego ze względu
na wpływ na ogólną biologiczną ocenę wyrobów [15]. Przy doborze
materiałów składowych ortezy należy również wziąć pod uwagę cechy takie
jak [17]:
 własności mechaniczne;
 stopień kontaktu, inwazyjności z ciałem ludzkim;
 okres zastosowania;
 możliwości wykonawcze;
 ekonomiczność rozwiązania.
280
Dobór własności mechanicznych elementów stabilizatora zewnętrznego
do leczenia kurzej klatki piersiowej
W ostatnich latach nastąpił dynamiczny rozwój metod stabilizacji
zewnętrznej kurzej klatki piersiowej. Na podstawie literatury można
stwierdzić, że składowe stabilizatorów wykonywane są głównie z materiałów
lekkich, szyn aluminiowych oraz elementów polimerowych [18‚20].
3. Materiały i metody
3.1. Model trójwymiarowy stabilizatora zewnętrznego
Wykonanie fizycznego modelu spersonalizowanego prototypu stabilizatora
zewnętrznego do leczenia kurzej klatki piersiowej wymaga precyzyjnego
opracowania wieloetapowej procedury. Pierwszym, niezbędnym etapem było
sformułowanie modelu geometrycznego stabilizatora zewnętrznego dla
konkretnego przypadku – mężczyzna lat 24.W tym celu przeniesiono
rzeczywisty kształt trójwymiarowy męskiej klatki piersiowej o prawidłowej
budowie (rys. 4a) do postaci cyfrowej z wykorzystaniem ręcznego skanera
HandyScan 3D Revscan oraz oprogramowaniaGeoMagic 2012, a następnie
w programie InventorFusion 2012 zasymulowano kurzą klatkę piersiową,
która występuje wg literatury najczęściej (typ 5 wg skali Willitala
– zniekształcenie symetryczne) (rys. 4b).
Rysunek 4.Model klatki piersiowej: a) o prawidłowej budowie, b) kurzej [opracowanie własne]
Na podstawie zamodelowanej kurzej klatki piersiowej zaprojektowano
spersonalizowany stabilizator zewnętrzny do jej leczenia. Na etapie
projektowania modelu wzięto pod uwagę założenia konstrukcyjne,
materiałowe (aluminium H24, polimetakrylan metylu, poliuretan oraz
polipropylen), użytkowe, funkcjonalne, estetyczne, a także płeć, wiek oraz
predyspozycje rekonwalescenta. Model stabilizatora zewnętrznego
wykonano w programie Inventor Professional 2015.W skład stabilizatora
wchodzi 13 elementów stałych oraz 2 dodatkowe. Główne elementy, które
odgrywają najważniejszą rolę w konstrukcji stabilizatora to łuk przedni
oraz tylni okalające klatkę piersiową,połączone za pomocą pasków
zapadkowych oraz klamer umożliwiającychregulację siły nacisku
281
Magdalena Antonowicz, Anita Kajzer, Magdalena Grygiel-Pradelok
stabilizatora względem zniekształcenia. Symetrycznie, na środkowej części
łuku przedniego umieszczono element powodujący ucisk największego
uwypuklenia kurzej klatki piersiowej,tym samym przywracając pozycję
mostka do pozycji anatomicznej.Zaprojektowano ochraniające pianki
mające na celu zabezpieczeniepowierzchni skóry pacjenta przed możliwym
podrażnieniem przez otaczające klatkę piersiową łuki. W celu nadania
estetyki zaprojektowano pokrowce, które są elementami dodatkowymi.
Utrzymanie stabilizatora w pozycji prawidłowej odbywa się poprzez
odpowiedni docisk realizowany przez paski zapadkowe, natomiast w celu
zwiększenia stabilności zamodelowano szelki (rys. 5).
8
1
7
6
2
3
4
5
Rysunek 5. Model geometryczny stabilizatora zewnętrznego 1-pokrowiec tylni, pod nim pianka
oraz łuk tylni, 2-pasek zapadkowy, 3-klamra zaciskająca, 4-Pokrowiec prawy, pod nim pianka
oraz łuk przedni, 5-łuk przedni, 6-pokrowiec na element uciskający, pod nim pianka, 7-element
uciskający, 8-szelki [opracowanie własne]
3.2. Analiza wytrzymałościowa
Zweryfikowanie wartości własności wytrzymałościowychelementów
konstrukcji stabilizatora zewnętrznego przeprowadzono za pomocą uproszczonej analizy numerycznej metodąelementów skończonych.
3.2.1. Uproszczony model
Model stabilizatora zewnętrznego uproszczono do elementu łuku
przedniego, elementu uciskającego oraz wkrętów mocujących ze sobą
obydwie częściortezy.Dodatkowo zamodelowano kościec odcinka piersiowego klatki piersiowej o szerokości 100mm. Zbudowane modele tworzą ze
sobą układ stabilizator – kość (rys. 6).
282
Dobór własności mechanicznych elementów stabilizatora zewnętrznego
do leczenia kurzej klatki piersiowej
Rysunek 6. Uproszczony model geometryczny stabilizatora zewnętrznego oraz łuku odcinka
piersiowego klatki piersiowej [opracowanie własne]
3.2.2. Opracowanie modelu obliczeniowego oraz wyniki analizy
Dyskretyzację opracowanego układu stabilizator – kość wykonano
z wykorzystaniem oprogramowania ANSYS Workbench v15 i elementu
typu SOLID187. Dla układu stabilizator – kość wygenerowano siatkę
o wysokiej jakości wykorzystując zaawansowane metody dyskretyzacyjne,
tj. generowanie siatki od wnętrza objętości oraz wysoką jejrelewancję co
pozwoliło na uzyskanie siatki o skośności poniżej 0,8 co przekłada się na
miarodajność wyników (rys. 7).
a)
c)
d)
b)
Rysunek 7. Modele zdyskretyzowane: a) kość żebra, b) łuk stabilizatora, c) element uciskający,
d) wkręty [opracowanie własne]
Zakres przeprowadzonej analizy obejmował: wyznaczenie stanu
przemieszczeń, odkształceń i naprężeń zredukowanych w poszczególnych
elementach układu stabilizator-kość w zależności od zadanego przemieszczenia. Poszczególnym elementom nadano własności mechaniczne struktur na
podstawie danych literaturowych (tab. 1) [21, 22] oraz nadano warunki
283
Magdalena Antonowicz, Anita Kajzer, Magdalena Grygiel-Pradelok
brzegowe, które z odpowiednim uproszczeniem odwzorowują zjawiska
zachodzące w układzie rzeczywistym. Zastosowano przemieszczenie
2,5 mm przyłożone na końcachłuku przedniego, które spowodowało
przywrócenieprzedniego łuku klatki piersiowej do pozycji anatomicznej
(rys. 8). Połączenie stabilizatora z kością zrealizowano poprzez nadanie
kontaktów tarciowych o współczynniku tarcia μ = 0,4.
F
F
Rysunek 8. Zadane przemieszczenie dla układu stabilizator – kość [opracowanie własne]
Tabela 1. Dane materiałowe dla potrzeby analizy [21, 22]
Element
Moduł Younga
[MPa]
Liczba Poissona
Kość
żebra
Łukprzedni
stabilizatora
(aluminium
H24)
Element
uciskający
(polimetakrylan
metylu)
Wkręty
mocujące
7500
69000
2450
200000
0,3
0,33
0,375
0,3
Rysunek 9. Rozkład przemieszczeń zredukowanych dla przemieszczenia o 2,5 mm w układzie
stabilizator-kośćna osi Z [opracowanie własne]
284
Dobór własności mechanicznych elementów stabilizatora zewnętrznego
do leczenia kurzej klatki piersiowej
a)
b)
c)
d)
Rysunek 10. Rozkład odkształceń zredukowanych dla przemieszczenia o 2,5 mm w elementach
układu stabilizator-kość: a) kość żebra, b) łuk przedni, c) element uciskający, d) wkręt
[opracowanie własne]
a)
b)
c)
d)
Rysunek 11. Rozkład naprężeń zredukowanych dla przemieszczenia o 2,5 mm w elementach
układu stabilizator-kość: a) kość żebra, b) łuk przedni, c) element uciskający, d) wkręt
[opracowanie własne]
285
Magdalena Antonowicz, Anita Kajzer, Magdalena Grygiel-Pradelok
Na podstawie uzyskanych wyników stwierdzono zróżnicowany rozkład
wartości przemieszczeń, odkształceń i naprężeńzredukowanych zarówno
w poszczególnych
elementach
stabilizatora,jak
i fragmencie
kości.Największa wartość przemieszczenia wystąpiław środkowej części
łuku stabilizatora pod elementem uciskającym w kierunku osi „Z”
i wyniosła l= 0,49 mm (rys. 9).
Ponadto stwierdzono, że maksymalne odkształcenie przy przemieszczeniu o 2,5 mm zaobserwowano na zewnętrznych krawędziach elementu
uciskającego,które
wynosiłoεmax = 0,19 %,
naprężenie
natomiast
ζmax = 4,67 MPa. W kości żebra odkształcenie wyniosło εmax = 0,042 %,
natomiast naprężenie ζmax = 3,15 MPa. Przy tym samym przemieszczeniu
zaobserwowano również maksymalne naprężenie, które wystąpiło w łuku
przednim ζmax = 102,45 MPa, odkształcenie w tym miejscu wyniosło
εmax= 0,14 %. We wkrętach łączących ze sobą łuk przedni oraz element
uciskowy naprężenie wyniosło ζmax = 12,48 MPa, natomiast odkształcenie
εmax= 0,012%(rys. 10, 11).
125
105
Kość
Naprężenie, MPa
85
Łuk
przedni
65
45
Element
uciskając
y
Wkręt
25
5
-15
0,5
1,0
1,5
2,0
2,5
3,0
3,5
4,0
4,5
5,0
Przemieszczenie, mm
Rysunek 12. Naprężenia zredukowane w elementach stabilizatora w zależności od
przemieszczenia układu [opracowanie własne]
Uzyskane wartości przemieszczeń świadczą o stabilności i odpowiedniej sztywności analizowanego układu. Wartości naprężeń zredukowanych w stabilizatorze dla łuku przedniego nie przekroczyły granicy
plastyczności aluminium (Rp0,2= 123 MPa) (rys. 12) przy przemieszczeniu
układu w zakresie 0,5 mm‚ 3,0 mm. Gwarantuje to odkształcenie
elementów stabilizatora w zakresie sprężystym. Natomiast przekroczenie
tej wartości następuje przy przemieszczeniu układu powyżej 3,0 mm.
286
Dobór własności mechanicznych elementów stabilizatora zewnętrznego
do leczenia kurzej klatki piersiowej
3.3. Badania własności mechanicznych elementów konstrukcyjnych
W celu zweryfikowania wyników analizy numerycznej wstępnie
dobranych materiałów konstrukcyjnych stabilizatora (głównie na łuki
okalające klatkę piersiową) przeprowadzono statyczną próbę rozciągania.
Do badań wytypowano blachę aluminium H24w stanie umocnionym,
o grubościach: 0,5 mm, 1,0 mm, 1,5 mm i własnościach mechanicznych
przedstawionych w tabeli 2 będącą materiałem odgrywającym najważniejszą rolę w konstrukcji stabilizatora. Dodatkowo statyczną próbę
rozciągania przeprowadzono dla pasków poliuretanowych zastosowanych
na paski zapadkowe oraz pasy polipropylenowe na ramiączka. W celu
przeprowadzenia statycznej próby rozciągania przygotowano próbki
aluminium dla każdej z grubości (rys. 13) oraz próbki poliuretanowe (rys. 14)
i polipropylenowe (rys. 15).
Tabela 2. Własności mechaniczne blachy aluminiowej o grubości 0,5 mm, 1,0 mm, 1,5 mm [23]
Własności mechaniczne
dla przekroju
poprzecznego
Blacha
0,5 mm
aluminiow
1,0 mm
a
1,5 mm
o grubości
Wytrzymałość
na rozciąganie
Rm [MPa]
138,0
123,0
Granica
plastyczności
Rp0,2 [MPa]
127,0
116,0
129,0
123,0
Wydłużenie
A50 [%]
6,4
4,3
5,2
Rysunek 13. Aluminiowe próbki do badania [opracowanie własne]
Rysunek 14. Próbki pasa poliuretanowego
[opracowanie własne]
Rysunek 15. Próbki pasa polipropylenowego
[opracowani własne]
287
Magdalena Antonowicz, Anita Kajzer, Magdalena Grygiel-Pradelok
Statyczną próbę rozciągania przeprowadzono zgodnie z zaleceniami
normy PN-EN ISO 6892-1 [24]. W badaniach wykorzystano maszynę
wytrzymałościową firmy MTS Criterion model 45. Próba dla wszystkich
trzech rodzajów próbek została przeprowadzona w temperaturze pokojowej
T=23°C z prędkością rozciągania 5 mm/min.
Na podstawie wyników statycznej próby rozciągania wygenerowano
przykładowy wykres dla próbek 3Al_0,5, 3Al_1,0 oraz 3Al_1,5 zależności
wartości siły od wartościwydłużenia(rys. 16).
2500
Siła, N
2000
1500
3Al_0,5
1000
3Al_1,0
500
3Al_1,5
0
0,0 0,2 0,5 0,7 0,9 1,2 1,4 1,6 1,9 2,1 2,3 2,6 2,8
Wydłużenie, mm
Rysunek 16. Przykładowy wykres zależności siła – wydłużenie dla próbek aluminiowych
[opracowanie własne]
Granica plastyczności dla blachy 0,5 mm, 1,0 mm oraz 1,5 mm jest
zbliżona. Próbka aluminium o grubości 1,5 mm charakteryzuje się
największym odkształceniem, a jej granica plastyczności wyniosła 123MPa.
Na podstawie wyników statycznej próby rozciągania pasów
poliuretanowych oraz polipropylenowych stwierdzono, iż są wystarczająco
wytrzymałe na elementy stabilizatora zewnętrznego.
4. Prototyp stabilizatora zewnętrznego
Na podstawie procedur weryfikujących konstrukcje stabilizatora
zewnętrznego, przygotowano jego składowe poprzez następujące czynności:
 wyciętoz blachy aluminiowej za pomocą strumienia wody elementów
do wyprofilowania z nich łuków: przedniego oraz tylnego;
 wyciętostrumieniem wody części z polimetakrylanu metylu jako
elementu uciskającego największe uwypuklenie;
 wycięto ręcznie pianki poliuretanowe: przednie, tylneoraz na element
uciskający, ochraniających ciało przed podrażnieniem przez aluminiowe
łuki;
288
Dobór własności mechanicznych elementów stabilizatora zewnętrznego
do leczenia kurzej klatki piersiowej
 zapadkowe paski polipropylenowe oraz klamry zaciskające jako
elementy gotowe, mające za zadanie przemieszczenie stabilizatora
jednocześnie uciskając klatkę piersiową;
 wykonano dwa zestawypokrowców na elementy stabilizatora
z materiału bawełnianego. W skład jednego zestawu wchodzą dwa
przedniepokrowce, jeden tylni oraz pokrowiec na element
uciskający. Od strony wewnętrznej pokrowca, przymocowano piankę
poliuretanową, przy dolnej krawędzi przymocowano zatrzaski
umożliwiające zapięcie pokrowców natomiast na krawędzi górnej
wykonano szlufki w celu przymocowania szelek Wykonane zostały
dwa zestawy, ze względu na możliwość ich wymiany. Pokrowiec ma
za zadanie ochronę przed podrażnieniami, zachowanie higieny oraz
estetyki;
 wykonano szelki stabilizująceo długości 60 cm z dodatkową możliwością regulacji o 30 cm oraz ich odpięcia za pomocą haczyków.
Tak przygotowane składowe elementów ze sobą połączono tworząc
gotowy prototyp stabilizatora zewnętrznego (rys. 17, 18). W konstrukcji
stabilizatora elementami nieruchomymi są paski zapadkowe oraz klamry
zaciskające. Pozostałe części mogą zostać zdemontowane w celu wymiany
pokrowca bądź jego oczyszczenia.
Rysunek 17. Stabilizator zewnętrzny po montażu wszystkich składowych
289
Magdalena Antonowicz, Anita Kajzer, Magdalena Grygiel-Pradelok
Rysunek 18. Stabilizator zewnętrzny umieszczony na klatce piersiowej
5. Podsumowanie
W przedstawionej pracy zaprezentowano najistotniejsze aspekty
dotyczące problematyki leczenia kurzej klatki piersiowej za pomocą
stabilizatorów zewnętrznych. Dyskomfort psychiczny wywołany przez
wadę kurzej klatki piersiowej powoduje wzrost zapotrzebowania na
skuteczne i szybkie metody leczenia tej wady. W ostatnich latach nastąpił
dynamiczny rozwój metod stabilizacji zewnętrznej kurzej klatki piersiowej.
Wpracy głównie skoncentrowano się na procedurach pozwalających na
konstrukcję fizycznego modelu stabilizatora zewnętrznego męskiego – ze
względu na większy odsetek zachorowań wśród mężczyzn. Trudnością
w podjęciu działań konstrukcyjnych jest indywidualne uwarunkowanie
anatomiczne pacjenta oraz rodzaj i nasilenie wady.
Pierwszym etapem było zaprojektowanie precyzyjnego stabilizatora
zewnętrznego na podstawie wykonanego modelu kurzej klatki piersiowej
oraz dobrano wstępnie materiały. W celu weryfikacji prawidłowego doboru
materiałów na składowe stabilizatora wykonano analizę numeryczną
z wykorzystaniem metody elementów skończonych dla uproszczonego
układu stabilizator – kość. Wyniki analizy numerycznej elementów układu
stabilizator- kość wskazują na zróżnicowany rozkład wartości przemieszczeń, odkształceń i naprężeń zredukowanych. Przy przemieszczeniu
stabilizatora w zakresie L = 0,5 mm – 3,0 mm nie przekroczono granicy
plastyczności zarówno w poszczególnych jego elementach, jak i w kości
żebra. Następnie na podstawie wyników statycznej próby rozciągania
stwierdzono że, materiałami konstrukcyjnymi na elementy stabilizatora są:
blacha aluminium o grubości 1,5 mm, paski poliuretanowe oraz pasy
polipropylenowe. Wyniki analizy numerycznej metodą elementów
290
Dobór własności mechanicznych elementów stabilizatora zewnętrznego
do leczenia kurzej klatki piersiowej
skończonych oraz statycznej próby rozciągania materiału dobranego na łuki
okalające klatkę piersiową tj. aluminium H24 wskazują,żedobrany materiał
jest wytrzymały, nie narażając na odkształcenie materiału podczas
stabilizacji. Szacunkowy koszt wykonanego stabilizatora wynosi 170,45 zł
uwzględniając w nim materiał oraz usługi produkcyjne, natomiast koszt
zewnętrznego stabilizatora do leczenia kurzej klatki piersiowej firmy
Trulife wynosi około 600 zł [23]. Koszt wykonanego stabilizatora uległ
czterokrotnemu zmniejszeniu.
Literatura
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
Fibak J.,Chirurgia repetytorium, Warszawa : Wydawnictwo Lekarskie PZWL,
(2004) s. 164-169
Stoba Cz., Willitala G. H., Sołtysiak P. K., Atlas chirurgii dziecięcej, Pelpin :
Bernardinum, (2008) s. 31-41
Czernik J., Powikłania w chirurgii dziecięcej, Wydawnictwo Lekarskie
PZWL, Warszawa,(2009) s. 58, 59, 330-347
http://isurgical3d.com/. [Online]
Coelho M., Guimaraes P., Pecus Carinatum, The Journal Brasileiro de
Pneumologia, (2007), strony 463-474
Kajzer A., Kajzer W., Dzielicki J., Matejczyk D,. The study of
physicochemical properties stabilizing plates removed from the body after
treatment of pectus excavantum, Acta of Bioengineering and Biomechanics,
(2015), 2, strony 35-44
Fokin A. A, Steuerwald N. M., Ahrens W. A., Allen K.E., Anatomical,
Histologic, and Genetic Characteristics of Congenital Chest Wall Deformities,
Thoracic and Cardiovascular Surgery, Elsevier (2009), s. 44-57
Park C. H., Kim T., Haam S. J., Jeon I., Lee S., The etiology of pectus
carinatum involves overgrowth of costal cartilage and undergrowth of ribs,
Journal of Pediatric Surgery, (2014) (49), s. 1252-1258
Emil S., Laberge J. M., Sigalet D., Baird R., Pectus carinatum treatment in
Canada: current practices, Journal of Pediatric Surgery, (2012) (47), s. 862-866
Cohee A. S., Lin J. R., Frantz F. W., Kelly R. E., Staged management of
pectus carinatum, Journal of Pediatric Surgery, (2013) (48), s. 315-320
Stephenson J. T., Du Bois J., Compressive orthotic bracing in the treatment
of pectus carinatum: the use of radiographic markers to predict success,
Journal of Pediatric Surgery, (2008) (43), s. 1776-1780
Martinez-Ferro M., Fraire C., Bernard S., Dynamic compression system for the
correction of pectus carinatum, Seminars in Pediatric Surgery, (2008) (17),
s. 194-200
Desmarais T. J., Keller M. S., Pectus Carinatum, Current Opinion surgery,
(2013) (25), s. 375-379
www.trulife.com[Online]
Norma PN – EN ISO 10993-1 Biologiczna ocena wyrobów medycznych, s. 5-7
Norma PN-EN ISO 9999 Pomoce techniczne dla osób niepełnosprawnych.
Klasyfikacja
291
Magdalena Antonowicz, Anita Kajzer, Magdalena Grygiel-Pradelok
17. Marciniak J., Biomateriały, Wydawnictwo Politechniki Śląskiej, Gliwice
(2013), s. 18-27, 376-402
18. Kravarusic D., Dicken B. J., Dewar R., Harder J., Poncet P., Schneider M.,
Sigalet D. L,. The Calgary protocol for bracing of pectus carinatum:
a preliminary report, Journal of Pediatric Surgery, (2006) (41), s. 923-926
19. Kang Y., Jung J., Chung S., Cho J., Lee S., Factors affecting patient
compliance with compressive brace therapy for pectus carinatum, Interactive
CardioVascular and Thoracic Surgery (2014) s. 1-4
20. www.oandp.com [Online]
21. Pezowicz C., Głowacki M., The mechanical properties of human ribs in young
adult. Acta of bioengineering and biomechanics.2012, Tom 2, 14, strony 53-60
22. www.matweb.com [Online]
23. Inspection Certificate AssanAluminyum EN 10204-3.1
24. Norma PN-EN ISO 6892-1: Metale, Próba rozciągania, Część 1: Metoda
badania w temperaturze pokojowej
Dobór własności mechanicznych elementów stabilizatora zewnętrznego
do leczenia kurzej klatki piersiowej
Celem pracy było zaprojektowanie oraz wykonanie prototypu zewnętrznego stabilizatora do
leczenia kurzej klatki piersiowej.
Na podstawie wykonanego skanu 3D powierzchni skóry klatki piersiowej o prawidłowej
budowie dokonano symulacji kurzej klatki piersiowej. Wykonane modele umożliwiły precyzyjne
zaprojektowanie i wytworzenie spersonalizowanego stabilizatora zewnętrznego. W celu zweryfikowania poprawności konstrukcji oraz doboru materiału na składowe stabilizatora wykonano
analizę numeryczną za pomocą metody elementów skończonych. Na podstawie otrzymanych
wartości przemieszczeń, odkształceń i naprężeń zredukowanych oraz wyników statycznej próby
rozciągania stwierdzono, że najkorzystniejszymimateriałami na składowe stabilizatora są:
aluminium o grubości 1,5 mm, pasy poliuretanowe oraz pasy polipropylenowe.
Selection of mechanical properties of materials used in components of
stabilizer for pectus carinatum treatment
The aim of this study has been to design and make an external orthotic stabilizer (pectus bracing)
used the in treatment of the chicken chest (pectus carinatum). On the basis of a 3D scan
performed of the skin surface of the normal structured chest, there has been a simulation
performed of the pectus carinatum. The performed models have made it possible to design and
produce a personalized external stabilizer. In order to verify the correctness of the design and the
selection of material making up the components of the pectus bracing, there has been a numerical
analysis performed using the finite-element method. Based on the obtained values of dislocations,
reduced stress and tensions and the static tensile test along, it has been found that the best
materials for the components of the pectus bracing include: aluminum 1.5 mm thick,
polyurethane belts and polypropylene straps.
292
Żaneta Anna Mierzejewska1
Wieloaspektowa analiza problematyki
związanej z mechanizmami niszczenia implantów
1. Wstęp
Przyczyn szybkiego zużywania się stawów, zarówno naturalnych, jak
i sztucznych, jest kilka, m.in. aktywny tryb życia, wzrost liczby urazów,
w tym wypadków komunikacyjnych i kontuzji przy uprawianiu sportu,
często również nadwaga. Średnia wieku pacjentów poddawanych operacji
endoprotezoplastyki stawu biodrowego z każdym rokiem spada, natomiast
liczba wykonanych operacji systematycznie rośnie [1]. Lekarze ostrzegają
przed przeprowadzania endoprotezoplastyki u młodych ludzi przez wzgląd
na ograniczoną trwałość protez, niestety – coraz częściej zdarza się, że po
kilkunastu latach od operacji stan endoprotezy wymaga jej reimplantacji
[1]. W efekcie obok kolejki osób oczekujących na protezoplastykę pierwotną, tworzy się druga kolejka czekających na realloplastykę. Mimo to,
chorzy bardzo często decydują się na wymianę stawu, bowiem taki zabieg
oznacza dla nich powrót do życia pozbawionego dolegliwości bólowych [2].
Powszechnie stosowane do wytwarzania implantów materiały
metaliczne, pomimo wielu zalet, posiadają szereg niekorzystnych cech.
Metale o bardzo dobrych właściwościach mechanicznych są zbyt sztywne
w stosunku do kości, jak również ulegają korozji w agresywnym
środowisku biologicznym. Działanie na implanty naprężeń mechanicznych
i obecność płynów ustrojowych, może przyspieszać ich degradację,
zmniejszyć stabilność i trwałość [3].
2. Cel pracy
W pierwszej części pracy omówiono i przeanalizowano obciążenia oraz
warunki ich występowania w stawie biodrowym. Przedstawiono tu najczęściej opisywane modele przenoszenia obciążeń. W kolejnym rozdziale
krótko scharakteryzowano protezoplastykę, jej przebieg oraz powody, dla
których zabieg ten jest wykonywany. Dalsza część pracy zwraca uwagę na
problemy związane z eksploatacją materiałów stosowanych na implanty,
przeanalizowano procesy niszczenia, a także problemy związane z eksploatacją i pękaniem trzpieni.
1
[email protected], Katedra Inżynierii Materiałowej i Biomedycznej,
Wydział Mechaniczny, Politechnika Białostocka, www.pb.edu.pl
293
Żaneta Anna Mierzejewska
3. Analiza warunków obciążeń w stawie biodrowym
Układ ruchowy człowieka jest złożony z wzajemnie powiązanych ze
sobą za pomocą więzadeł stawów i mięśni, nad którymi kontrolę sprawuje
układ nerwowy. Każda zmiana anatomiczna lub fizjologiczna powoduje
zaburzenia funkcjonowania i biomechaniki całego układu, ponieważ
stanowi on łańcuch kinematyczny [3]. Staw biodrowy, jako składowa
narządu ruchu podlega obciążeniom statycznym, które wynikają z oddziaływań mięśni, dynamicznym, powstającym na skutek wykonywanych
ruchów oraz obciążeniom wynikającym z masy ciała. Wyróżniamy dwa
rodzaje obciążeń: przewlekłe – powolne, systematyczne powstawanie
zmian zwyrodnieniowych oraz nagłe, prowadzące do pęknięcia lub
złamania kości [4]. Przenoszenie wymienionych obciążeń z kręgosłupa
przez miednice na kończyny dolne prezentuje rys. 1.
Siły oddziaływujące na staw biodrowy podzielić można na zewnętrzne
i wewnętrzne. Siłami zewnętrznymi określa się siły przyciągania
ziemskiego, oddziaływanie podporowe oraz siły, z jakimi inne ciała
oddziaływają na organizm ludzki. Do sił wewnętrznych zalicza się siły,
które są wynikiem pracy mięśni [3]. Dzięki odpowiedniej budowie stawu
biodrowego, strukturze kostnej, silnym mięśniom i więzadłom, przystosowany jest on do przenoszenia dużych obciążeń oraz pełnienia funkcji
podporowej podczas statycznego obciążenia kończyn. Ocena kierunków
i wartości oddziaływań, z uwagi na dużą liczbę mięśni i miejsc przyłożenia
sił oraz zmieniających się faz chodu, jest bardzo trudna. Wynika to ze
zmiany położenia środka ciężkości ciała oraz ruchów w innych płaszczyznach (przywodzenie, odwodzenie, ruchy rotacyjne). W pracy przedstawiono trzy najczęściej opisywane w źródłach literaturowych modele
przenoszenia obciążeń.
3.1. Model Pauwelsa
Model ten rozpatruje fazę obciążania obunożnego i jednonożnego
(rys.2a,b). Obciążenia pochodzące od głowy, tułowia i kończyn górnych
stanowią 62% masy ciała. W modelu Pauwelsa wektor siły (R) ukierunkowany jest w punkt obrotu (O), stanowiący anatomiczny środek głowy kości
udowej. Przyjmuje się, że całkowita wartość sił obciążających staw w fazie
podparcia jednonożnego, wynika z oddziaływania masy ciała i sił mięśni
okołostawowych. Relacje te przestawia się graficznie za pomocą
dwuramiennej dźwigni, której punkt podparcia odwzorowuje środek stawu
biodrowego [5].
Siła R jest wielkością wypadkową zredukowanego ciężaru ciała
(P; Pz = 0,81 P) oraz siły mięśni odwodzących (M), tj. pośladkowego
średniego i małego. Model uwzględnia oddziaływanie pasma biodrowopiszczelowego, natomiast w płaszczyźnie horyzontalnej – oddziaływanie
mięśni rotujących.
294
Wieloaspektowa analiza problematyki związanej z mechanizmami niszczenia implantów
Rysunek 1. Model przenoszenia obciążeń z kręgosłupa na kończyny dolne [5]
b)
a)
c)
d)
Rysunek 2. Model obciążeń wg Pauwelsa: (a) podparcie obunożne, (b) podparcie jednonożne,
(c) aktywny model oddziaływań obciążeń w stawie biodrowym wg Maqueta,
(d) wg Będzińskiego [5]
3.2. Model Maqueta
Na bazie modelu Pauwelsa powstał model Maqueta (rys.2. c), który
w odmienny sposób przedstawia pasmo biodrowo-piszczelowe. W modelu
tym, pasmo zewnętrzne w powięzi szerokiej uda napinane jest przez
odwodziciele. Symulacja modelu przedstawia pasmo jako cięgno, które
biegnie wzdłuż kości udowej od stawu kolanowego do kości miednicy
i opiera się na krętarzu kości udowej, dzięki czemu ma możliwość ślizgania
się po nim. Taki model stabilizuje staw biodrowy lepiej poprzez dodatkową
siłę poziomą [6].
3.3. Aktywny model oddziaływania obciążeń (Będzińskiego)
Uwzględnia oddziaływanie masy tułowia na głowę kości udowej (R),
jak również oddziaływania mięśni odwodzicieli (M), pasma biodrowo
piszczelowego (T) oraz oddziaływanie mięśni rotujących, powodujących
295
Żaneta Anna Mierzejewska
skręcanie kości udowej (rys.2d) [5]. Obciążenia mechaniczne, występujące
w warunkach statycznych i dynamicznych, mają istotny wpływ na
wytrzymałość struktur kostnych oraz ich budowę wewnętrzną
3.4. Rozkład sił w stawie biodrowym
W odcinku bliższym kość udowa tworzy skomplikowany mechaniczny
układ: ciężar ciała przenoszony jest z głowy kości udowej na jej trzon
poprzez dźwignię, którą tworzy szyjka kości udowej i okolice krętarzy.
Wektor tej siły, wg Pauwelsa działa pod kątem 159º do osi pionowej.
Obciążenie podczas podparcia jednonożnego wzrasta trzykrotnie [4]. Punkt
przyłożenia siły oraz jej wektor przebiegają w oddaleniu od osi długiej
kości udowej, co jest wynikiem przesunięcia przyśrodkowego mechanicznej osi w stosunku do osi anatomicznej kończyny dolnej. To z kolei
powoduje powstawanie w korowej warstwie kości udowej sił rozciągających (po stronie bocznej) i sił ściskających (po stronie przyśrodkowej).
Siły te współistnieją w ścisłej równowadze – pomimo przeważającego
działania sił ściskających, boczne ukształtowanie kości udowej kompensuje
różnice sił [7]. Biomechaniczną konsekwencją działania zbyt dużych sił są
najczęściej złamania w okolicy krętarza mniejszego, które stanowią 34%
wszystkich złamań w okolicy biodra.
W doświadczeniach nad biomechaniką oraz patomechaniką stawu
biodrowego opracowywane są modele fizjologicznego rozkładu sił
i naprężeń w stawie biodrowym. Badanie są również właściwości
mechaniczne, zwłaszcza sztywność i wytrzymałość na obciążenia udarowe
konstruowanych endoprotez przed i po implantacji. W badaniach tych
coraz częściej wykorzystuje się komputerowe techniki numerycznej
symulacji z zastosowaniem Metody Elementów Skończonych (MES).
4. Alloplastyka stawu biodrowego
Endoprotezoplastykę stawu biodrowego stosuje się wtedy, gdy staw
ulega zniszczeniu w wyniku procesów chorobowych (choroba zwyrodnieniowa, reumatoidalne zapalenie stawów, dysplazja stawu biodrowego,
jałowa martwica kości udowej) i uniemożliwia funkcjonowanie lub gdy
doszło do złamania szyjki kości udowej [8]. Pogorszenie stanu stawu może
także nastąpić na skutek wielu wrodzonych i nabytych chorób oraz urazów.
Zabieg ten zajmuje z reguły do 2 godzin. Chirurg wykonuje pojedyncze
cięcie (długości 20-30 cm) ponad biodrem i udem. Przecinana jest szyjka
kości udowej, po czym usuwana jest uszkodzona główka stawowa. Aby
przygotować miejsce na wszczepienie endoprotezy stawu biodrowego
wycina się chorą panewkę stawową i na jej miejscu mocuje się protezę
panewki. Następnie opracowuje się jamę szpikową, w sposób
296
Wieloaspektowa analiza problematyki związanej z mechanizmami niszczenia implantów
umożliwiający dokładne zamocowanie trzpienia protezy, przy pomocy
cementu lub bez niego. Główkę protezy umieszcza się na trzpieniu. Obie
części protezy są następnie łączone ze sobą w celu zbudowania stawu,
tj. rdzeń z zamocowaną do niego główką scalany jest z panewką (rys.3).
Mięśnie zostają zszyte, a rana zamknięta. W stawie umieszcza się dreny
odprowadzające krew, gromadzącą się nad stawem biodrowym [1].
Wymiana stawu naturalnego na sztuczny powoduje likwidację powstałych
zmian patologicznych, skutkiem czego jest wyeliminowanie bólu oraz
odtworzenie naturalnych funkcji biodra.
Rysunek 3. Schemat przebiegu operacji wymiany stawu biodrowego:(1) usunięcie głowy kości
udowej, (2) mocowanie protezy panewki, opracowanie jamy szpikowej, (3) zamocowanie
trzpienia, (4) łączenie komponentów w funkcjonalny przegub [1]
5. Materiały implantacyjne
Materiały implantacyjne stanowią specyficzną grupę materiałów. Ich
cechą charakterystyczną jest kompatybilność i możliwość współpracy
z żywą tkanką. Definicją, która najtrafniej opisuje pojęcie biomateriału, jest
ta, podana na Konferencji Biomateriałów przez National Institute of Health.
Przedstawia ona biomateriał jako „ każdą inną niż lek substancję albo
kombinację substancji syntetycznych lub naturalnych, która może być użyta
w dowolnym okresie, w całości lub części, a której zadaniem jest uzupeł-
297
Żaneta Anna Mierzejewska
nienie lub zastąpienie tkanek narządu albo jego części lub spełnianie ich
funkcji” [9].
Biomateriały różnią się składem, budową i właściwościami. Ze względu
na ich zachowanie w kontakcie z tkankami, biomateriały dzieli się na trzy
grupy [10]. Pierwszą grupę stanowią materiały obojętne lub prawie obojętne
– neutralne. Są to substancje, które nie wywołują żadnej znaczącej reakcji
w otaczających je tkankach. Kolejną grupą są materiały aktywne, które
integrują się z tkanką okołowszczepową, stymulują do rozwoju oraz
pobudzają jej regenerację. Trzecią grupę stanowią materiały biodegradowalne, które po ściśle określonym czasie działania zostają rozłożone oraz
wchłonięte przez otaczające je tkanki, nie powodując przy tym żadnych
uszkodzeń i zmian patologicznych.
Biomateriał pracuje w zmiennym stanie naprężeń i przemieszczeń oraz w
środowisku reaktywnym. Stosowany jako wszczep, bez względu na
przewidziane dla niego funkcje, musi spełniać szereg wymagań. Biomateriały
o optymalnej biotolerancji nie powodują ostrych lub chronicznych reakcji
organizmu. Oznacza to harmonijną interakcję pomiędzy implantem i tkanką.
Ich zastosowanie poprzedzane jest wieloletnimi testami biozgodności
tkankowej i jeśli wyniki badań są zadowalające, wtedy materiały takie mogą
zostać dopuszczone do zastosowania na implanty [11].
Wymagania stawiane biomateriałom stosowanym w chirurgii kostnej są
wyjątkowo wysokie. Dotyczy to szczególnie materiałów używanych do
produkcji endoprotez stawów, które w trakcie eksploatacji poddawane są
bardzo dużym obciążeniom, zarówno statycznym jak i dynamicznym. Średnie
obciążenia stawu biodrowego u dorosłego człowieka podczas spoczynku
osiągają wartość równą około trzykrotnej jego masie, natomiast w trakcie
biegu wartość ta wzrasta nawet dziesięciokrotnie w stosunku do masy ciała [4].
Twórcą pierwszej endoprotezy stawu biodrowego był Amerykanin, prof. J.
Charnley. Implant zaprojektowano i wykonano w połowie XIX w. i od tamtej
pory jego konstrukcja nie uległa znaczącym zmianom [12]. Na podstawie
doświadczeń i badań klinicznych gromadzonych na przestrzeni wielu lat,
a także na podstawie badań z zakresu biomechaniki oraz biotolerancji,
udoskonalano również skład chemiczny i struktury stopów, które następnie
posłużyły do wytworzenia implantów.
6. Procesy niszczenia materiałów
Poprawnie działający układ immunologiczny bardzo szybko wykryje
w organizmie ciało obce, jakim jest implant. Naturalnym odruchem obronnym
jest reakcja toksykologiczna i immunologiczna. Produkowane są antyciała,
które mają silnie utleniające właściwości. Ich zadaniem jest unieszkodliwienie i „pozbycie się” ciała obcego. Antyciała w postaci limfocytów
298
Wieloaspektowa analiza problematyki związanej z mechanizmami niszczenia implantów
i granulocytów otaczają implant, absorbują do wszczepu i powodują jego
degenerację [1].
Najczęściej występującym problemem, związanym z wykorzystaniem
na implant materiału metalicznego jest korozja. Spowodowane jest to silnie
degradacyjnym i reaktywnym środowiskiem płynów ustrojowych oraz
stałą, wysoką temperaturą i silnie obniżonym pH, które bardzo sprzyjają
rozwojowi korozji. Z klinicznego punktu widzenia pojawienie się korozji
w organizmie może znacznie ograniczyć zdolność do długotrwałej pracy
implantu. Możliwe jest wystąpienie odczynów zapalnych, które ściśle
związane są z uwalnianiem do tkanek okołowszczepowych produktów
zużycia. Stan zapalny równoznaczny jest z pojawieniem się bólu, a jego
długotrwałe utrzymywanie się jest czynnikiem decydującym o usunięciu
wszczepu z ciała [1].
Poprawnie działający układ immunologiczny bardzo szybko wykryje w
organizmie ciało obce, jakim jest implant. Naturalnym odruchem
obronnym jest reakcja toksykologiczna i immunologiczna. Produkowane są
antyciała, które mają silnie utleniające właściwości. Ich zadaniem jest
unieszkodliwienie i „pozbycie się” ciała obcego. Antyciała w postaci
limfocytów i granulocytów otaczają implant, absorbują do wszczepu
i powodują jego degenerację [1].
Najczęściej występującym problemem, związanym z wykorzystaniem
na implant materiału metalicznego jest korozja. Spowodowane jest to silnie
degradacyjnym i reaktywnym środowiskiem płynów ustrojowych oraz
stałą, wysoką temperaturą i silnie obniżonym pH, które bardzo sprzyjają
rozwojowi korozji. Z klinicznego punktu widzenia pojawienie się korozji
w organizmie może znacznie ograniczyć zdolność do długotrwałej pracy
implantu. Możliwe jest wystąpienie odczynów zapalnych, które ściśle
związane są z uwalnianiem do tkanek okołowszczepowych produktów
zużycia. Stan zapalny równoznaczny jest z pojawieniem się bólu, a jego
długotrwałe utrzymywanie się jest czynnikiem decydującym o usunięciu
wszczepu z ciała [1].
6.1. Rodzaje korozji
Ze względu na rodzaje środowiska korozyjnego wyróżnia się dwa jej
typy: chemiczną i elektrochemiczną [13]. W korozji chemicznej istotą
procesu są jednoczesne reakcje utleniania metalu i redukcji utleniacza,
będącego składnikiem środowiska. Z kolei korozja elektrochemiczna
zachodzi w środowisku elektrolitycznym, w którym tworzą się ogniwa
korozyjne. Schemat obrazujący poszczególne typy zniszczeń korozyjnych
przedstawiono na rysunku 4.1., zamieszczonym na końcu podrozdziału.
299
Żaneta Anna Mierzejewska
6.1.1. Korozja ogólna (general corrosion)
Jest to korozja stosunkowo najmniej groźna, gdyż polega na równomiernym zaatakowaniu całej powierzchni stali nierdzewnej. W wyniku tego
grubość wyrobu stalowego zmniejsza się równomiernie, z jednoczesnym
zmniejszeniem się ogólnej wytrzymałości korodowanego elementu.
Szybkość ubytku grubości nie powinna jednak przekraczać pewnej
praktycznie ustalonej granicy. Dla stali odpornych na korozję jako
dopuszczalny przyjmuje się – dla większości zastosowań – średni roczny
ubytek grubości nie przekraczający 0,1 mm (wyznacza się wg PN-78/H04610). Zapobieganie skutkom korozji równomiernej (przez ograniczenie
jej szybkości) polega na: wymianie stali na stal o lepszej odporności na
korozję, zmianie środowiska korozyjnego (zmiana stężenia, temperatury,
prędkości przepływu cieczy, dodanie inhibitora itd.), okresowym
pasywowaniu powierzchni stali [14].
6.1.2. Korozja wżerowa (pitting)
Korozja wżerowa charakteryzuje się punktowym ubytkiem masy stali.
Przebieg procesu tego rodzaju korozji związany jest z działaniem lokalnego
ogniwa. Pitting stali odpornych na korozję występuje najczęściej
w środowiskach wodnych, zawierających jony chloru, bromu, jodu, przy
czym jej intensywność zależy głównie od stężenia tych jonów i temperatury.
Pojawia się przeważnie na wszelkiego rodzaju niejednorodnościach
wewnętrznych metalu (wtrącenia niemetaliczne, wydzielenia, odkształcenia)
i zewnętrznych (krawędzie, zarysowania, wgniecenia, resztki zgorzeliny) [15].
6.1.3. Korozja szczelinowa (cervice corrosion)
Ten typ korozji pojawia się w szczelinach i zagłębieniach konstrukcyjnych. Korozja szczelinowa powstaje w wyniku stopniowego zanikania
warstewki pasywnej w szczelinach, w których na skutek utrudnionego
napowietrzenia i zahamowanego dopływu tlenu, warstewka ta nie może się
zregenerować [14]. Wystąpienie korozji szczelinowej prowadzi zazwyczaj
do propagacji pęknięcia i w efekcie uszkodzenia wszczepu. Zapobieganie
temu typowi degradacji materiału polega głównie na właściwym doborze
cech konstrukcyjnych wykonywanych elementów [15].
6.1.4. Korozja galwaniczna – stykowa (galvanic corrosion)
Korozja ta jest wywołana stykiem dwóch metali lub stopów o różnych
potencjałach, zanurzonych w elektrolicie, w którym możliwy jest przepływ
elektronów. Skuteczność działania ogniwa zwiększa się ze wzrostem
różnicy potencjałów stykających się ze sobą dwóch metali w środowisku
300
Wieloaspektowa analiza problematyki związanej z mechanizmami niszczenia implantów
korozyjnym, np. zawierającym jony chlorkowe. Do korozji galwanicznej
dochodzi również w stopach dwufazowych, w których jedna z faz jest
szlachetniejsza od drugiej. Wytrącenia niemetaliczne w stopach jednofazowych również mogą być czynnikiem powodującym pojawienie się
korozji stykowej. Odporność na korozję stopu jednofazowego o zbliżonym
składzie jest zazwyczaj większa, niż stopu dwufazowego. Do powodów
występowania tego zjawiska zalicza się: różnice w pH, odmienny stopień
chropowatości powierzchni stykowych oraz utwardzenie materiału drogą
wielokrotnego zgniatania [16].
6.1.5. Korozja międzykrystaliczna (intergranular corrosion)
Typ korozji występującej na granicach ziaren. Powstaje w wyniku
istnienia w stopie obszarów o zróżnicowanym składzie chemicznym.
Zróżnicowanie zawartości chromu na granicy ziarna i w jego wnętrzu
prowadzi do wystąpienia korozji międzykrystalicznej. Powstawanie korozji
inicjowane jest wzrostem zawartości węgla oraz spadkiem zawartości
chromu w stali. Stal austenityczna w stanie przesyconym poddawana jest
wygrzewaniu w temperaturze powyżej 500oC, co powoduje powstawanie
węglików (FeCr)23C6 na granicach ziarn, a tym samym zubożenie granic
w chrom. Zjawiska te powodują lokalnie zawartość w materiale
metalicznym pierwiastków stopowych, zwłaszcza chrom oraz tworzenie
mikroogniw korozyjnych, w których katodę stanowi węglik, natomiast
anodę – otaczający metal. Dodatkowo pojawienie się naprężeń w miejscach
tworzenia się nowych faz może niszczyć warstwę pasywną [16].
6.1.6. Korozja cierna (fretting)
Istotą tego procesu jest powstawanie miejscowych ubytków materiału w
elementach, które poddawane są działaniu drgań, niewielkich poślizgów,
ich przemieszczania się pod wpływem cyklicznych obciążeń oraz
intensywnego korozyjnego oddziaływania środowiska [14]. Występowanie
frettingu może znacząco obniżyć wytrzymałość zmęczeniową materiału, co
jest szczególnie niebezpieczne w przypadku zastosowania implantacyjnego.
Z frettingiem wiąże się emisja znacznej ilości produktów korozji do tkanek
otaczających wszczep [13]. Może to być indykatorem do powstania
pęknięć na powierzchni wszczepu, a w konsekwencji prowadzić do jego
uszkodzenia.
6.1.7. Korozja naprężeniowa (stress corrosion)
Korozja naprężeniowa pojawia się tylko wtedy, gdy stal podatna na ten
typ korozji, poddawana naprężeniom wewnętrznym lub zewnętrznym, jest
narażona na działanie środowisk korozyjnie agresywnych, które wywołują
301
Żaneta Anna Mierzejewska
ten typ korozji. Im większe są te naprężenia i im bardziej agresywne
środowisko otaczające implant, tym szybciej dojdzie do zużycia produktu.
Pękanie naprężeniowe wywołane jest głównie naprężeniami w makroskali,
występującymi w całej objętości materiału. Naprężenia zginające, rozciągające i ściskające wpływają na obniżenie odporności materiału na korozję
w wyniku obniżania stabilności termodynamicznej metalu i naruszenia
ciągłości warstwy pasywnej, jednak nie powodują one zlokalizowanych
pęknięć materiału. Pęknięcia wynikające z korozji naprężeniowej rozwijają
się po granicach ziaren oraz śródkrystalicznie [17].
6.1.8. Korozja wodorowa (hydrogen damage)
Pod wpływem naprężeń występujących w materiale tworzy się
płaszczyzna poślizgu. Wynikiem poślizgu jest depasywacja powierzchni,
prowadząca do reakcji anodowych, które są przyczyną powstawania
wakansu i w efekcie absorpcji atomów wodoru. Na powierzchni powstałego pęknięcia obserwuje się dwa obszary: zmiękczony i utwardzony.
Współpraca tych dwóch obszarów prowadzi do lokalnego wzrostu naprężeń.
Zaabsorbowany wodór powoduje spadek energii kohezji pomiędzy
płaszczyznami. Zmniejszenie tej energii oraz lokalne spiętrzenie naprężeń
prowadzi do łatwej propagacji pęknięcia [17].
6.2. Pękanie materiału (corrosion fatigue)
Wśród najistotniejszych czynników powodujących przedwczesne
zniszczenie materiałów wymienić należy: nieprawidłowo zrealizowaną
obróbkę cieplną, ukryte wady materiałowe, nieodpowiednią konstrukcję
implantu, niedopasowaną do warunków obciążeń, nieprawidłowe zamocowanie lub eksploatację. Możemy wyróżnić trzy rodzaje pękania materiałów: doraźne, będące wynikiem utraty spójności, zmęczeniowe oraz
będące następstwem działania na materiał wysokiej temperatury i znacznych obciążeń – pełzanie.
Oprócz powyższego podziału rodzaje pęknięć materiału można sklasyfikować jako: ciągliwe, kruche oraz będące wynikiem utraty spójności.
Pękanie ciągliwe, inaczej rozdzielcze powstaje wtedy, kiedy na materiał
działają obciążenia wywołujące nagłe przeciążenia plastyczne [18].
Na silnie rozwiniętej powierzchni przełomu widoczne są pustki
wypełnione wydzieleniami lub zanieczyszczeniami w postaci sferycznych
cząstek. Jeżeli większość cząstek, na których tworzą się pustki znajduje się
na granicach ziarn, to pękanie zachodzi po granicach ziarn i jest nazywane
międzykrystalicznym, jeżeli natomiast rozmieszczenie cząstek jest
względnie równomierne, to pękanie zachodzi przez ziarna i jest nazywane
transkrystalicznym. Kruche cząstki innej fazy w ciągliwej osnowie nie są
302
Wieloaspektowa analiza problematyki związanej z mechanizmami niszczenia implantów
w stanie zaakomodować dużych odkształceń plastycznych osnowy. Dlatego
nawet niewielkie odkształcenia plastyczne osnowy, będące wynikiem
dyslokacji oraz sił zewnętrznych osiąga wartość wystarczającą do
spowodowania pękania cząstek. Podczas pękania ciągliwego wytrzymałość
na rozciąganie jest mniejsza niż naprężenia konieczne do
rozprzestrzeniania się pęknięcia, dlatego próbka odkształca się najpierw
równomiernie, a następnie tworzy się szyjka. Dalsze odkształcenie oraz
łączenie się pustek jest ograniczone do obszaru szyjki. Końcowe
rozdzielenie materiału uzyskuje się przez ścięcie lub niekiedy przez
przewężenie się pierścienia otaczającego pęknięcie [18].
Pękanie zmęczeniowe materiału jest procesem pokrewnym do korozji
naprężeniowej. Występuje, gdy materiał jest pod wpływem cyklicznych lub
zmiennych naprężeń, które nie przekraczają granicy plastyczności materiału.
Oddziaływanie tych naprężeń powoduje naruszenie powierzchniowej warstwy
pasywnej i odsłonięcie metalu [Ratajczak, 2005]. W przeciwieństwie do
korozji naprężeniowej, korozja zmęczeniowa w stali austenitycznej może
pojawić się w dowolnym środowisku, począwszy od pary wodnej, poprzez
wodę, do roztworów chemicznych. Tworzące się wżery i szczeliny mogą
stać się zarodkami pęknięć. Wskutek dalszego działania naprężeń
rozciągających oraz środowiska korozyjnego dochodzi do propagacji
pęknięć śródkrystalicznych oraz po granicach ziaren, mających charakter
pękania kruchego.
Zasadniczy wpływ na odporność na ten typ niszczenia materiału
metalicznego mają: wytrzymałość materiału na rozciąganie, wielkość
ziaren oraz obecność składników stopowych, których zadaniem jest
polepszenie pasywności stali. Podstawową rolę zmian w mikrostrukturze
przypisuje się naprężeniom będącym skutkiem odkształceń sprężystych
sieci krystalicznej na skutek wzrostu gęstości dyslokacji. W początkowej
fazie występują lokalne odkształcenia plastyczne, których oznaką są pasma
poślizgów. W obszarach, w których na skutek poślizgu gęstość dyslokacji
przekroczy wartość krytyczną, pojawiają się mikropęknięcia. Również
zmiany naprężeń, prowadzące do zmiany plastyczności materiału i jego
lokalnego utwardzenia, mogą stać się przyczyną wystąpienia mikropęknięć.
Przy dalszym cyklicznym obciążeniu zwiększa się powierzchni pęknięcia,
co prowadzi do lokalnego zniszczenia [19].
Pękanie zmęczeniowe materiału przebiega w trzech etapach. Pierwszym
etapem jest tworzenie się zarodka, a więc inicjacja powstania ogniska
zmęczeniowego. Następnie dochodzi do propagacji pęknięcia i tworzenia
się prążków zmęczeniowych, a ostatnim etapem jest pękanie doraźne
z typowym złomem ciągliwym.
Wygląd przełomu zależy od rodzaju i wielkości obciążeń zmęczeniowych, jakie spowodowały zniszczenie. Dzięki tej zależności można
303
Żaneta Anna Mierzejewska
odtworzyć charakter obciążeń oraz ustalić położenie ogniska pęknięcia. Dla
większości metali można wyróżnić dwie odmienne strefy, które odpowiadają dwóm następującym po sobie etapom niszczenia materiału: strefę
zniszczenia zmęczeniowego oraz strefę zniszczenia doraźnego (rys. 4)
[20‚21].
Rysunek 4. Charakterystyczny przełom zmęczeniowy [19]
Strefa zniszczenia zmęczeniowego ma wygładzoną powierzchnię, często o
kształtach muszlowych, z widocznymi niekiedy liniami frontu, świadczącymi
o nierównomiernym, skokowym pogłębianiu się szczeliny. Im mniejsza jest ta
strefa, w porównaniu ze strefą pęknięcia doraźnego, tym większa jest wartość
naprężenia zmęczeniowego. Duże pole powierzchni strefy pęknięcia
zmęczeniowego świadczy o działaniu małych naprężeń i małych prędkościach
rozprzestrzeniania się pęknięcia. Natomiast strefa zniszczenia doraźnego (tzw.
strefa resztkowa lub doraźna) ma powierzchnię wizualnie bardziej
gruboziarnistą i powstaje nagle w ostatnim okresie pracy elementu. W okolicy
przełomu brak jest widocznych odkształceń plastycznych, a więc ma on
charakter przełomu kruchego [18‚20].
Ostatni typ zniszczenia materiału dotyczy utraty spójności Charakterystyczne jest tutaj nieznaczne lub w ogóle nie występujące odkształcenie
plastyczne. Pęknięcie przebiega jedynie wzdłuż granic ziarn. Powodem
zaistnienia utraty spójności jest osłabienie wytrzymałości granic ziarn spowodowane obecnością zanieczyszczeń, wtrąceń i segregacją pierwiastków [19].
7. Podsumowanie
Implanty stosowane w chirurgii kostnej powinny wykazywać dużą
trwałość w środowisku biologicznym, co w praktyce nie zawsze jest
spełnione. Przyczyną niepowodzenia może być zarówno źle zaplanowana
i zrealizowana procedura wszczepienia implantu, jak też aspekty bio-
304
Wieloaspektowa analiza problematyki związanej z mechanizmami niszczenia implantów
mechaniczne: wady materiałowe, brak biozgodności pomiędzy implantem
i strukturą kości, niewłaściwe dobranie charakterystyki odkształceniowe
implantu i kości, a także niewłaściwe zaprojektowanie części składowych
w przypadku endoprotez. Ponadto implanty stosowane w leczeniu operacyjnym powinny być uniwersalne, posiadać różne możliwości korekcyjne
i wykazywać jak najmniejszy zakres obróbki mechanicznej podczas
zabiegu. Dlatego do uzyskania nowych w pełni funkcjonalnych biomateriałów i technologii dla medycyny, konieczna staje się zastosowanie
nowoczesnego oprogramowania inżynierskiego, opartego na metodzie
elementów skończonych (MES), które wprowadziło ogromny postęp w
zakresie modelowania układów biologicznych [22]. Takie badania są
ukierunkowane głównie na optymalizację konstrukcji implantów, ale też
zastosowanie nowych materiałów.
Decydujący wpływ na długotrwałą bifunkcyjność sztucznego stawu
biodrowego ma relacja sztywności trzpienia endoprotezy do sztywności
kości. Prowadzonych jest wiele prac z zastosowaniem obliczeń
numerycznych, których celem jest dopasowanie sztywności implantu do
sztywności otaczającej go struktury kostnej poprzez optymalizację kształtu
endoprotezy i odpowiednie rozwiązania materiałowe. W tym celu buduje
się specjalne trójwymiarowe modele układu kość – endoproteza i prowadza
się obliczenia przy zastosowaniu różnych parametrów wytrzymałościowych. Na podstawie przeprowadzonych badań stwierdzono, że
głównym czynnikiem wpływającym na procesy adaptacyjne zachodzące
w kości i długotrwałe zamocowanie implantu endoprotezy stawu
biodrowego, główny wpływ wywiera konstrukcja endoprotezy [3].
Praca zrealizowana przy wsparciu finansowym Wydziału Mechanicznego Politechniki Białostockiej w ramach projektu „Rozwój młodych
naukowców i uczestników studiów doktoranckich‖ nr MB/WM/14/2014.
Literatura
1.
2.
3.
4.
5.
6.
Ackrermann K., Implantologia, Urban&Partner, (2004), s. 15-29
Korzyński M, Cwanek J., Procesy zużycia w stawie biodrowym, Zbiór prac
seminarium naukowego Mechanika w Medycynie 1, (1993), s. 15-18
Buśkiewicz J., Podstawy konstrukcji w protetyce, Akademicka Oficyna
Wydawnicza, AGH, (2008), s. 14-21
Bernakiewicz M., Będziński R., Analiza stanu naprężeń kości udowej
w ekstremalnych warunkach obciążeń, Zeszyty Nukowe Konferencji
Mechaniki Stosowanej, (1999), s. 33-38
Będziński R., Ścigała K., Biomechanika stawu biodrowego i kolanowego.
Tom 5 Biocybernetyka i inżynieria rehabilitacyjna, Akademicka Oficyna
Wydawnicza Exit, (2004), s. 34-54
Maquet P. G. J., Biomechanics of the hip, (1985), s. 16-18
305
Żaneta Anna Mierzejewska
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
Kapandji A., Physiology of the Joints: Lower Limb v. 2: Annotated Diagrams
of the Mechanics of the Human Joints, Lincoln, LIN, (1997), s. 111-124
Przeździak B., Zastosowanie kliniczne protez, ortoz i środków pomocniczych,
Via Medica, vol.40, (2008), s.17-24
Gierzyńska- Dolna M., Biotribologia, Wydawnictwo Politechniki
Częstochowskiej, (2002), s.32-32
Żurek- Świeczko B., Biomateriały, Wydawnictwo Politechniki Gdańskiej,
(2009), s. 1-14
Nowacki L., Gustavo F., Biomateriały w konstrukcji implantów, Open Access
Library vol. 11, (2012), s. 13-42
Brooks S., Fracture of fully hydroxyapatite-coated titanium femoral stem
of a total hip replacement – a report of 3 cases, Acta Orthop Scand;
75 no. 6, (2004), s. 768-771
Costa I., Terada M., Microstructure and intergranular corrosion of the
austenitic stainless steel, Journal of Nuclear Materials, (2006), s. 40-46
Surowska B., Wybrane zagadnienia z korozji i ochrony przed korozją,
Politechnika Lubelska, (2002), s. 20-32
Blicharski M., Wstęp do inżynierii materiałowej, Wydawnictwa NaukowoTechniczne, (2009), s. 428-446
House K., Sernetz F., Dymock D., Sandy J. R., Ireland A. J., Corrosion
of orthodontic appliances, American Journal of Orthodontics & Dentofacial
Orthopedics, (2008), s. 584-595
Upadhyay D., Panchal M. A., Dubey R. S., Srivastava V. K., Corrosion
of alloys used in dentistry: A review, Materials Science & Engineering, (2008),
s. 1-15
Kowalewski L., Zmęczenie materiałów – podstawy, kierunki badań, ocena
stanu uszkodzenia, Siedemnaste seminarium Nieniszczące Badania
Materiałów, (2011)
Ratajczak J., Badanie metali na zmęczenie, Politechnika Szczecińska, (2005),
s.12-15
Prowans S., Metaloznawstwo, WNT, (1992), s. 34-45
Przybyłowicz K., Metaloznawstwo, WNT, (1997), s. 100-156
Madej T., Modelowanie strefy ruchowej endoprotezy stawu biodrowego
w aspekcie biomateriałów, AGH, (2008), s. 29-43
306
Wieloaspektowa analiza problematyki związanej z mechanizmami niszczenia implantów
Wieloaspektowa analiza problematyki związanej z mechanizmami
niszczenia implantów
Przyczyn szybkiego zużywania się stawów, zarówno naturalnych, jak i sztucznych, jest kilka,
m.in. aktywny tryb życia, wzrost liczby urazów, w tym wypadków komunikacyjnych i kontuzji
przy uprawianiu sportu, często również nadwaga. Średnia wieku pacjentów poddawanych
operacji endoprotezoplastyki stawu biodrowego z każdym rokiem spada, natomiast liczba
wykonanych operacji systematycznie rośnie. Lekarze ostrzegają przed przeprowadzania
endoprotezoplastyki u młodych ludzi przez wzgląd na ograniczoną trwałość protez, niestety
– coraz częściej zdarza się, że po kilkunastu latach od operacji stan endoprotezy wymaga jej
reimplantacji. W efekcie obok kolejki osób oczekujących na protezoplastykę pierwotną, tworzy
się druga kolejka czekających na realloplastykę. Mimo to, chorzy bardzo często decydują się na
wymianę stawu, bowiem taki zabieg oznacza dla nich powrót do życia pozbawionego
dolegliwości bólowych. Powszechnie stosowane do wytwarzania implantów materiały
metaliczne, pomimo wielu zalet, posiadają szereg niekorzystnych cech. Metale o bardzo dobrych
właściwościach mechanicznych są zbyt sztywne w stosunku do kości, jak również ulegają korozji
w agresywnym środowisku biologicznym. Działanie na implanty naprężeń mechanicznych
i obecność płynów ustrojowych, może przyspieszać ich degradację, zmniejszyć stabilność
i trwałość. Jednym z najczęściej stosowanych biomateriałów metalicznych jest stal
X2CrNiMo17-12-2 (316 L). Implanty wykonywane z tej stali zaliczane są do grupy wszczepów
krótkotrwałych. Powinno to wykluczyć stosowanie stali 316 L na endoprotezy stawu
biodrowego, które z założenia są wszczepami długookresowymi, jednak częstość stosowania
implantów wykonanych z tej stali nie maleje, mimo obecności na rynku trwalszych materiałów.
The multifaceted analysis of issues related to the mechanisms
of implants destruction
There are several reasons for the rapid wear of the joints, both natural and man-made, including
active lifestyle, increase in the number of injuries, traffic accidents and injuries during sport, often
overweight. The average age of patients undergoing hip replacement surgery each year is falling,
while the number of operations is steadily growing. Doctors warn against carrying arthroplasty in
young people for the sake of the limited durability of prostheses, unfortunately – more often it
happens that after several years of transactions, the prosthesis requires its reimplantation. As
a result, next to the queue of people waiting for THR primary forms a second queue waiting for
realloplasty. Despite this, patients often decide to exchange the pond, because such treatment is
for them to return to a life without pain. Commonly used implant materials for the production of
metal, in spite of many advantages, have a number of disadvantages. Metals with very good
mechanical properties are too stiff relative to the bone, as well as corrode in an aggressive
biological environment. The effect on implants mechanical stress and the presence of body fluids,
may accelerate their degradation, reduce stability and durability. One of the most common
biomaterials metal is stainless X2CrNiMo17-12-2 (316 L). Implants made of this steel are among
the short-term implants. This should exclude the use of stainless 316 L hip replacement, which by
definition are long-term implants, but the frequency of the use of implants made from this steel is
not decreasing, despite the presence of more durable materials on the market.
307
Żaneta Anna Mierzejewska1
Przyczyny mechanicznego niszczenia implantów
wytwarzanych tradycyjnymi technologiami
1. Wstęp
Połączenia stawowe przyrównuje się do łożysk ślizgowych. Mechanizmy zużycia, zarówno w naturalnym stawie jak i w łożysku mechanicznym, są podobne. Wyróżniamy [1‚2]:
 zużycie adhezyjne, występujące w miejscach najbardziej obciążonych
oraz na wierzchołkach nierówności chrząstki stawowej;
 zużycie ścierne, będące skutkiem oddziaływania fragmentów chrząstki
stawowej oderwanych od podłoża, znajdujących się w mazi stawowej;
 zużycia zmęczeniowe – pod wpływem zmiennych obciążeń ciecz
synowialna wtłaczana jest do mikroszczelin, skutkiem czego jest
rozklinowanie naturalnych, bądź pourazowych mikroszczelin
występujących w chrząstce stawowej;
 zużycie przez zwłóknienie chrząstki stawowej, opisywane jest jako
proces, w którym w mazi stawowej pojawiają się cienkie włókna.
Jeśli w naturalnym stawie biodrowym dochodzi do procesów chorobowych, to degradacja chrząstki stawowej przebiega intensywniej. Organizm nie ma czasu, aby naprawić uszkodzone tkanki. Przyjmuje się, że
w zdrowym stawie biodrowym współczynnik tarcia jest rzędu 0,0025-0,0030,
natomiast grubość warstwy smarującej jest rzędu 50*10-6 m [3]. W przypadku stawu, w którym przebiegi procesów zużycia są zaawansowane,
współczynnik tarcia jest dziesięciokrotnie większy, grubość warstwy
smarującej znacząco maleje, a nawet zanika [4].
Jako jedną z przyczyn niepowodzeń alloplastyki stawu biodrowego
wymienia się zużycie ścierne elementów endoprotez, w wyniku którego do
organizmu człowieka dostają się drobiny polietylenu i metali [3]. Produkty
tarcia znajdujące się w strefie kontaktu metalu z polietylenem mogą
wywoływać zwiększone zużycie ślizgowych elementów endoprotezy
i powodować wzrost ilości produktów ścierania. Proces zużycia endoprotezy przebiega tym intensywniej, im większe jest obciążenie, działające
na sztuczny staw biodrowy (ciężar i aktywność ruchowa pacjenta).
1
[email protected], Katedra Inżynierii Materiałowej i Biomedycznej,
Wydział Mechaniczny, Politechnika Białostocka
308
Przyczyny mechanicznego niszczenia implantów wytwarzanych tradycyjnymi technologiami
Z czasem, w skrajnych przypadkach, nadmierne zużycie może doprowadzić
do ponownej dysfunkcji i konieczności reimplantacji [1‚4].
Drobiny polietylenu i metali uwalniające się w wyniku ścierania
przedostają się z płynem tkankowym do przestrzeni okołostawowej,
zaburzając zachodzące tam procesy biologiczne. Ciągłe drażnienie
okolicznych tkanek przez produkty zużycia wywołuje reakcję obronną ze
strony organizmu, który stara się pozbyć obcego dla niego ciała na drodze
fagocytozy. Wokół produktów zużycia pojawiają się makrofagi i fibroblasty, i dochodzi do uaktywnienia osteoklastów, odpowiedzialnych za
osteolizę tkanki kostnej. W efekcie prowadzi to do resorpcji kości
w otoczeniu endoprotezy i jej obluzowania. W rejonie panewki proces ten
rozpoczyna się od jej krawędzi bocznej i postępuje wzdłuż sklepienia [5].
Mechaniczna stabilność implantu określona jest przez stopień
zaawansowania resorpcji i tworzenia pomiędzy cementem i tkanką kostną
odczynowej błony łącznotkankowej, która z czasem może stanowić
warstwę przejściową. Część produktów zużycia może wędrować z płynem
tkankowym, wywoływać resorpcję kości i doprowadzić do obluzowania
endoprotezy daleko poza miejscem jej uszkodzenia. Pozostała część może
zostać przetransportowana poprzez naczynia limfatyczne do organizmu
człowieka [1, 6].
Dominującą rolę w obluzowaniu trzpieni endoprotez odgrywają
czynniki biomechaniczne. Struktura tkanki kostnej dostosowuje się do
istniejącego stanu naprężeń. W fizjologicznym stawie biodrowym
obciążenia są przenoszone przez miednicę na kość udową. Implantacja
endoprotezy zmienia istniejący stan naprężeń, dochodzi do odciążenia
okolicy krętarza i przenoszenia obciążeń przez tkankę kostną wokół
dalszego odcinka trzpienia [7].
2. Mechanizm zmęczeniowego pękania trzpieni
Cykliczne obciążanie i odciążanie elementu powoduje zmęczenie
materiału. Zmiany naprężeń prowadzą do zmiany plastyczności materiału
oraz do lokalnego utwardzenia, co w konsekwencji może stać się przyczyną
wystąpienia mikropęknięć. Zainicjowanie pęknięcia a następnie jego
rozrost powoduje, że zmniejsza się powierzchnia, która efektywnie
przenosi obciążenia [8].
Alloplastyka, tak jak wszystkie zabiegi i ingerencje chirurgiczne,
obarczona jest pewnym prawdopodobieństwem pojawienia się komplikacji
i powikłań. Jednym z nich jest dość rzadko występujące złamanie
izolowane (bez naruszenia ciągłości tkanki kostnej). Prawdopodobieństwo
wystąpienia złamania izolowanego trzpienia endoprotezy stawu biodrowego wynosi 0,27% [8‚10]. Z dostępnego piśmiennictwa wynika, że
309
Żaneta Anna Mierzejewska
najczęstszym powodem zgłaszania się chorych do ortopedy są dolegliwości
bólowe, zlokalizowane w okolicy biodra i/lub bliższej części uda po stronie
operowanej. Niektórzy chorzy skarżą się na uczucie przeskakiwania
w stawie biodrowym. Większość autorów zgadza się, iż wpływ na
wystąpienie omawianego powikłania ma wiele, często nakładających się na
siebie czynników [10‚11].
Pierwsze doniesienie na temat złamania trzpienia endoprotezy można
spotkać w literaturze specjalistycznej z roku 1977. Carlsson opisał 14
przypadków złamań trzpienia endoprotezy Charnleya. Według niego
czynnikiem prowadzącym do złamania implantu była błędna technika
operacyjna. Murray oraz Yates, na podstawie analizy 14 przypadków
złamania trzpieni endoprotezy stawu biodrowego doszli do podobnych
wniosków, jednak jako nadrzędny czynniki ryzyka wystąpienia powikłania
w postaci złamania trzpienia autorzy wskazali na wysoki wskaźnik masy
ciała pacjenta – BMI (Body Mass Index) oraz błędy techniki operacyjnej.
Harvie i Jarvi, niezależnie od siebie opisali przypadki złamania trzpieni,
w których analiza metalurgiczna wykazała wady odlewnicze i materiałowe
[12]. Większość opisanych przez autorów trzpieni wykonanych było ze
stali austenitycznej. Znamienny jest fakt, że znaczna część z opisanych
trzpieni uległa zniszczeniu w czasie krótszym niż 10 lat od przeprowadzenia endoprotezoplastyki.
3. Kliniczne przypadki złamań trzpienia
Alloplastyka, tak jak wszystkie zabiegi i ingerencje chirurgiczne,
obarczona jest pewnym prawdopodobieństwem pojawienia się komplikacji
i powikłań [13‚16]. Jednym z nich jest złamanie izolowane (bez naruszenia
ciągłości tkanki kostnej). Etiologia złamania jest wieloczynnikowa.
Wyróżnia się trzy kategorie: kliniczną, techniczną i materiałową [17].
W kategorii klinicznej złamanie skorelowane jest z wiekiem, wagą,
wzrostem pacjenta, jakością kośćca i poziomem aktywności fizycznej
[17‚19]. W kategorii technicznej możliwość wystąpienia złamania
trzpienia zależna jest od poprawnego doboru techniki operacyjnej, sposobu
mocowania, jakości i ilości cementu kostnego i innych czynników [17‚19].
Z doniesień literaturowych wynika, że częściej dochodzi do złamań trzpieni
endoprotez mocowanych za pomocą cementu kostnego, w porównaniu do
metody bezcementowej. Zbyt rzadka lub zbyt gęsta konsystencja, zbyt mała
ilość, nieprawidłowe wymieszanie lub nieodpowiednie rozłożenie warstwy
kleju kostnego może skutkować przedwczesnym złamaniem trzpienia. Do
kategorii materiałowej zalicza się konstrukcję, rodzaj i jakość materiał.
Nieodpowiednia konstrukcja trzpienia jest przyczyną niekorzystnego
rozkładu naprężeń, które w konsekwencji mogą prowadzić do nadmiernego
310
Przyczyny mechanicznego niszczenia implantów wytwarzanych tradycyjnymi technologiami
przeciążenia materiału i jego przedwczesnego zniszczenia. Ponadto, wszelkie
nieciągłości i niejednorodność struktury (pod względem fazowym, składu
chemicznego czy wielości ziarn), powodują zdecydowane obniżenie
właściwości wytrzymałościowych stosowanych implantów.
Z informacji podanych przez Amerykańskie Towarzystwo Chirurgów
Biodra i Kolana wynika, że prawdopodobieństwo wystąpienia złamania
izolowanego trzpienia endoprotezy stawu biodrowego wynosi 0,27%
[14‚15, 20]. Jednak z badań przeprowadzonych przez Martensa [13]
wynika, że procentowy wskaźnik złamań izolowanych w całkowitej liczbie
niepowodzeń obserwowanych w alloplastyce stawu biodrowego, jest nawet
o dwa rzędy wielkości większa i wynosi 11%. Złamania tego typu
odnotowano przy implantach wykonanych z różnych materiałów, o różnej
geometrii i różnym sposobie mocowania [13‚15]
Doniesienie dotyczące złamania trzpienia endoprotezy znaleźć możnaw
literaturze specjalistycznej, pochodzącej z roku 1977 [10, 13]. Carlsson
[21] opisał czternaście przypadków złamań trzpienia endoprotezy
Charnleya. Według tego autora, czynnikiem prowadzącym do złamania
implantu była błędna technika operacyjna. Murray [22], na podstawie
analizy czternastu przypadków złamania trzpieni endoprotezy stawu
biodrowego doszedł do podobnych wniosków, jednak jako nadrzędny
czynniki ryzyka wystąpienia powikłania w postaci złamania trzpienia
wskazał na wysoki wskaźnik masy ciała pacjenta – BMI (Body Mass Index)
oraz błędy techniki operacyjnej. Na uwagę zasługuje fakt, że większość
odnotowanych przypadków złamań izolowanych dotyczy trzpieni
wykonanych ze stali austenitycznej. Ponadto, znamienny jest fakt, że 60%
z opisanych trzpieni uległa zniszczeniu w czasie krótszym niż 10 lat od
przeprowadzenia endoprotezoplastyki.
Jednym z przykładów złamania izolowanego jest przypadek opisany
przez A. Kotela, przedstawiający złamania trzpienia endoprotezy stawu
biodrowego typu Wellera (rys.1), zaimplantowanej 22 lata wcześniej
z powodu wystąpienia zaawansowanych zmian zwyrodnieniowych.
Złamanie nastąpiło w połowie długości trzpienia [16].
311
Żaneta Anna Mierzejewska
Rysunek 1. Zdjęcie rentgenowskie obrazujące złamanie, a) zdjęcie rentgenowskie, b) zdjęcie
po ekstrakcji z kości [16]
Kolejne 2 przykłady złamań trzpieni endoprotez opisują Drobniewski
i Synder [10]. Jako pierwszy opisano przypadek 45-cio letniej kobiety
z wrodzoną dysplazją stawów biodrowych, u której w 24 lata po
wszczepieniu endoprotezy Mittlemeiera stwierdzono złamanie trzpienia
w połowie długości endoprotezy. Endoprotezę tego samego typu wszczepiono również 32- letniej kobiecie, która podobnie jak poprzednia
pacjentka, cierpiała na dysplazję stawu biodrowego. 10 lat po zaimplantowaniu endoprotezy u pacjentki stwierdzono złamanie trzpienia w dolnej
jego części, poniżej 2/3 jego długości. W obu przypadkach nie podano
przyczyn uszkodzenia, jednak przeprowadzony wywiad lekarski wykluczył
jako przyczynę złamania uraz zewnętrzny [10].
Ciekawym przypadkiem jest historia 66-letniej kobiety, która zgłosiła
się do szpitala z bólem w stawie biodrowym. Badanie rentgenowskie
ujawniło złamanie trzpienia endoprotezy (DePuy, wykonanego ze stopu
Co-Cr) w połowie jego długości. Jako powód uszkodzenia wskazano
niekorzystny rozkład warstwy cementu kostnego. Nieodpowiednie zamocowanie trzpienia w kanale szpikowym spowodowało mikroruchy, które
przyczyniły się do wykruszania kleju kostnego oraz do powstania pustej
przestrzeni między kością a implantem. Ta pusta przestrzeń spowodowała,
że spotęgowane zostały wartości pionowych obciążeń, działających na
trzpień. Doprowadziło to do tego, że materiał uległ zniszczeniu na skutek
zmęczenia materiału [23].
312
Przyczyny mechanicznego niszczenia implantów wytwarzanych tradycyjnymi technologiami
Brooks (2004) opisał 3 przypadki złamania trzpieni endoprotez pokrytych warstwą hydroksyapatytu. We wszystkich przypadkach pęknięcie
nastąpiło w połowie długości trzpienia. Uzasadnione zostało to przez autora
nieprawidłową geometrią i kształtem endoprotezy (rys.2) Dodatkowo jeden
z trzpieni poddano analizie metalograficznej (rys.3) za pomocą mikroskopu
elektronowego. Analiza ta ujawniła, że uszkodzenie rdzenia spowodowane
było działaniem mechanizmów zmęczeniowych. W miejscu inicjacji autor
artykułu zaobserwował wiele rys, pęknięć i drobnych prążków zmęczeniowych. Powierzchnia przełomu charakteryzowała się niską deformacją
plastyczną materiału, co dodatkowo potwierdza tezę o kruchym złamaniu
zmęczeniowym [15].
Kolejny przypadek złamania izolowanego trzpienia endoprotezy został
opisany przez Prendergasta (2002) z Departamentu Chirurgii Ortopedycznej Akademickiego Szpitala w Rotterdamie. U pacjentki, lat 52,
zdiagnozowano złamanie trzpienia endoprotezy Exter, wprowadzonego do
organizmu zaledwie 3 lata wcześniej [24].
Złamanie trzpienia nastąpiło na wysokości 9 cm od jego dolnego końca.
Do analizy powierzchni przełomu użyto mikroskopu skaningowego. Jako
miejsce inicjacji pęknięcia wyznaczono przednio-boczną krawędź trzonu.
Na taką identyfikację pozwoliły, przede wszystkim, bardzo widoczne
prążki zmęczeniowe, znajdujące się na powierzchni pęknięcia, wskazujące
jednoznacznie na zniszczenie zmęczeniowe powstałe na skutek cyklicznych
naprężeń (rys.4). Brak podparcia w części przednio-bocznej mógł być
czynnikiem przyczyniającym się do wzrostu naprężeń rozciągających.
Rysunek 2. Zdjęcia obrazujące złamanie, a) zdjęcie rentgenowskie, b) zdjęcie po ekstrakcji
z kości [9]
313
Żaneta Anna Mierzejewska
Rysunek 3. Zdjęcia przełomów wykonane przy użyciu wysokiej rozdzielczości SEM,
a) powierzchnia przełomu w centralnej części trzpienia z widocznymi prążkami i szczelinami,
b) powierzchnia na obrzeżach przełomu [9]
Wydłużone ramię momentu siły wywierało nacisk na smukłą część
dystalną protezy. Taki mechanizm pękania trzpieni został opisany w roku
1995 przez Rokkuma – na przykładzie matowych trzpieni typu Exter, przy
czym wykluczono istnienie jakichkolwiek wad materiałowych i produkcyjnych. Połączenie dużego momentu działającego na przekrój o niewielkiej powierzchni może być więc powodem gromadzenia się dużych
obciążeń zmęczeniowych stymulujących pękanie trzpienia [24].
Jak podaje źródło, przez 13 lat obserwacji gładko polerowanych trzpieni
wykonanych ze stali 316L, zniszczeniu w postaci pęknięcia lub złamania
izolowanego, uległo tylko 8 z 426 wszczepionych implantów. W roku 1976
zmieniono geometrię trzpienia oraz jego grubość, a powierzchnię z polerowanej zmieniono na wykończenie matowe. Wskaźnik złamań matowego
trzpienia Exter w roku 1996 wyznaczono na 0,2 %, jednak okazało się, że
trzpienie te w znacznej większości ulegały obluzowaniu w kanale
szpikowym [24].
Wilson w swoim artykule opisał siedem przypadków złamań trzpieni
endoprotez kołnierzowych, z których dwie mocowane były za pomocą
cementu kostnego, pozostałe – na wcisk (rys.5). W przypadku sześciu
z opisywanych trzpieni złamanie miało miejsce na wysokości 1/3
proksymalnej części trzpienia, natomiast złamanie siódmego trzpienia
złamanie nastąpiło 20 mm od kołnierza. Zdaniem autora powodem
pęknięcia trzpieni, w każdym z tych przypadków, były wady konstrukcyjne. Średni czas pomiędzy wszczepieniem implant, a zdiagnozowaniem
złamania wynosił 41 miesięcy [25].
314
Przyczyny mechanicznego niszczenia implantów wytwarzanych tradycyjnymi technologiami
Rysunek 4. Zdjęcie SEM obrazujące przełom przy różnym powiększeniu: a) 400 x i b) 100 x [24]
Carlson, Stenport i Gentz [21] opisali 14 przypadków złamań trzpieni
endoprotez mocowanych za pomocą cementu kostnego po operacjach
endoprotezoplastyki przeprowadzonych w General Hospital w Malmo.
Wszystkie te implanty wykonane były ze stali 316L technologią kucia
i pochodziły z tej samej fabryki. Średni czas pomiędzy wszczepieniem
implantu a zdiagnozowaniem złamania wynosił 40 miesięcy, przy czym
jedno nastąpiło już po 14 miesiącach od wszczepienia endoprotezy.
Rysunek 5. Zdjęcia obrazujące dwa różne miejsca złamania, a) przy kołnierzu, b) w miejscy
zwężenia [25]
Badania radiologiczne wykazały, że złamania nastąpiły w odległości 61100 mm od koniuszka trzpienia. Jako powód złamania trzpieni autorzy
sugerują złe zamocowanie w kanale szpikowym poprzez niedokładne
naniesienie cementu kostnego, co z kolei spowodowało poluzowanie
endoprotezy i wykruszania się kleju kostnego. Skutkiem tego jest znaczący
wzrost naprężeń panujących w trzpieniu, co może prowadzić do korozji,
315
Żaneta Anna Mierzejewska
złamania zmęczeniowego lub do kombinacji tych czynników, co – według
autorów, przy odpowiednio zamocowanej endoprotezie nie powinno się
wydarzyć [21].
Wróblewski w swoim artykule opisuje badanie siedemdziesięciu
trzpieni wykonanych ze stali 316 L. Jako przyczynę pęknięcia trzpieni
wskazuje on na znaczne obciążenia skręcające wynikające z nieodpowiedniej konstrukcji trzpienia. Jako miejsce inicjacji pęknięcia autor
wskazuje na przednio – boczną krawędź trzpienia i popiera swoją teorię
fotografiami przełomów, na których widoczne są prążki zmęczeniowe.
Pęknięcie trzpienia zainicjowane zostało w miejscu największych naprężeń
i rozciągnęło się do góry, do tyłu i przyśrodkowo [18].
W innym artykule ten sam autor dokonuje analizy 120 przypadków
złamań trzpieni Charnley’a wykonanych ze stali 316L [26]. Większość
złamań odnotowano po 11 latach od przeprowadzenia endoprotezoplastyki
na grupie 115 pacjentów. Jedynie w ośmiu przypadkach złamanie nastąpiło
po ok. 2 latach i spowodowane było czynnikami zewnętrznymi, np.
upadkiem pacjenta. Wszystkie endoprotezy mocowane były za pomocą
cementu kostnego i właśnie tutaj autor dopatruje się przyczyn niepowodzeń
implantacji. Dodatkowa analiza wykazała, że wszyscy pacjenci cierpieli na
znaczną nadwagę, co w znacznym stopniu zwiększyło prawdopodobieństwo pęknięcia implantu [26].
Kishida, Sugano i Sakai przeprowadzili na grupie 176 pacjentów 204
operacje endoprotezoplastyki z użyciem porowatych implantów kobaltowo
– chromowo – molibdenowych, mocowanych na wcisk. Jedynie 5 z nich
uległo złamaniu, wszystkie na wysokości 1/3 odległości od wierzchołka
trzpienia. Jedno ze złamań nastąpiło niecały tydzień po operacji, pozostałe
powstały po okresie mniej więcej 5 lat. Autor wymienia kilka powodów,
które mogły spowodować pęknięcie, m.in. wady materiałowe (wskazuje na
obecność porów, ubytków i wtrąceń niemetalicznych), nieodpowiednie
zamocowanie implantu, odbiegającą od normy geometrię kości udowej [27].
Lakstein analizuje 6 przypadków złamań trzpieni endoprotez (Zimmer,
Warsaw, Indiana), które nastąpiły w okresie od 13 do 80 miesięcy po
przeprowadzeniu endoprotezoplastyki. Wszystkie trzpienie były porowate,
mocowane na wcisk. Trzy z nich (rys.6,7) poddane zostały analizie
materiałowej. We wszystkich przypadkach odnotowano boczne i przednie
uszkodzenie ścianki trzpienia, które pod działaniem naprężeń zginających
doprowadziły do pęknięcia trzpienia. Dalsze oględziny powierzchni
złamania ujawniły trzy różne tekstury na powierzchni przełomu. Obszar
A (pękanie zmęczeniowe) zajmuje ok. 40% powierzchni złamania,
charakteryzuje się gładką teksturą o płaskiej orientacji. Obszar C (przełom
resztkowy) ma szorstką fakturę i obejmuje ok. 30% powierzchni złamania.
Obszar B (pękanie doraźne) obejmuje również ok. 30% powierzchni
316
Przyczyny mechanicznego niszczenia implantów wytwarzanych tradycyjnymi technologiami
złamania, a jego charakterystyczną cechą jest chropowata struktura
wewnątrz przełomu i gładka na obrzeżach [28].
Hernandez-Rodrigues i Orteza-Saenz (3) przedstawili w artykule
przykład pacjenta, u którego złamanie trzpienia zdiagnozowano niecałe
5 lat od przeprowadzenia operacji endoprotezoplastyki. W celu ustalenia,
dlaczego doszło do pęknięcia trzpień poddano analizie OM, SEM i EDS.
Autorzy na podstawie wyników badań własnych wywnioskowali, że
powodem pęknięcia była wysoka koncentracja naprężeń na przedniobocznej powierzchni trzpienia. Nieciągłości materiału i wady powierzchni
skumulowane wokół miejsca inicjacji pęknięcia spowodowały, że przekrój
poprzeczny trzpienia nie był w stanie utrzymać wysokich obciążeń, jakie
generowane były przez aktywnego fizycznie pacjenta. Analiza wykazała
również obecność dużych cząstek zanieczyszczeń, przede wszystkim siarki,
ale według autorów zdecydowanie nie był to główny powód pęknięcia
(rys.8,9) [29].
Rysunek 6. Zdjęcie rentgenowskie obrazujące przełom i a) wyszczególnione obszary złamania:
(A) przełom doraźny, (B) przełom zmęczeniowy, (C) przełom resztkowy, b) ognisko [28]
317
Żaneta Anna Mierzejewska
Rysunek 7. Zdjęcia przełomów wykonane przy użyciu wysokiej rozdzielczości SEM obrazujące
przełom zmęczeniowy i ujawniające: a) obszar A, b) miejsce inicjacji i prążki zmęczeniowe,
c) obszar przełomu z wtórnymi pęknięciami, d) dodatkowe pęknięcia poprzeczne, e, f) wgłębienia
wynikające z przeciążenia materiału [28]
Rysunek 8. Zdjęcia przedstawiające: a) złamany trzpień, b) przełom z wyszczególnionym:1
miejscem inicjacji, 2 odkształceniem plastycznym, c) widok z boku obrazujący skręcenie
trzpienia w miejscu pęknięcia [29]
318
Przyczyny mechanicznego niszczenia implantów wytwarzanych tradycyjnymi technologiami
Rysunek 9. Zdjęcie z MO obrazujące: a) obecność wytrąceń siarczków, b) strukturę austenityczną
bez widocznych węglików i fazy ferrytycznej [29]
4. Wnioski
W tabeli 4 zsumowano dane dotyczące liczby złamań trzpieni endoprotez stawu biodrowego otrzymanych z różnych materiałów implantacyjnych oraz czas ich użytkowania. Dane zawarte w tabeli 4 ukazują, że
najwięcej (88,6%) odnotowanych przypadków złamań izolowanych
trzpieni endoprotez dotyczy stali austenitycznej. Stop ten, po przeróbce
plastycznej na zimno, zazwyczaj charakteryzuje się bardzo drobnoziarnistą
mikrostrukturą, która przyczynia się do zwiększenia wytrzymałości na
rozciąganie. Z drugiej strony powoduje zwiększenie twardości i obniżenie
ciągliwości stali, co może wpływać na pogorszenie jej odporności na
pękanie [30].
Według brytyjskiej normy ISO 5832-1:199 stal austenityczna może
zostać wykorzystana do produkcji trzpieni endoprotez stawu biodrowego.
Natomiast zgodnie z polską normą PN-ISO 5832-1 implanty wykonywane
z tej stali austenitycznej zaliczane są do wszczepów krótkotrwałych i nie
powinny być stosowane na elementy endoprotez stawu biodrowego, które
z założenia są wszczepami długookresowymi. Jednak na podstawie
najnowszych danych literaturowych [10, 16, 22, 31‚35] należy stwierdzić,
że częstość stosowania implantów wykonanych z tej stali nie maleje,
pomimo dostępności na rynku innych materiałów. Na pewno, w przypadku
stali istotnym czynnikiem jest jej cena. Chociaż norma ISO dopuszcza stal
austenityczną do produkcji implantów przeznaczonych do długotrwałego
funkcjonowania w organizmie ludzkim, to powstaje pytanie, czy
rzeczywiście i w jakich przypadkach stop ten należy stosować. Być może
istnieje potrzeba ustalenia kryteriów, które powinny być spełnione,
w przypadku stosowania trzpieni wykonanych ze stali austenitycznej.
319
Żaneta Anna Mierzejewska
Tabela 4 Tabela zbiorcza dotycząca różnych przypadków złamań trzpieni endoprotezy
Liczba
złamanych
trzpieni
Czas
użytkowania
[w miesiącach]
108
96
8
Materiał
Mocowanie
Stal austenityczna
Stal austenityczna
Tytan
Tytan
Kobalt
Tytan
Stal austenityczna
Kobalt
Kobalt
Kobalt
Stal austenityczna
Cementowe
Cementowe
Bezcementowe
Bezcementowe
Bezcementowe
Bezcementowe
Cementowe
Bezcementowe
Bezcementowe
Bezcementowe
Cementowe
1
13
1
1
5
3
14
5
2
2
1
Stal austenityczna
Cementowe
1
36
Kobalt
Bezcementowe
5
82
Stal austenityczna
Cementowe
1
264
Tytan
Bezcementowe
6
48
Kobalt
Bezcementowe
3
20
Kobalt
Bezcementowe
4
45
Stal austenityczna
Cementowe
5
163
Stal austenityczna
Cementowe
2
Stal austenityczna
Cementowe
1
48
Stal austenityczna
Cementowe
1
54
Tytan
Bezcementowe
2
Brak danych
Stal austenityczna
Cementowe
69
Brak danych
Stal austenityczna
Cementowe
120
108
Stal austenityczna
Cementowe
14
47
320
36
66
40
80
150
Brak danych
48
Brak danych
Przyczyny mechanicznego niszczenia implantów wytwarzanych tradycyjnymi technologiami
Łącznie złamanych
trzpieni
282
% stal austenityczna
86,2 %
% stopy kobaltu
9,2 %
% stopy tytanu
4,6 %
Trzpienie cementowe
86,2 %
Trzpienie
bezcementowe
13,8 %
Chociaż nie wszystkie opisane w literaturze przypadki złamań poddano
wnikliwej analizie metalograficznej, to badania, w których przeprowadzono
obserwacje przy użyciu SEM ujawniły w zdecydowanej większości
przypadków cechy złamania zmęczeniowego. Inicjacja pęknięcia
zlokalizowana została na przednio-bocznym narożu trzpienia.
Z przedstawionego przeglądu literaturowego wynika również, że
główną przyczyną pękania trzpieni jest nadwaga pacjentów, która zgodnie
z badaniami przeprowadzonymi przez Wróblewskiego, wykazuje liniową
zależność pomiędzy masą ciała, a okresem użytkowania endoprotezy.
Ponieważ, pomimo dynamicznego postępy, jaki jest obserwowany w
endoprotezoplastyce stawu biodrowego, do chwili obecnej nie udało się w
pełni wyeliminować problemów związanych z izolowanym pękaniem
trzpieni endoprotez, należy podjąć dalsze badania zmierzające do
wyjaśnienia tego zjawiska.
Literatura
1.
2.
3.
4.
5.
6.
7.
Korzyński M, Cwanek J., Procesy zużycia w stawie biodrowym, Zbiór prac
seminarium naukowego Mechanika w Medycynie, 1 (1993)
Blicharski M., Wstęp do inżynierii materiałowej, Wydawnictwa NaukowoTechniczne, (2009), s. 428-446
Nowacki, L., Gustavo F., Biomateriały w konstrukcji implantów, Open Access
Library, vol. 11, (2012)
Błaszczyk W., Biomechanika kliniczna. Podręcznik dla studentów medycyny
i fizjoterapii, Wydawnictwo Lekarskie PZWL, (2004)
Ackrermann K., Implantologia, Urban&Partner, (2004)
Będziński R., Ścigała K., Biomechanika stawu biodrowego i kolanowego. Tom
5 Biocybernetyka i inżynieria rehabilitacyjna, Akademicka Oficyna
Wydawnicza Exit, (2004)
Bernakiewicz M., Będziński R., Analiza stanu naprężeń kości udowej
w ekstremalnych warunkach obciążeń, Zeszyty Nukowe Konferencji
Mechaniki Stosowanej, (1999)
321
Żaneta Anna Mierzejewska
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
Kishida Y., Sugano N., Stem fracture of the cementless spongy metal Lubeck
hip prosthesis, The Jurnal of Arthroplasty, (2002)
Brooks S., Fracture of fully hydroxyapatite-coated titanium femoral stem
of a total hip replacement – a report of 3 cases, Acta Orthop Scand (2004),
75 (6), s.768-771
Drobniewski M., Sibiński M., Złamanie trzpienia endoprotezy jaki rzadkie
powikłanie alloplastyki stawu biodrowego – opis dwóch przypadków,
Chirurgia Narządów Ruchu i Ortopedia Polska, (2010), s. 53-56
Hernandez-Rodriguez M., Ortega-Saenz J., Failure analysis of a total hip
prosthesis implanted in active patient, Journal of the Mechanical Behavior of
Biomedical Materials, (2010), s. 619-622
Lakstein D., Eliaz N., Fracture of cementless femoral stem at the mid-stem
junction modular revision hip arthroplasty system, The Journal of Bone &
Joint Surgery, (2011)
Martens M., Aernoudt E., De Meester P., Ducheyne P., Muller J. C., Delangh
R., Kestelijn P,. Factors in the Mechanical Failure of the Femoral Component
in Total Hip Prosthesis, Acta Orthop Scandinavica (1974), 45(5), s. 693-710
Berkenbilt S. I., Hungeford W., Fracture of an Extensively Porous-Coated
Femoral Stem-Case Report, About Joints, (2003) [cited 2013 Jan 21].
Avaliable from: URL:
http://aboutjoints.com/physicianinfo/casereports/case4/Case4.htm
Brooks S., Sharma D. K., Creasey S., Lewis B., Fracture of fully
hydroxyapatite-coated titanium femoral stem of a total hip replacement—a
report of 3 cases, Acta Orthop Scand, (2004),75(6), s. 768-71
Kotela A., Ambroziak P., Deszczyński M. J., Złamanie trzpienia endoprotezy
stawu biodrowego – opis przypadku, Ostry dyżur (2012) tom 5, numer 1-2
Bono J., McCarthy J., Thornhill T., Revision Total Hip Arthroplasty, Springer,
(1999)
Wróblewski B. M., The mechanism of francture of the femoral prosthesis in
total hip replacement, International Orthopaedics Springer, (1979), vol. 3(2),
s. 137-139
Żurek-Świeczko B., Biomateriały, Wydawnictwo Politechniki Gdańskiej,
(2009)
Martens M., Aernoudt E., De Meester P., Ducheyne P., Muller J. C., Delangh
R., Kestelijn P., Factors in the Mechanical Failure of the Femoral Component
in Total Hip Prosthesis, Acta Orthop Scandinavica (1974), 45(5), s.693-710
Carlsson A. S., Gentz C. F., Stenport J., Fracture of the femoral prosthesis in
total hip replacement according to Charnley, Acta Orthop Scand (1977),
48(6), s. 650-655
Murray D. W., Cemented femoral fixation: the North Atlantic divide,
Orthopedics (2011), 34(9), s. 462-463
Rae P. J., Hardinge K., Segmental fracture of the femoral stem of a lowfriction arthroplasty. A case report. J. Arthroplasty, (2011) vol.2, s. 241-243
Prendergast J., Fracture of an Exeter stem 3 years after impaction
allografting— a case report, Acta Orthop Scand (2002), s.111-113
322
Przyczyny mechanicznego niszczenia implantów wytwarzanych tradycyjnymi technologiami
26. Wilson L., Fracture of the femoral stem of the ring TCH hip prosthesis,
British Editorial Society on Bone and Joint Surgery, (1992)
27. Wróblewski B. M., Fractured stem in total hip replacement: A clinical review
of 120 cases, Acta Orthop Scand (1982), s. 279-284
28. Kishida Y., Sugano N., Ohzono K., Sakai T., Nishii T., Yoshikawa H., Stem
Fracture of the Cementless Spongy Metal Lubeck Hip Prosthesis, The Journal
of Arthroplasty, (2002)17:8, s.1021-1027
29. Lakstein D., Eliaz N., Levi O., Backstein D., Kosashvili Y., Safir O., Gross A.
E., Fracture of cementless femoral stem at the mid – stem junction in modular
revision hip arthroplasty system, The Journal of Bone & Joint Surgery (2011)
05;93(1), s. 57-65
30. Hernandez-Rodriguez M., Ortega-Saenz J., Failure analysis of a total hip
prosthesis implanted in active patient, Journal of the Mechanical Behavior of
Biomedical Materials, (2010), s. 619-622
31. Clemens D., Galante J., Rostoker W., The Influence of Grain Size on the
Fatigue Behavior of Annealed 316 LVM Stainless Steel, J Biomed Mater Res
(1979) 13(3), s.437-41
32. Ling S. M. R., Cahrity J., Lee A. J. C., Whitehouse S. L., Timperley A. J., Gie
G. A., The Long-Term Results of the Original Exeter Polished Cemented
Femoral Component – A Follow-up Report, The Journal of Arthroplasty
(2009) 24(4), s.511-527
33. Purbach B., Kay P. R., Siney P. D., Fleming P. A., Wroblewski M.,
The C-Stem in Clinical Practice: Fifteen-Year Follow-Up of a Triple Tapered
Polished Cemented Stem, The Journal of Arthroplasty (2013), vol. 28: 8,
s. 1367-1371
34. Sen R. K., Mootha A. K., Saini R., Kumar V., Segmental Fracture
Of A Cemented Femoral Stem – A Case Report And Review Of Litrature,
The Internet Journal of Orthopedic Surgery (2009); vol.13, no. 1
35. Hailer N. P., Garellick G., Karrholm J., Uncemented and cemented primary
total hip arthroplasty in the Swedish Hip Arthroplasty Register, Acta Orthop
(2010);81(1), s.34-41
36. Scheerlinck T., Druyts P., Casteleyn P. P., The use of primary total hip
arthroplasty in university hospitals of the European Union, Acta Orthop Belg
(2004);70(3), s.231-239
323
Żaneta Anna Mierzejewska
Przyczyny mechanicznego niszczenia implantów wytwarzanych
tradycyjnymi technologiami
Prawidłowo zbudowany i funkcjonujący staw biodrowy umożliwia płynny zakres ruchu w wielu
płaszczyznach. Jakakolwiek zmiana chorobowa w tym układzie może prowadzić do uszkodzenia
stawu, poprzez jego deformację, ból lub utratę funkcji. Endoprotezoplastyka stawu biodrowego
jest zabiegiem mającym na celu wymianę uszkodzonych powierzchni stawowych i zastąpienie
ich elementami sztucznymi. Jednak, jak każda ingerencja chirurgiczna, niesie ze sobą ryzyko
powikłań. Jednym z nich jest złamanie izolowanie trzpienia, polegające na złamaniu implantu
wewnątrz kanału szpikowego, bez uszkodzenia otaczających go tkanek. Artykuł zawiera przegląd
literatury dotyczącej klinicznych przypadków złamań izolowanych trzpieni endoprotez stawu
biodrowego wykonanych ze stali austenitycznej. Pomimo, iż izolowane złamanie trzpienia nie
jest zaliczane do częstych powikłań występujących po implantacji, to brak w literaturze fachowej
przejrzystego opisu przyczyn występowania tego zjawiska oraz danych statystycznych, skłania do
podjęcia tej tematyki.
The causes of mechanical destroying of implants manufactured with
traditional technologies
A properly built and functioning hip joint enables a smooth range of motion in multiple planes.
Any lesion in this system may lead to damage of the pond, through its deformation, pain or loss
of function. Hip replacement is an operation designed to replace damaged articular surfaces and
replacing them with artificial components. However, like any surgical intervention, carries the
risk of complications. One of them is to break the isolated stem consisting in breaking the implant
within the intramedullary canal without damaging surrounding tissues. The article contains
a review of the literature on clinical cases of isolated fractures of the hip endoprosthesis stems
mainly made of austenitic stainless steel. Although isolated fracture of the stem is not included in
the frequent complications occurring after implantation, the lack in the literature a clear
description of the causes of this phenomenon and statistical data tends to take up this subject.
324
Adrian Dubicki1, Żaneta Anna Mierzejewska2
Projekt indywidualnego implantu kości biodrowej
1. Wstęp
Istnieje wiele różnych procedur leczenia dysfunkcji miednicy, zarówno
inwazyjnych jak i nieinwazyjnych. Niektóre ze schorzeń wymagają
zastosowania implantów lub endoprotez, które różnią się konstrukcją,
wykorzystanymi materiałami i wykończeniem powierzchni. Często ich
jedynym wspólnym punktem jest cel zastosowania, którym jest przywrócenie funkcji miednicy. Czasami zaawansowanie i rozległość choroby
czy urazu nie pozwalają na skuteczne zastosowanie standardowych metod
i jedynym wyjściem jest przygotowanie indywidualnego rozwiązania
w postaci implantu [1, 2].
Rola implantów w organizmie oraz fakt, że będą wewnątrz niego
umieszczone, powoduje konieczność postawienia im licznych wymagań [3]. Ze względu na rozległość oraz złożoność zabiegu chirurgicznego,
ważne jest uniknięcie komplikacji oraz maksymalne skrócenie czasu
operacji. Ważnym jej etapem, podczas którego występuje najwięcej
problemów, jest dopasowanie takiego wszczepu. Z tego powodu, w trakcie
przygotowywania spersonalizowanego implantu, należy zwrócić szczególną uwagę na jego dopasowanie, co pozwoli uniknąć komplikacji
i znacząco skróci czas zabiegu jego wszczepienia [1].
2. Cel pracy
W związku z przedstawionymi powyżej problemami, zaproponowane
w pracy rozwiązanie oparte będzie na wykorzystaniu programów
komputerowych, umożliwiających otrzymanie wirtualnych modeli oraz
wspomagających proces projektowania. Cyfrowy model kości miednicy
otrzymany zostanie dzięki użyciu inżynierii odwrotnej (ang. Reverse
Engineering) – badanie tomografem komputerowym, projektowanie na
jego podstawie implantu przeprowadzone zostanie w programach wspomagających projektowanie (ang. Computer Aided Design), a do wytworzenia
1
[email protected], Katedra Inżynierii Materiałowej i Biomedycznej, Wydział
Mechaniczny, Politechnika Białostocka, www.pb.edu.pl
2
[email protected], Katedra Inżynierii Materiałowej i Biomedycznej,
Wydział Mechaniczny, Politechnika Białostocka, www.pb.edu.pl
325
Adrian Dubicki, Żaneta Anna Mierzejewska
wszczepu użyta będzie technika szybkiego prototypowania (ang. Rapid
Prototyping) – wydruk 3D z proszków biozgodnych metali.
Obranie takiej ścieżki pozwala na zwiększenie dokładności dopasowania implantu do pozostałych struktur anatomicznych pacjenta, co
przekłada się na zmniejszenie ryzyka powikłań oraz skrócenie czasu
trwania zabiegu operacyjnego.
3. Cyfrowy model kości
Niemal u każdego pacjenta, z poważnymi schorzeniami czy uszkodzeniami w obrębie miednicy wykonywane jest badanie tomografem
komputerowym lub rezonansem magnetycznym. Głównym celem jego
przeprowadzenia jest poznanie rozległości choroby lub obrażeń chorego.
Na podstawie badania, lekarz może potwierdzić wstępnie postawioną diagnozę, a dzięki dokładności wyników, rozszerzyć ją.
Do otrzymania modelu komputerowego kości wykorzystano oprogramowanie MIMICS. Jest ono profesjonalnym narzędziem do segmentacji obrazów
medycznych pochodzących z tomografii komputerowej lub rezonansu
magnetycznego, ich wizualizacji oraz tworzenia trójwymiarowych modeli [4].
Proces przygotowania trójwymiarowego modelu kości miednicy rozpoczął
się od wczytania danych z tomografii komputerowej. Do celów projektu
wykorzystane zostały skany tomograficzne dostępne w bibliotece programu
MIMICS, zawierające obrazy struktur anatomicznych potrzebnych do
niniejszej pracy. Okno programu MIMICS z wczytanymi obrazami tomograficznymi przedstawione zostało na rysunku 1.
Rysunek 1. Okno programu MIMICS z wczytanymi obrazami TK
326
Projekt indywidualnego implantu kości biodrowej
W celu zebrania wszystkich pikseli prezentujących na obrazach dany
rodzaj tkanki, np. zgrupowanie tkanek kostnych i ich oddzielenie od tkanek
miękkich, należy przeprowadzić operację progowania – opcja Thresholding
Opcja ta wykorzystuje przypisanie poszczególnym pikselom wartości ze
skali Hounsfielda. Wybranie pewnego przedziału ze skali wartości
powoduje utworzenie maski zawierającej tylko te punkty, które mają
przypisany współczynnik mieszczący się w wybranym przez użytkownika
zakresie. Program umożliwia indywidualne dobranie wartości interesującego nas przedziału lub wybranie określonych w programie przedziałów, które w przybliżony sposób odpowiadają danej tkance np. kościom.
W projekcie wykorzystano zaproponowany w programie zakres progowania dla kości, wynoszący od 226 do 1634 jednostek HU.
Po wybraniu odpowiedniego przedziału i utworzeniu maski z pikselami
reprezentującymi kości, można przystąpić do jej edycji. W utworzonym
zbiorze znajdują się wszystkie piksele z całego obszaru badania, które
mieszczą się w zadanym zakresie wartości ze skali Hounsfielda.
Utworzenie trójwymiarowego modelu na podstawie tej maski dało by efekt
w postaci modelu połączonych ze sobą kości (brak przejść stawowych),
części naczyń krwionośnych (głównie tętnic) i narządów. Z tego powodu
należy podać maskę edycji.
Interesująca nas prawa kość miedniczna musi zostać odłączona od
pozostałych wybranych tkanek. Umożliwi to w dalszych krokach
oddzielenie pikseli reprezentujących strukturę, której model chcemy
otrzymać i utworzenie z nich nowej maski. W celu oddzielenia punktów
kości miednicznej od innych, reprezentujących kość udową, krzyżową
i spojenie łonowe należy użyć funkcji Edit masks i jej opcji Erase. Pozwala
ona na usunięcie, wymazanie zbędnych pikseli, odseparowanie złączonych
w modelu kości o których wiemy, że w rzeczywistości są połączone tylko
za pomocą tkanki chrzęstnej i nadanie nowych granic obiektom. Funkcja
programu MIMICS – Calculate 3D, umożliwia wygenerowanie na podstawie pikseli wybranej maski, trójwymiarowego modelu struktur
anatomicznych (rysunek 2a).
Wygenerowany trójwymiarowy model kości miednicznej (2b) mógłby
zostać wyeksportowany do oprogramowania CAD, w celu zaprojektowania
implantu kości biodrowej. Posiada on jednak liczne niedoskonałości
i nieciągłości. Wykorzystanie takiego modelu mogłoby spowodować złe
dopasowanie do struktur anatomicznych i nieprawidłowe zaprojektowanie
implantu.
Dzięki opcji Calculate polylines (rysunek 3) program tworzy polilinie,
które prowadzone są na granicy pikseli danej maski. Powoduje to łagodne
wygładzenie powierzchni modelu. Utworzenie polilinii umożliwia
przeprowadzenie kolejnej ważnej operacji. Jest nią Cavity fill from
327
Adrian Dubicki, Żaneta Anna Mierzejewska
polylines, która umożliwia uzupełnienie luk wewnątrz modelu. W wyniku
użycia tej opcji utworzona jest nowa maska, w której skład wchodzą
również woksele w poprzednich maskach nie uwzględniane.
a)
b)
Rysunek 2. Wygenerowany model a) kośćca miednicy i kręgów lędźwiowych, b) model kości
biodrowej
Rysunek 3. Okno funkcji Calculate polylines oraz utworzone, widoczne na modelu 3D polilinie
328
Projekt indywidualnego implantu kości biodrowej
4. Obróbka cyfrowego modelu kości [5]
Dalsza obróbka utworzonego cyfrowego modelu kości miednicznej
wykonana została przy użyciu modułu Mimics Remesh, będącego częścią
oprogramowania MIMICS. Za jego pomocą przygotowany został gotowy,
cyfrowy model prawej kości miednicznej (w rozszerzeniu STL), który
będzie mógł następnie zostać wykorzystany do projektowania implantu
w oprogramowanie CAD.
Po wybraniu opcji Remesh w programie MIMICS trójwymiarowy model
jest automatycznie przenoszony do modułu Mimics Remesh. Okno modułu
podzielone jest na trzy części. Po lewej znajduje się podgląd na model oraz
lista przeprowadzonych procesów, a po prawej stronie okna panel
kontrolny modelu i miejsce do wprowadzenia parametrów wykonywanych
na modelu operacji.
Przeniesiony do Mimics Remesh model przedstawiony jest w postaci
siatki trójkątów. Podobnie jak w przypadku wizualizacji modelu
w programie MIMICS (bez wyświetlenia siatki trójkątów), podobnie
i w jego module, na podstawie obserwacji siatki trójkątów można zauważyć
liczne niedoskonałości i nierówności. Ich wygładzenie możliwe jest dzięki
opcji Smooth. Po jej wybraniu należy ustawić parametry wygładzania.
W tym celu współczynnik wygładzenia (Smooth factor) ustawiony został
na wartość 0,7. Ilość iteracji wygładzania (Number of iterations) ustawiono
na piętnaście powtórzeń.
Działanie funkcji Smooth opiera się na porównywaniu trójkątów
z sąsiednimi i ich dopasowaniu w celu usunięcia nierówności. W wyniku
zastosowania tej opcji, siatka trójkątów została wygładzona. Krawędzie
talerza biodrowego oraz panewki nie są ostre, a powierzchnie mają płynne,
gładkie kształty.
Kolejnym etapem obróbki modelu jest wykorzystanie opcji Reduce. Jej
użycie ma na celu uproszczenie siatki trójkątów. Przed wykonaniem tego
kroku, model utworzony jest z równomiernie ułożonych trójkątów.
Niezależnie czy opisywana przez nie powierzchnia jest płaska czy
wypukła, do ich opisania używana jest taka sama liczba trójkątów.
Powoduje to niepotrzebne skomplikowanie modelu.
Po wybraniu opcji redukcji należy wprowadzić w oknie parametry
procesu. Pierwszym jest Flip thresholds angle, który ustawiamy na wartość
15. Ten parametr decyduje o wartości kątów – im jest wyższy, tym trójkąty
tworzące siatkę będą bardziej równomierne. Ważnym parametrem jest
Geometrical error. Decyduje on o odchyleniu położenia nowego trójkąta
w stosunku do położeń trójkątów go tworzących. Ustawiona na 0,9 wartość
błędu geometrycznego oznacza, że model będzie różnił się od
wejściowego, utworzonego na podstawie zdjęć tomografii komputerowej
329
Adrian Dubicki, Żaneta Anna Mierzejewska
o wartość maksymalnie 1/8 piksela. Pomimo uproszczenia, pozwoli to na
dosyć dokładne odwzorowanie zdjęć TK przez model. Ilość iteracji
redukcji (Number of iterations) ustawiono na 25 powtórzeń.
W wyniku wykonania opcji Reduce siatka trójkątów tworząca model
składa się 2140. Przed jej wykonaniem liczba trójkątów wynosiła 15954,
więc w wyniku redukcji model został opisany siatką mniejszą o 13814
trójkąty.
Siatka tworząca model, po przeprowadzonych operacjach składa się
z mniejszej liczby trójkątów, ale nie rozłożonych równomiernie. Niektóre
powierzchnie składają się z pojedynczych, a niektóre z nawet
kilkudziesięciu trójkątów. Aby wyrównać siatkę należy użyć opcji Auto
Remesh. W celu uzyskania dokładnego wyrównania położenia trójkątów
wprowadzono parametry procesu. Pierwszym jest dokładność odwzorowania kształtu (Shape quality) wynosząca 0,3 oraz maksymalny błąd
geometrii (Maximum geometrical error) ustawiony na wartość 0,4.
Wymienione parametry zablokują możliwość zbyt dużego odchylenia od
wartości początkowych i pozwolą na dokładne odwzorowanie struktur
anatomicznych. Maksymalna długość krawędzi trójkąta (Maximal edge
length) została ustawiona na wartość 5. Oznacza to że każda powierzchnia
będzie opisana trójkątami o podobnych wymiarach. Ilość iteracji (Number
of iterations) ustawiona została na 15 powtórzeń.
330
Projekt indywidualnego implantu kości biodrowej
Rysunek 4. Parametry opcji Reduce. Modele kości przed redukcją (u góry) oraz po jej wykonaniu
(u dołu)
W wyniku wykonania operacji Auto remesh model ponownie składa się
z większej liczby trójkątów. Ich liczba zwiększyła się do 15728. Świadczy
to o tym że siatka składała się w głównej mierze z dużych trójkątów.
Powierzchnie utworzone z małych trójkątów stanowiły rzadkość w modelu.
Wykorzystanie opcji sprawiło równomierne rozmieszczenie siatki, jej
wygładzenie i rozbudowanie.
331
Adrian Dubicki, Żaneta Anna Mierzejewska
Ostatnim krokiem, mającym na celu edycję siatki trójkątów jest
wykorzystanie funkcji Quality Preserving Reduce Triangles. Ma ona na
celu ponowną redukcję ilości liczby trójkątów, przy jednoczesnym
zachowaniu jak najlepszej jakości modelu. Wprowadzone parametry
procesu miały takie same wartości, jak w przypadku operacji Auto Remesh.
Różnice pomiędzy siatkami przed i po wykonaniu operacji uproszczenia
siatki są niemal nie zauważalne. Powodem tego jest ilość trójkątów o które
pomniejszono siatkę. W wyniku tej operacji, liczba trójkątów wchodzących
w skład siatki zmniejszyła się już tylko o 372 elementy. Tak otrzymany
model może posłużyć do wykonania implantu kości biodrowej, lecz przed
opuszczeniem programu należy sprawdzić budowę siatki. W tym celu
wykorzystano funkcję Fix Wizard (rys. 5). Pozwala ona wykryć wszystkie
niedoskonałości siatki, np. nieciągłości oraz automatyczną naprawę
prostych defektów.
Rysunek 5. Okno opcji Fix wizard sprawdzającej poprawność siatki
5. Projektowanie indywidualnego implantu kości biodrowej przy
użyciu oprogramowania CAD
Zaawansowane zmiany kości biodrowej mogą uniemożliwiać
wykorzystanie modelu do celów projektowych. W takim przypadku konieczne
było by przygotowanie modelu zdrowej kości miednicznej. Wtedy pierwszym
krokiem, po wgraniu modelu do programu CAD – SolidWorks lub jeszcze na
etapie programu MIMICS, powinno być wykonanie lustrzanego odbicia
modelu zdrowej kości. Budowa anatomiczna kości miednicznych danego
332
Projekt indywidualnego implantu kości biodrowej
człowieka nie różni się aż w takim stopniu, by uniemożliwić ich
naprzemienne wykorzystanie.
Kość biodrowa jest jedną z kości tworzących kość miedniczną. Wraz
z kością łonową i kulszową buduje również panewkę stawu biodrowego.
Z tego powodu, wykonanie implantu tylko i wyłącznie kości biodrowej nie
jest możliwe [6]. Projektowany wszczep musi być zatem wyposażony
w sztuczną panewkę. Aby połączenie implantu z pozostałymi kośćmi
pacjenta nie odbywało się w bezpośrednim sąsiedztwie zewnętrznych
powierzchni panewki, będzie ono miało miejsce na trzonie kości kulszowej
i górnej gałęzi kości łonowej.
Aby przygotować przyszły kształt implantu i odrzucić z wczytanego do
programu modelu kości, które mają być u pacjenta zachowane, użyto opcji
Wyciągnięcie wycięcia (rys. 6). Za jej pomocą, wcześniej przygotowane,
przestrzennie dopasowane do kości szkice, posłużyły do przecięcia kości,
we wcześniej opisanych miejscach.
Rysunek 6. Przecięte w programie SolidWorks kości miednicy (po lewej – trzon kości kulszowej,
po prawej – gałąź kości łonowej)
Kolejnym ważnym krokiem w procesie projektowania implantu kości
biodrowej jest przygotowanie panewki stawu biodrowego. Musi być ona
odpowiednio ustawiona względem kości miednicznej, jak i również kości
udowej. Zakres kąta osi panewki względem trzonu kości udowej powinien
o
o
mieścić się w przedziale od 115 do 150 [6]. Najlepszym rozwiązaniem do
wypozycjonowania łoża pod panewkę jest wykorzystanie naturalnej
panewki pacjenta, której model posiadamy.
W tym celu utworzona została płaszczyzna, przechodzącą symetrycznie
przez środek panewki z wczytanego modelu. Wykonanie przekroju, na
podstawie odpowiednio ustawionej płaszczyzny pozwala naszkicować
kształt przyszłej powierzchni stawowej implantu.
Przed przystąpieniem do projektowania panewki należało usunąć
zbędne elementy modelu. W tym celu utworzony został szkic, który
posłużył do wycięcia w modelu sfery, poprzez wykorzystanie operacji
333
Adrian Dubicki, Żaneta Anna Mierzejewska
Wycięcie przez obrót. Tak przygotowane miejsce dało pewność, że model
struktur anatomicznych pacjenta nie wpłynie na kształt projektowanego
implantu stawowego, nie będą obecne przenikania na powierzchnię
przyszłej panewki jak i puste przestrzenie pod nią. Następnie został
przygotowany szkic łoża. Etapy jego przygotowania zostały ukazane
poniżej, na rysunku 7.
Do utworzenia panewki (rysunek 8 a) użyto operacji Dodanie przez
obrót. Zaprojektowana została w taki sposób, aby mogła współpracować
z implantami powierzchni stawowych – kapami (po uprzednim przygotowaniu powierzchni i pokryciu warstwą odpornego na ścieranie azotku
tytanu (TiN)) lub po wyposażeniu we wkładkę polietylenową – z głową
endoprotezy stawu biodrowego. Wkładka polietylenowa, po umieszczeniu
jej w łożu i wciśnięciu, blokuje się za pomocą wypustek, uniemożliwiając
wysunięcie się [2].
Rysunek 7. Etapy projektowania panewki stawu biodrowego w implancie kości biodrowej
(A – przekrój przez model panewki, B – oczyszczenie miejsca pod panewkę,
C – szkic łoża panewki)
Po wykonaniu operacji dodania do modelu panewki, przeprowadzony
został pomiar, (rys. 8 b) mający na celu sprawdzenie prawidłowego
ustawienia łoża względem trzonu kości udowej. Na odpowiednio
ustawionej względem osi panewki płaszczyźnie, naszkicowane zostały linie
– przechodząca przez jej środek symetrii oraz pionowa. Dokonany pomiar
o
kąta wykazał wartość bliską 126 . Świadczy to o prawidłowym ustawieniu
implantu panewki w modelu kości miednicznej pacjenta, gdyż wartość kąta
o
o
mieści się w poprawnym zakresie od 115 do 150 [6].
Kolejnym etapem projektowania indywidualnego implantu kości
biodrowej jest dodanie mocowań (rys. 9). Pozwolą one na trwałe
połączenie wszczepu z pozostawionymi kośćmi – kulszową i łonową.
Ważne jest aby wypustki mocujące jak najdokładniej pasowały do
powierzchni kości, a osie otworów pod wkręty kostne nie przecinały się,
aby nie doszło do skrzyżowania umieszczanych w kości wkrętów.
Dodanie mocowań odbywało się przy użyciu operacji Wyciagnięcie
dodania/bazy oraz Wyciągnięcie po profilach. Skomplikowana geometria
334
Projekt indywidualnego implantu kości biodrowej
modelu wymagała pracy na licznych płaszczyznach i przekrojach, na
których następnie rysowane były szkice mocowań. Po wymodelowaniu
wypustek używana była operacja Zaokrąglenie, mająca na celu usunięcie
już na etapie modelu komputerowego ostrych, mogących powodować
skaleczenia pacjenta jak i lekarza krawędzi.
Po przygotowaniu ramienia mocowania, na ich końcach dodawane były
otwory. Będą one umożliwiały przymocowanie za pomocą wkrętów
kostnych, implantu do kości. Średnice wszystkich otworów mają wartość
4,4 milimetra. W fazie obróbki wykańczającej powinny zostać rozwiercone
do średnicy 4,6 milimetra, co umożliwi zastosowanie śrub dokostnych
o średnicy 4,5 milimetra.
a)
b)
Rysunek 8. Dodane do implantu kości biodrowej a) łoże panewki stawu biodrowego, b) pomiar
wartości kąta pomiędzy osią panewki, a trzonem kości udowej
Po zakończeniu przygotowywania otworów pod wkręty kostne, ważne
jest również przygotowanie gniazda pod łeb śruby. W tym celu użyta
została operacja Sfazowanie. Umożliwiła ona otrzymanie wgłębienia,
w które przynajmniej w części schowany będzie łeb wkrętu kostnego.
Kolejnym etapem projektowania jest dodanie na ścianach implantu,
które będą łączyć się z kośćmi, powierzchni umożliwiających przerost
tkanką kostną. Do ich wykonania posłużyła operacja Wyciągnięcie wycięcia
wykonywana na podstawie sporządzonych na kilku płaszczyznach szkiców.
Powierzchnie te umożliwią po pewnym okresie od implantacji wrośnięcie
w przygotowaną strukturę, żywej tkanki kostnej. Rezultatem przerostu
tkanką, będzie dodatkowe, mechaniczne połączenie na granicy implant-
335
Adrian Dubicki, Żaneta Anna Mierzejewska
kość, powodujące jeszcze lepszą stabilizację wszczepu. Mechanizm
osteointegracji można porównać do mechanizmu zrastania się złamanych
kości [7].
Korzystanie z takich powierzchni daje pozytywne efekty, dlatego
w dużej części nowoczesnych implantów, zarówno ortopedycznych jak
i stomatologicznych można zaobserwować ich użycie. Istnieją różnorodne
metody wytwarzania takich struktur oraz ich różne formy [7]. Najczęściej
stosowanymi obecnie są powierzchnie wytworzone z hydroksyapatytu,
napylonego stopu tytanu, a wraz ze wzrostem technik przyrostowych,
bezpośrednio projektowane i drukowane.
Rysunek 9. Mocowania implantu do kości kulszowej (po lewej) i łonowej
Kolejnym etapem jest wykonanie mocowania implantu z kością
krzyżową. Ze względu na położenie implantu względem kości krzyżowej,
utrudnione staje się dodanie mocowań podobnych do wcześniej
omawianych. Wygodniejszym rozwiązaniem jest zastosowanie otworów
przechodzących przez implant, które posłużą do przytwierdzenia implantu
przy użyciu wkrętów kostnych.
Do programu SolidWorks wczytany został wcześniej przygotowany
w programie MIMICS, model kości krzyżowej. Zaimportowany został
w formie grafiki, co powoduje że nie wpływa on na projektowany wszczep
i nie mogą być na nim wykonywane żadne operacje. Implant wraz
z wczytanym modelem ustawione zostały w płaszczyźnie strzałkowej.
Podgląd struktury kości krzyżowej umożliwił prawidłowe rozmieszczenie
otworów (rys. 10), w miejscach gdzie łączy się ona z kością biodrową,
a zarazem gdzie można zauważyć jej grubsze, wypukłe ścianki.
Przy użyciu operacji Wyciągnięcie wycięcia, na podstawie szkiców i ich
rozmieszczenia do modelu dodane zostały otwory służące do wprowadzenia śrub kostnych i trwałego połączenia implant-kość krzyżowa.
Możliwe jest ono dzięki zastosowaniu trzech śrub mocujących, które
pewnie i stabilnie unieruchomią implant w odpowiednim płożeniu.
336
Projekt indywidualnego implantu kości biodrowej
Podobnie jak w przypadku wcześniej omawianych i dodanych mocowań,
wykonane zostały dodatkowe wgłębienia oraz sfazowania, mające na celu
schowanie łba śruby. Tak jak poprzednio, średnice wszystkich otworów
mają wartość 4,4 milimetra, a w fazie obróbki wykańczającej powinny
zostać rozwiercone do średnicy 4,6 milimetra, aby było możliwe zastosowanie wkrętów takich jak w poprzednich mocowaniach.
Na stabilność implantu wpływ ma również rozbudowana, dobrze
dopasowana struktura powierzchni łączących się z kością krzyżową, przez
którą będą przenoszone siły z górnej części ciała.
W kolejnym etapie projektowania należało przygotować szereg
dodatkowych otworów, których funkcją będzie zapewnienie miejsca
przyczepu mięśniom. Bez przywrócenia utraconych, podczas usuwania
zmienionej chorobowo kości, połączeń pomiędzy układem kostnym,
którego częścią staje się projektowany implant, a układem mięśniowym,
nie możliwe jest przywrócenie mobilności i stabilności organizmowi [6, 7].Większość otworów zlokalizowana jest na obwodzie talerza
kości biodrowej. Będą one służyć do przyczepu szerokiego pasma mięśni
biodrowych. Pozostałe, rozmieszczone m.in. na guzowatości kości
kulszowej czy biodrowej, będą służyć jako miejsce mocowania, m.in. dla
mięśnia krawieckiego, lędźwiowego, naprężacza powięzi szerokiej oraz
mięśni pośladkowych. Do przygotowanych otworów przymocowane będą
również więzadła – pachwinowe i krzyżowo-biodrowe [6, 7].
Rysunek 10. Dobranie położenia otworów do mocowania implantu do kości krzyżowej.
Wczytany model kości krzyżowej służy do prawidłowego rozmieszczenia otworów
337
Adrian Dubicki, Żaneta Anna Mierzejewska
Górna pozostałość krawędzi panewki stawu biodrowego wykorzystana
została do przeprowadzenia przez nią otworów, podobnie jak w poprzednich przypadkach, mających na celu przymocowanie więzadła biodrowoudowego [6, 7].
Kolejnym ważnym krokiem projektowania, którego celem jest zmniejszenie masy implantu, jest dodanie ażurowych wycięć w rejonach wszczepu
nie przenoszących znacznych sił. Przed przystąpieniem do wykonania tej
operacji, wykorzystano opcję Właściwości masy, pozwalająca określić
objętość i masę modelowanych obiektów.
Przed użyciem opcji Właściwości masy, należy modelowi przypisać
materiał, z jakiego ma być wykonany. Do wykonania wszczepu użyty zostanie
stop tytanu Ti6Al4V. Jest on obecnie najczęściej stosowanym materiałem na
różnego rodzaju implanty, spośród wszystkich biomateriałów metalicznych.
Posiada on dobre własności mechaniczne, charakteryzuje się bardzo dobrą
odpornością korozyjną i biokompatybilnością [7]. W porównaniu do innych
stosowanych na endoprotezy materiałów (stali austenitycznej i stopów
kobaltu), stop tytanu posiada niższą masę właściwą oraz moduł Younga.
Wpływa to pozytywnie przy współpracy i przenoszeniu sił na granicy implantkość. Najlepsza spośród materiałów biozgodność sprawia że stopy tytanu są
stosowane w licznych wariantach endoprotez, a szczególnie tych
przeznaczonych dla osób młodych [7]. Ze względu na te korzystne połączenie
właściwości mechanicznych (sprężystość, plastyczność, wytrzymałość)
materiał ten zostanie wykorzystany do produkcji zaprojektowanego implantu.
W poniższej tabeli 1, przedstawiono podstawowe właściwości mechaniczne
nadawane przez program SolidWorks projektowanemu wszczepowi.
Tabela 1. Właściwości materiałowe stopu Ti6Al4V z bazy programu SolidWorks
Właściwość
Wartość
Moduł Younga
Współczynnik Poissona
Wytrzymałość na rozciąganie
Granica plastyczności
Masa właściwa
104800,3 N/mm2
0,31
1050 N/mm2
825,4 N/mm2
4428,8 kg/m3
W celu porównania masy projektowanego implantu, przygotowany
został również model prezentujący zastępowaną przez wszczep kość.
Program SolidWorks nie zawiera danych dotyczących właściwości
mechanicznych kości, dlatego należało przygotować i wprowadzić dane
dotyczące tkanki kostnej. Wprowadzone dane (tabela 2) dotyczą uśrednionych wartości budującej kość tkanki korowej i gąbczastej.
338
Projekt indywidualnego implantu kości biodrowej
Tabela 2. Wprowadzone do programu SolidWorks właściwości materiałowe kości [8]
Właściwość
Moduł Younga
Współczynnik Poissona
Granica plastyczności
Masa właściwa
Wartość
2130 N/mm2
0,3
148 N/mm2
2000 kg/m3
Po przypisaniu materiałów, oba modele zostały poddane badaniu
Właściwości masy, które oblicza m.in. objętość modelu i podaje wartość jego
masy. Z otrzymanych danych (rys. 11) wynika, że masa usuniętej pacjentowi
kości wyniosła by ok. 823 gramy, a masa zastępującego ją implantu wynosi
ok. 1816 gram. Jest to wartość ponad dwukrotnie przewyższająca masę
usuniętych tkanek. Wykonanie badania potwierdziło konieczność wykonania
w implancie ażurowych przestrzeni. Główną lokalizacją, ze względu na
przenoszone przez implant siły, będzie powierzchnia talerza kości biodrowej.
Obciążenia, z kręgosłupa na kończynę dolną, przenoszone są pomiędzy kością
krzyżową, a panewką stawu biodrowego. Talerz kości biodrowej w głównej
mierze służy jako miejsce przyczepu licznych mięśni. Zastosowanie implantu
będzie wiązać się z koniecznością znacznego zmniejszenia aktywności
fizycznej. Siły generowane przez mięśnie, które dodatkowo będą poddane
rekonstrukcji nie będą tak duże jak u zdrowego człowieka. Daje to możliwość
zastosowania konstrukcji ażurowej, przy zachowaniu łukowatego brzegu
talerza, który będzie służył za miejsce przyczepu i do przenoszenia sił mięśni.
Rysunek 11. Porównanie masy implantu z masą kości przez niego zastępowaną
339
Adrian Dubicki, Żaneta Anna Mierzejewska
Pierwszym etapem przygotowania powierzchni i konstrukcji ażurowej
jest wybranie odpowiednich, jak najbardziej równoległych do ścian talerza
biodrowego powierzchni. Na ich podstawie utworzone zostały szkice,
pozwalające na przygotowanie za pomocą operacji Wyciągnięcie wycięcia
wycięć w materiale, w postaci struktury tzw. plastra miodu.
W taki sposób przygotowane zostały cztery takie powierzchnie. Dwie
graniczne, położone nad połączeniem implant-kość krzyżowa oraz przy
guzie przednim, górnym talerza biodrowego powierzchnie nie zostały
wycięte przelotowo przez implant. Ma to na celu zachowanie dopasowanej
powierzchni stawowej (w przypadku pierwszej struktury) oraz wzmocnienia guza przedniego, górnego implantu (druga struktura), który będzie
miejscem przyczepu m.in. mięśnia krawieckiego. Pozostałe dwie
powierzchnie przechodzą na wylot talerza kości biodrowej.
Wykonanie konstrukcji ażurowej pozwoliło na zmniejszenie masy
implantu, przy zachowaniu wystarczającej jego wytrzymałości. Zostało to
potwierdzone dzięki wykonaniu badania Właściwości masy. Widok
implantu z wykonanymi strukturami ażurowymi przedstawiony został na
rysunku 12.
Zastosowanie konstrukcji ażurowej pozwoliło zmniejszyć masę
implantu o 141 gram. W stosunku do pełnego implantu, masa po
wykonaniu operacji wycięcia spadła o ok. 8%. Pozwoliło to na otrzymanie
wartości masy implantu dwukrotnie większej od wartości kości.
W poprzednim przypadku różnica ta wynosiła ok. 2,2.
W celu zmniejszenia masy można byłoby zastosować puste przestrzenie
wewnątrz implantu. Nie wpływały by one znacząco na wytrzymałość
wszczepu. Przy obecnym stanie techniki, nie posiadamy jednak
rozwiązania umożliwiającego pozostawienie takich przestrzeni. Stosowane
techniki przyrostowe, dające możliwość wytwarzania detali z metali, jako
podpory stosują używany do produkcji proszek. Przy zamknięciu
wszystkich ścian, nie można by go było usunąć z wnętrza takiego implantu,
a w przypadku uszkodzeń wszczepu mogło by dojść do wysypania go
wewnątrz organizmu.
Zaproponowana konstrukcja implantu spełnia stawiane mu założenia
i oczekiwania. Wierne odtworzenie modelu kości miednicznej pacjenta
pozwoliło na wykorzystanie modelu do wykonania idealnie pasującego do
pozostałego kośćca pacjenta wszczepu. Dodane wypustki mocujące do
kości kulszowej i łonowej oraz otwory do zamocowania z kością krzyżową
pozwolą na stabilne połączenie implantu z kośćmi, a dodatkowe powierzchnie do przerostu tkanką kostną pozwolą na kolejne jej zwiększenie.
Zastosowanie otworów, których funkcją ma być rekonstrukcja przyczepów mięśniowych umożliwia w pewnym stopniu odtworzenie funkcji
340
Projekt indywidualnego implantu kości biodrowej
układu mięśniowego w obrębie miednicy. Wykorzystane ażurowe wycięcia
zmniejszają masę implantu, bez znaczących strat w jego wytrzymałości.
Wpasowana na podstawie modelu pacjenta do implantu panewka,
pozwoli na przywrócenie funkcji ruchomości w stawie biodrowym
i z biegiem czasu, w procesie rehabilitacji, umożliwi na lokomocję
pacjenta.
Rysunek 12. Widoki rzutów indywidualnego implantu kości biodrowej prawej
341
Adrian Dubicki, Żaneta Anna Mierzejewska
6. Wnioski/Podsumowanie
Indywidualne implanty stają się coraz powszechniej stosowanym
sposobem zastąpienia uszkodzonych tkanek i przywrócenia pełnionych
przez nie funkcji. Rosnąca popularność związana jest z coraz częstszymi
przypadkami dysfunkcji w obrębie kośćca miednicy, spowodowanymi
poprzez zmiany zwyrodnieniowe, onkologiczne lub urazy. Zaawansowanie
i rozległość niektórych z nich sprawia, że często jedynym rozwiązaniem są
spersonalizowane implanty.
Do popularyzacji indywidualnych implantów przyczynia się również
rozwój techniki, który umożliwia przygotowanie i wytworzenie idealnie
dopasowanych wszczepów. Nie byłoby to jednak możliwe bez znacznego
postępu, który można zauważyć w technikach obrazowego diagnozowania
medycznego. Oprócz precyzyjnej diagnozy, pozwalają otrzymać niezwykle
przydatne w obecnej medycynie, trójwymiarowe modele tkanek i narządów
pacjenta.
Zaproponowany w pracy projekt, opartego na trójwymiarowym modelu
implantu oraz metoda jego produkcji pozwalają osiągnąć wymienione cele.
Użycie techniki inżynierii odwrotnej, poprzez wykorzystanie obrazów z
tomografii komputerowej pozwoliło na otrzymanie niezbędnych do
utworzenia modelu 3D danych. Wykorzystanie oprogramowania do
rekonstrukcji obrazów medycznych MIMICS umożliwiło otrzymanie
modelu kości miednicznych, a moduł Mimics Remesh, na jego przygotowanie do wykorzystania w celach projektowych, w oprogramowaniu CAD
– SolidWorks. Wykorzystanie programu do komputerowego wspomagania
projektowania dało możliwość przygotowania implantu, który pomimo
licznych, zmniejszających masę ażurowych obszarów, będzie miał
odpowiednią wytrzymałość.
Pomimo licznych zalet, metoda posiada również wady. Wykonanie
gotowego, pustego wewnątrz wyrobu nie jest możliwe. Stosowany jako
podpora proszek pozostaje wewnątrz wszczepu. Możliwość wykonania
implantu w postaci skorupy dałaby pozytywne efekty. Tak przygotowany
implant byłby równie wytrzymały, a dodatkowo lżejszy. Pozwoliłoby to na
naśladowanie w pewnym stopniu naturalnej struktury kości, składającej się
z zbitej, zewnętrznej warstwy korowej i wewnętrznej, ażurowej tkanki
gąbczastej.
Rozwój techniki i medycyny będzie skutkował powstaniem coraz to
nowszych metod zastępowania tkanek i rozwoju już istniejących. W świetle
obecnego stanu techniki, zaproponowany projekt implantu kości biodrowej,
jak i proces jego wykonania spełnia stawiane oczekiwania.
342
Projekt indywidualnego implantu kości biodrowej
Podziękowania
Praca zrealizowana przy wsparciu finansowym Wydziału Mechanicznego Politechniki Białostockiej w ramach projektu „Rozwój młodych
naukowców i uczestników studiów doktoranckich‖ nr MB/WM/14/2014.
Literatura
1.
2.
3.
4.
5.
6.
7.
8.
Gonera K., Kurzac J., Rusińska M., Dybała B., Metody CAx w aplikacjach
medycznych przy wytwarzaniu technologiami generatywnymi, Wrocław,
Miesięcznik Naukowo-Techniczny Mechanik, 2010, tom 83, numer 2, s. 132-142
Madej T., Modelowanie strefu ruchowej endoprotezy stawu biodrowego
w aspekcie biomateriałów, Kraków, 2008, Praca doktorska, Wydział inżynierii
mechanicznej i robotyki, Akademia Górniczo-Hutnicza
Markowska O., Budzik G., Innowacyjne metody wytwarzania implantów
kostnych za pomocą inżynierii odwrotnej (RE) oraz technik szybkiego
prototypowania (RP), Sosnowiec, X Forum Inżynierskie ProCAx, 2011
Mimics. Medical Edition. Skrócona instrukcja obsługi oprogramowania
[katalog], Leuven, Materialise NV, 2014
Mimics Student Edition Course Book [podręcznik], Leuven, Materialise NV, 2012
Bochenek A., Reicher M., Anatomia człowieka. Tom I. Warszawa,
Wydawnictwo Lekarskie PZWL, 2009, s. 232-237, 518-541 i 853-868
Anatomia człowieka. Podręcznik dla studentów i lekarzy, Praca zbiorowa pod
redakcją W. Woźniaka. Wrocław: Elsevier Urban i Partner, 2010, s. 379-431
Polak Sz., Modelowanie i analiza właściwości mechanicznych kości, Poznań,
2014, Praca dyplomowa inżynierska, Wydział budowy maszyn i zarządzania,
Politechnika Poznańska
Projekt indywidualnego implantu kości biodrowej
Zamysłem niniejszej pracy jest połączenie wiedzy medycznej z techniczną, w celu uzyskania
zadowalającego efektu, jakim jest odtworzenie funkcji miednicy. W pracy został przedstawiony
i opisany przebieg projektowania indywidualnego implantu kości biodrowej, przy wykorzystaniu
najnowszych rozwiązań technicznych. Wykonywane badania tomografii komputerowej
pozwalają na postawienie precyzyjnej diagnozy, a otrzymany z ich przetworzenia cyfrowy model
kości miednicznej, posłużył do zaprojektowania w programie CAD wspomnianego implantu,
dokładnie dopasowanego do pozostałych kości miednicy pacjenta. Kolejną korzyścią jest
możliwość szybkiego wykonania takiego wszczepu przy użyciu techniki szybkiego
prototypowania – drukując go z proszku tytanowego, przy użyciu drukarki 3D, czy przy
wykorzystaniu obrabiarek sterowanych numerycznie.
The project of individual ilium bone implant
The intention of this work is to combine technical and medical knowledge in order to achieve a
satisfactory result, which is to restore the function of the pelvis. In this work and described
progress of individual design of the implant of the ilium has been shown, using the most modern
technical solutions. Computed tomography allows to place a precise diagnosis and resulting from
their processing digital model of the pelvic bone and to design the CAD model precisely matched
to the rest of the patient's pelvic bone. Another benefit is the ability to quickly execute such an
implant using rapid prototyping techniques – printing it titanium powder using a 3D printer,
whether using numerically controlled machine tools.
343
Magdalena Grygiel-Pradelok1, Janusz Szewczenko2, Wojciech Kajzer3,
Magdalena Antonowicz4
Ocena wpływu biodegradowalnej
warstwy polimerowej (PLGA)
na korozję podłoża ze stopów tytanu
1. Wprowadzenie
Pomimo dynamicznego rozwoju inżynierii tkankowej oraz nowoczesnych biomateriałów polimerowych i ceramicznych, w dalszym ciągu
do produkcji implantów najczęściej wykorzystuje się biomateriały
metalowe. Wśród nich wyróżnić można: stal austenityczną, stopy kobaltu,
czysty tytan oraz stopy tytanu [1, 2]. Główną przyczynę szerokiego
stosowania materiałów metalowych stanowi relatywnie niski koszt,
w porównaniu do innych grup materiałowych oraz szeroka dostępność.
Podstawowe ograniczenie ich stosowania stanowi umiarkowana
biotolerancja, na którą wpływa głównie niewystarczająca odporność
korozyjna w środowisku tkanek człowieka, alergiczne i toksyczne
oddziaływanie produktów degradacji na tkanki okołowszczepowe, a także
wysoka wartość modułu sprężystości. Natomiast do zalet biomateriałów
metalowych zalicza się przede wszystkim: wysoką wytrzymałość,
odporność na zmęczenie i zużycie, łatwość produkcji oraz sterylizacji [3].
W wyniku prowadzonych przez wiele lat badań, opracowano szereg
wymagań dotyczących składu chemicznego, struktury i właściwości
mechanicznych biomateriałów metalowych. Szczególnie istotnymi są
normy z serii PN-EN ISO 5832 (części 1‚3) – Implanty dla chirurgii
– Materiały metalowe, a także normy z serii PN-EN ISO 10993:1-18
– Biologiczna ocena wyrobów medycznych. Niestety nadal nie osiągnięto
zadawalającego poziomu biotolerancji implantów. Obecnie powszechnym
dążeniem jest poprawa biotolerancji materiałów metalowych poprzez
1
[email protected], Katedra Biomateriałów i Inżynierii Wyrobów
Medycznych, Wydział Inżynierii Biomedycznej, Politechnika Śląska, www.ib.polsl.pl
2
[email protected], Katedra Biomateriałów i Inżynierii Wyrobów Medycznych,
Wydział Inżynierii Biomedycznej, Politechnika Śląska, www.ib.polsl.pl
3
[email protected], Katedra Biomateriałów i Inżynierii Wyrobów Medycznych,
Wydział Inżynierii Biomedycznej, Politechnika Śląska, www.ib.polsl.pl
4
[email protected], Katedra Biomateriałów i Inżynierii Wyrobów Medycznych,
Wydział Inżynierii Biomedycznej, Politechnika Śląska, www.ib.polsl.pl
344
Ocena wpływu biodegradowalnej warstwy polimerowej (PLGA)
na korozję podłoża ze stopów tytanu
modyfikowanie ich warstwy wierzchniej [4, 5]. Głównymi celami stosowania różnych metod modyfikacji warstwy wierzchniej implantów
metalowych są: poprawa własności implantów w środowisku płynów
fizjologicznych człowieka, w tym osiągnięcie lepszej biokompatybilności
poprzez poprawę ich odporności korozyjnej i ograniczenie ilości
produktów degradacji. Celem modyfikacji jest obniżenie kinetyki degradacji, a także wytworzenie warstwy wydzielającej substancje lecznicze do
tkanek okołowszczepowych. Jakości warstw powierzchniowych nakładanych
na biomateriały metalowe poświęcono wiele prac, jednakże wciąż prowadzone są badania mające na celu wyłonienie najlepszej. Wyróżnić można
wiele metod obróbki powierzchniowej implantów metalowych, m.in [5]:
 polerowanie elektrolityczne;
 pasywacja;
 nanoszenie powłok metodami CVD oraz PVD;
 nanoszenie powłok węglowe typu DLC oraz NCD;
 implantacja jonów;
 napylanie plazmowe;
 utlenianie anodowe;
 powłoki nanoszone metodą zol-żel;
 nanoszenie powłok polimerowych.
Wybrana metoda obróbki powierzchniowej jest bezpośrednio zależna od
modyfikowanego materiału oraz przeznaczenia docelowej formy implantu.
Niemniej jednak najczęściej, na powierzchni biomateriału, ze szczególnym
uwzględnieniem jego cech geometrycznych, wytwarza się warstwy pasywne.
Warstwy te nie są doskonałe, ponieważ pod wpływem działania płynów
ustrojowych w organizmie człowieka oraz czynników mechanicznym ulegają
uszkodzeniu. Na skutek zniszczenia warstwy pasywnej dochodzi do procesów
korozyjnych w wyniku których przenikające do tkanek okołowszczepowych
produkty degradacji biomateriału metalowego mogą wywoływać reakcje
zapalne, alergiczne, cytotoksyczne bądź po prostu efekt drażnienia tkanek [1].
Aby zapewnić dobre właściwości mechaniczne implantów oraz ograniczyć ich
negatywny wpływ na organizm ludzki niezbędne okazało się stosowanie
różnego rodzaju powłok ograniczających proces metalozy z jednoczesnym
neutralizowaniem reakcji układu immunologicznego pomiędzy tkanką a
implantem. Jedną z nowoczesnych metod jest nanoszenie powłok
biopolimerowych na odpowiednio przygotowane podłoże metaliczne.
Przeprowadzono próby poprawy biozgodności implantów metalowych
poprzez zastosowanie biodegradowalnych warstw polimerowych na bazie
poliestrów alifatycznych [6]. Naniesienie na powierzchnię implantu
metalowego powłoki polimerowej zabezpiecza organizm przed produktami
345
Magdalena Grygiel-Pradelok, Janusz Szewczenko, Wojciech Kajzer, Magdalena Antonowicz
degradacji implantu metalowego, a także może dodatkowo przyśpieszyć
regenerację tkanek poprzez kontrolowane uwalnianie leku [7].
W chirurgii kostnej, poza stalą austenityczną, wykorzystywane są
również stopy tytanu. Jednym z najczęściej używanych stopów tytanu jest
stop Ti6Al4V ELI, który wykazuje się dobrym zespołem własności
mechanicznych, sprzyjających uzyskaniu szybkiej osteointegracji. Niestety
stop ten posiada toksyczne pierwiastki glinu i wanadu, które mogą
uwalniać się do organizmu. Badania nad biomateriałami doprowadziły do
powstania stopu Ti6Al7Nb [1]. Pomimo dobrych właściwości stopów
tytanu – dobra odporność na korozję – nadal trwają prace nad modyfikacją
powierzchni tych stopów, w celu polepszenia ich własności mechanicznych,
chemicznych i biologicznych [8-10]. Jest to spowodowane zwiększającą się
liczbą pacjentów, u których wystąpiły reakcje na produkty ich degradacji,
w tym Ti i Al. Dużą uwagę w ostatnich latach przyciągnęły polimery
biodegradowalne, które dzięki wchłanialności przez organizm mogą być
stosowane w medycynie.
W celu zmiany właściwości oraz zapobieganiu korozji możliwe jest
naniesienie na powierzchnię stopu tytanu powłoki ochronnej, czyli powłoki z
polimeru biodegradowalnego. Naniesiona na powierzchnię stopów warstwa
ma za zadanie podwyższenie odporności na korozję, zwiększenie
biokompatybilności lub też uwalnianie leków do otaczających implant tkanek.
Dla implantów o złożonej budowie lub skomplikowanej geometrii, małych
części lub wyrobów o małej grubości nanoszenie warstwy polimerowej
najczęściej następuje z wykorzystaniem metody zanurzeniowej. Metodę tę
cechuje przede wszystkim prostota i łatwość wykonania [12].
Polimery biodegradowalne w większości zbudowane są z biokompatybilnych monomerów L-laktydu, glikolidu, p-dioksanonu i kaprolaktonu
[11]. Poli(L-laktyd-ko-gliokolid) jest jednym z najczęściej stosowanych
polimerów biodegradowalnych na powierzchnię metalowego implantu.
Determinuje to powszechna dostępność tego alifatycznego poliestru
w handlu, który dodatkowo zatwierdzony jest przez FDA. PLGA jest
syntetyzowany z kopolimeryzacji z otwarciem pierścieni dwóch
monomerów: kwasu glikolowego i kwasu mlekowego. Typowymi
katalizatorami tej reakcji są: cyna (II) i etyloheksan cyny (II), alkoholany
lub izopropanol [13]. Jednakże, należy zauważyć, że dostępny w handlu
poliester powszechnie syntetyzuje się stosując związki cynowe jako
inicjatory – zazwyczaj Sn(oct)2, który może być toksyczny [14].
346
Ocena wpływu biodegradowalnej warstwy polimerowej (PLGA)
na korozję podłoża ze stopów tytanu
2. Cel pracy
Celem przeprowadzonych badań było określenie wpływu naniesionej
warstwy biodegradowalnego polimeru PLGA na proces degradacji
biomateriału metalowego (stopów tytanu). W pracy przedstawiono wyniki
badań wpływu środowiska korozyjnego (roztworu Ringera) na proces
korozji implantów metalowych pokrytych warstwą poli(D,L-laktyd-koglikolidu). Na podstawie przeprowadzonej analizy danych literaturowych
można stwierdzić, że dotychczas nie analizowano tego typu zagadnienia.
Ocenie poddano powierzchnię implantów, odporność korozyjną
metalowego podłoża po długotrwałej ekspozycji na środowisko korozyjne
oraz gęstość jonów metali przenikających do roztworu.
3. Materiał i metodyka badań
Materiał: Do badań wytypowano próbki ze stopu tytanu Ti6Al4V ELI
oraz Ti6Al7Nb o składzie chemicznym, strukturze i własnościach mechanicznych zgodnych odpowiednio z normami ASTM F 136-08e1 oraz ISO
5832-11. Skład chemiczny badanych stopów przedstawiono w tabeli 1.
Tabela 1. Skład chemiczny stopów tytanu: Ti6Al4V ELI i Ti6Al7Nb
Stop
tytanu
Stężenie pierwiastków, %
N
C
H
Fe
O
Al
V
Nb
Ta
Ti
Ti6Al4V
ELI
max.
0,05
max.
0,08
max.
0,012
max.
0,25
max.
0,13
5,56,5
3,54,5
-
-
reszta
Ti6Al7Nb
max.
0,05
max.
0,08
max.
0,009
max.
0,25
max.
0,20
5,56,5
-
6,57,5
max.
0,5
reszta
Źródło: Normy ASTM F 136-08e1 oraz ISO 5832-11
Próbki pobrano z prętów o średnicy 6 mm. Przed nałożeniem polimeru,
powierzchnię stopów tytanu poddano szlifowaniu na papierach o gradacji:
120, 320 i 600 oraz utlenianiu anodowemu, w kąpieli zawierającej kwas
fosforowy i siarkowy, przy napięciu U = 97 V i czasie t = 2 min. Następnie
przy współpracy z Centrum Materiałów Polimerowych i Węglowych PAN
w Zabrzu naniesiono warstwę PLGA, metodą zanurzeniową. Próbki zostały
zanurzone w roztworze PLGA i dichlorometanu, na czas 30 sekund (w celu
usunięcia nieprzereagowanych monomerów, zanieczyszczenia wytrącono
z wykorzy-staniem alkoholu metylowego [15]), a następnie materiał
osuszono pod ciśnieniem, do czasu odparowania rozpuszczalnika.
347
Magdalena Grygiel-Pradelok, Janusz Szewczenko, Wojciech Kajzer, Magdalena Antonowicz
Część próbek została poddana ekspozycji w roztworze Ringera,
o składzie przedstawionym w tabeli 2, przez okres 90 dni, w temperaturze
T = 37 ± 1 oC.
Tabela 2. Skład chemiczny roztworu Ringera
Związek
Chlorek sodu (NaCl)
Chlorek wapnia (KCl)
Chlorek wapnia dwuwodny (CaCl2*2H2O)
Zawartość
8,60 g/dm3
0,30 g/dm3
0,33 g/dm3
Źródło: firma B. Braun Melsungen AG
Dla każdej próbki przeprowadzono: obserwacje mikroskopowe, badania
potencjodynamiczne oraz zbadano przenikalność jonów do roztworu.
Obserwacje makroskopowe: W celu określenia zmian zachodzących na
powierzchni implantów metalowych, dokonano obserwacji makroskopowych. Obserwacje makroskopowe przeprowadzono dla próbek przed
procesem degradacji (w stanie wyjściowym), jak i po badaniach korozyjnych. Oględziny powierzchni próbek wykonano na mikroskopie stereoskopowym firmy ZEISS – SteREO Discovery V.8 z oprogramowaniem
AxioVisionAxio-CamERc. Badanie przeprowadzono w zakresie powiększenia od 3x do 24x.
Badania potencjodynamiczne: W celu określenia wpływu powłoki
polimerowej na odporność korozyjną metalu, przeprowadzono dla próbek
ze stopów tytanu badania potencjodynamiczne. Badania odporności na
korozję wżerową przeprowadzono zgodnie z normą PN-EN ISO 10993-15,
w roztworze Ringera (T = 37 ± 1 oC, pH = 6,8 ± 0,2), dla próbek po
90-dniowej ekspozycji na środowisko korozyjne. Do badań wykorzystano
potencjostat PGP-201 firmy Radiometer Analytical SAS. Elektrodą
odniesienia była nasycona elektroda kalomelowa NEK typu KP-113,
natomiast elektrodą pomocniczą − drut platynowy PtP-201.
W ramach badań potencjodynamicznych zarejestrowane zostały krzywe
polaryzacji anodowej. Badania rozpoczęto od wyznaczenia potencjału
otwarcia EOCP przez okres 2 godzin. Potencjał początkowy od którego
rejestrowano krzywe polaryzacji anodowej wynosił EINIT = – 100 mV,
a szybkość zmian potencjału wynosiła 3 mV/s. Krzywe rejestrowano do
momentu uzyskania gęstości prądu równej 1 mA/cm2 lub do momentu
osiągnięcia maksymalnej wartości zakresu pomiarowego +4094 mV,
następnie zmieniano kierunek polaryzacji i rejestrowano krzywą powrotną
[9]. Do wyznaczania wartości charakteryzujących odporność korozyjną
badanych próbek zastosowano metodę Sterna. Wyznaczono wielkości
potencjału korozyjnego Ekor oraz oporu polaryzacyjnego Rp.
348
Ocena wpływu biodegradowalnej warstwy polimerowej (PLGA)
na korozję podłoża ze stopów tytanu
Gęstość jonów metali przenikających do roztworu: W celu dokonania
oceny szczelności nałożonej warstwy powierzchniowej z poli (D,L-laktydko-glikolidu) na powierzchnie stopów tytanu, przeprowadzono badania
stężenia jonów metalowych, które przeniknęły do roztworu. Każdą
z próbek w okresie 90 dni, zanurzono w 100 ml roztworu fizjologicznego
Ringera. Ilość jonów przenikających do roztworu zmierzono za pomocą
spektrometru JY 2000, firmy Yobin – Yvon, wykorzystujące metodę emisyjnej spektrometrii atomowej z plazmą wzbudzoną indukcyjnie (ICP-AES).
Przy sporządzaniu krzywej wzorcowej wykorzystano rozcieńczone
materiały wzorcowe firmy Merck. Oznaczono ilość stężenia jonów: Ti, Al,
V, Nb. Stężenie jonów metalu przeliczono na masę pierwiastka
przenikającego z jednostkowej powierzchni próbki (µg/cm2).
4. Analiza wyników
Obserwacje makroskopowe: Na podstawie obserwacji makroskopowych
próbek (w stanie wyjściowym) zaobserwowano: nierówności, nieciągłości
oraz a)zróżnicowaną topografię warstwy polimerowej. Zauważalna jest
również niejednorodność powłoki polimerowej oraz zniekształcenia
powierzchni polimeru. Stwierdzono również występowanie nielicznych
pęcherzyków powietrza. Zaobserwowane defekty występują w postaci
miejscowych zacieków, wskutek zastosowania metody zanurzeniowej oraz
spowodowane są także sposobem przechowywania próbek. Zauważono
także uszkodzenia mechaniczne powierzchni metalowej powstałe przed
nałożeniem PLGA, powstałe podczas wstępnej obróbki powierzchniowej.
Wyniki obserwacji makroskopowych przedstawiono na rysunkach 1 i 2.
Zróżnicowane zabarwienie badanego materiału jest wynikiem procesu
utleniania anodowego. Zróżnicowana grubość warstwy polimeru PLGA
naniesionego na próbki jest efektem niedoskonałości metody zanurzeniowej Największą grubość warstwy polimerowej obserwowano na
brzegach próbki.
349
Magdalena Grygiel-Pradelok, Janusz Szewczenko, Wojciech Kajzer, Magdalena Antonowicz
Rysunek 1. Makroskopowy obraz próbki ze stopu Ti6Al7Nb, szlifowanej i utlenianej anodowo
a) obraz próbki, b) widoczne zarysowanie metalowego podłoża, c) niejednorodność w warstwie
polimeru, zacieki d) obraz makroskopowy próbki przy krawędzi, widoczny ślad po uchwycie
podczas procesu utleniania anodowego
Rysunek 2. Wyniki obserwacji makroskopowej próbek po nałożeniu warstwy polimeru,
a) widoczny pęcherz powietrza – materiał: Ti6Al4V ELI, b) zarysowania powierzchni
– stop Ti6Al7Nb
350
Ocena wpływu biodegradowalnej warstwy polimerowej (PLGA)
na korozję podłoża ze stopów tytanu
Dokonując porównania powierzchni podłoża metalowego zauważono,
że powierzchnia próbek ze stopu Ti6Al7Nb charakteryzowała się większą
ilością uszkodzeń mechanicznych na powierzchni materiału bazowego
w porównaniu do próbek z Ti6Al4V ELI.
Powierzchnia próbek po długotrwałej ekspozycji na środowisko korozyjne
wykazała wzrost, względem stanu wyjściowego, liczby uszkodzeń warstwy
PLGA niezależnie od rodzaju podłoża. Wyniki obserwacji makroskopowych
powierzchni próbek po ekspozycji w płynie fizjologicznym przedstawiono na
rysunku 3.
Rysunek 3. Powierzchni próbek metalowych z powłoką polimerową po 90-dniowej ekspozycji
na środowisko korozyjne i badania potencjodynamiczne, a) roztworzenie warstwy na końcu
próbki – Ti6Al4V ELI, b) przebarwienia – Ti6Al4V ELI, c) roztworzenie warstwy polimerowej
na końcu próbki – Ti6Al7Nb, d) powierzchnia po ekspozycji – Ti6Al7Nb
Długotrwała ekspozycja próbek w środowisku korozyjnym spowodowała
częściowe przebarwienie i zmatowienie powłoki polimerowej, co wskazuje na
zachodzące zmiany w warstwie polimerowej. Zaobserwowano również
zwiększenie nieciągłości powłoki polimerowej, nie zaobserwowano natomiast
na powierzchni zmian korozyjnych, co świadczy o dobrych właściwościach
ochronnych powłoki PLGA.
Badania potencjodynamiczne: Przeprowadzone badania potencjodynamiczne wykazały odporność na korozję wżerową stopów tytanu
351
Magdalena Grygiel-Pradelok, Janusz Szewczenko, Wojciech Kajzer, Magdalena Antonowicz
z powłoką polimerową. Zaobserowano również zróżnicowaną wartość
parametrów dla próbek o powierzchni poddanej procesowi szlifowania
i utleniania anodowego oraz z nałożoną warstwą biodegradowalnego polimeru
PLGA. Zarejestrowane, charakterystyczne krzywe polaryzacji próbek ze
stopów Ti6Al4V ELI oraz Ti6Al7Nb z warstwą polimeru przedstawiono na
rysunku 4. Na podstawie krzywych polaryzacji anodowej dla próbek Ti6Al4V
ELI, Ti6Al7Nb oraz dla próbek pokrytych warstwą polimerową, wyznaczone
wartości potencjału korozyjnego Ekor oraz oporu polaryzacyjnego Rp
przedstawiono w tabeli 3.
Rysunek 4. Typowe krzywe polaryzacji anodowej, 1) Ti6Al4V ELI + PLGA, 2)
Ti6Al7Nb + PLGA
Dla wszystkich badanych próbek ze stopów tytanu stwierdzono perfekcyjną pasywację w całym zakresie pomiarowym oraz nie stwierdzono
występowania pętli histerezy i potencjału przebicia, co wskazuje na brak
rozwoju korozji wżerowej na powierzchni badanego materiału. Zauważono
znaczy wzrost oporu polaryzacyjnego, niezależnie od materiału, dla próbek
pokrytych warstwą polimeru PLGA w stosunku do stanu wyjściowego, co
świadczy o lepszej ochronie metalowego podłoża przed korozją. Najwyższą
wartość potencjału korozyjnego uzyskano dla próbek Ti6Al4V – niepokrytych warstwą polimeru (Ekor=205 mV), natomiast najmniejszą
wartość uzyskano dla tego samego rodzaju stopu, z naniesioną warstwą
polimeru PLGA, (Ekor=-418 mV).
Tabela 3. Wyniki badań potencjodynamicznych dla stopów tytanu: Ti6Al4V ELI i Ti6Al7Nb
Ekor, mV
Rp, M cm2
Ti6Al4V ELI
Ti6Al4V ELI+PLGA
Ti6Al7Nb
+205(43)
+0,582(25)
-418(40)
+1,96(72)
+99(33)
+3,41(11)
352
Ti6Al7Nb
+PLGA
-393(31)
+4,10(27)
Ocena wpływu biodegradowalnej warstwy polimerowej (PLGA)
na korozję podłoża ze stopów tytanu
Długotrwała ekspozycja w środowisku korozyjnym nie zainicjowała
zmian korozyjnych na próbkach, co świadczy o dobrych właściwościach
ochronnych polimerowej warstwy PLGA.
Stężenie jonów metali przenikających do roztworu: Po 90-dniowym
okresie przetrzymywania próbek w roztworze Ringera określono stężenie
jonów metali przenikających do roztworu. Wyniki przenikalności jonów
przedstawiono w tabeli 4 oraz na rysunku 5. Badanie wykazało, że zarówno
dla próbek ze stopów tytanu, poddanych wyłącznie procesowi szlifowania
i ulteniania anodowego, jak i dla próbek pokrytych warstwą polimeru
PLGA, do roztworu przeniknęły jony metali. Jednakże, dla próbek
z warstwą polimeru ilość jonów przenikających do roztworu jest prawie 50krotnie mniejsza, w porównaniu z próbkami bez warswy PLGA.
Tabela 4. Wyniki gęstości masy jonów metali przenikających do roztworu, g/cm2
Ti6Al4V ELI
Ti
Al
V
Nb
45,68(18)
30,21(25)
23,73(21)
-
Ti6Al4V ELI
+PLGA
0,726(19)
0,400(28)
0,345(47)
-
Ti6Al7Nb
19,57(24)
2,49(36)
3,41(39)
Ti6Al7Nb
+PLGA
0,349(99)
0,251(19)
0,587(28)
Na podstawie otrzymanych wyników oceniono, iż pokrycie implantu
metalowego biodegradowalnym polimerem znacząco wpływa na ilość
jonów metalicznych przenikających do roztworu. Dla próbek z naniesioną
powłoką biodegradowalnego PLGA znakomicie została ograniczona
przenikalność jonów metali względem próbek bez warstwy
Rysunek 5. Wykres przedstawiający gęstość masy jonów metali przenikających do roztworu
Ringera od powierzchni próbek ze stopów Ti6Al4V ELI, Ti6Al7Nb oraz tych stopów pokrytych
warstwą PLGA
353
Magdalena Grygiel-Pradelok, Janusz Szewczenko, Wojciech Kajzer, Magdalena Antonowicz
5. Podsumowanie
Podsumowując, przeprowadzone badania jednoznacznie wykazały, że
naniesiona powłoka biodegradowalnego polimeru PLGA na podłoże
metalowe spowodowała znaczny wzrost odporności na korozję wżerową
stopów tytanu Ti6Al4V ELI i Ti6Al7Nb oraz znacząco obniżyła kinetykę
degradacji metalowego podłoża, wyznacznikiem czego było stężenie jonów
metali przenikających z metalowego podłoża do środowiska zewnętrznego,
symulującego środowisko organizmu ludzkiego.
Zastosowanie warstwy polimerowej powoduje polepszenie biotolerancji
badanych biomateriałów metalowych, tym samym pozwalając na bezpieczne i dłuższe wykorzystywanie implantów.
W dalszej kolejności planowane jest przeprowadzenie badania wpływu
warstwy polimerowej PLGA na odporność korozyjną stali Cr-Ni-Mo oraz
ocena własności mechanicznych biodegradowalnych warstw polimerowych
na biomateriałach metalowych. Planuje się również przeprowadzenie
badania degradacji polimeru.
Podziękowania
Autorzy pracy kierują podziękowania dla pracowników naukowych
Centrum Materiałów Polimerowych i Węglowych PAN w Zabrzu, dzięki
którym naniesiono polimerową powłokę biodegradowalnego PLGA.
Szczególne podziękowania kierujemy panią: dr Joannie Jaworskiej oraz
dr Katarzynie Jelonek za wsparcie merytoryczne.
Literatura
1.
2.
3.
4.
5.
6.
7.
Marciniak J., Biomateriały, Wydawnictwo Politechniki Śląskiej, 2013
Mahapatro A., Metals for Biomedical Applications and Devices, Journal
of Biomaterials and Tissue Engineering, 2012, 2(4), s. 259-268
Łaskawiec J., Michalik R., Zagadnienia teoretyczne i aplikacyjne
w implantach, Wydawnictwo Politechniki Śląskiej, 2002, s. 77-78
Biel M., Mikrostruktura i właściwości biomateriałów tytanowych po obróbce
powierzchniowej, praca doktorska, Akademia Górniczo-Hutnicza
im. S. Staszica w Krakowie, 2006
Szewczenko J., Basiaga M., Kiel-Jamrozik M., Kaczmarek M., Grygiel M.,
Corrosion Resistance of Ti6Al7Nb Alloy after Various Surface Modifications,
Solid State Phenomena, 2015 (227), s. 483-486
Argarate N., Olalde B., Atorrasagasti G., Valero J., Cifuentes S. C., Benavente
R., Lieblich M., Gonzales-Carrasco J. L., Biodegradable Bi-layered coating on
polymeric orthopaedic implants for controlled release of drugs, Materials
Letters, 2014 (132), s. 193-195
Astete C. E., Sabliov C. M., Synthesis and characterization of PLGA
nanoparticles, Journal of Biomaterials Science – Polymer Edition, 2009,
17(3), s. 247-289
354
Ocena wpływu biodegradowalnej warstwy polimerowej (PLGA)
na korozję podłoża ze stopów tytanu
8.
9.
10.
11.
12.
13.
14.
15.
Sena L. A., Rocha N. C. C., Andrade M. C., Soares G. A., Bioactivity
assessment of titanium sheets electrochemically coated with thick oxide film,
Surface and Coating Technology, Elsevier, 2003 (166), s. 254-258
Szewczenko J., Kształtowanie właściwości fizycznych i chemicznych warstwy
wierzchniej implantów ze stopu tytanu dla traumatologii i ortopedii,
Wydawnictwo Politechniki Śląskiej, 2014
Liu X., Chu P. K., Ding C., Surface modification of titanium, titanium alloys,
and related materials for biomedical applications, Materials Science and
Engineering, Elsevier, 2004, 47(3-4), s.49-121
Bartkowiak-Jowsa M., Będziński R., Chłopek J., Filipiak J., Szafraniec B.,
Comparative analysis of the deformation characteristics of biodegradable
polymers considered as a material for vascular stents, Polimery, 2011, 56 (3)
Balcerowska B., Ozgowicz W., Rydarowski H., Szota J., Tkaczyk S., Walczak
K., Powłoki ochronne, Politechnika Śląska, 1997
Zini E., Scandola M., Dobrzynski P., Kasperczyk. J, Bero M., Shape memory
behavior of novel (L-lactide-glycolide-trimethylene carbonate) terpolymers,
Biomacromolecules, 2008, 8(11), s. 3661-3667
Fang H., Li K., Su T., Yang T., Chang J., Lin P., Chang W., Dip coating
assisted polylactic acid deposition on steel surface: Film thickness affected by
drag force and gravity, Materials Letters, 2008 (62), s. 3739-3741
Strona internetowa BioMatPol sp. z o.o.
www.biomatpol.pl/pl/produkty/biocop/biocop-poli-laktydo-ko-glikolid, dostęp
z dnia 14.12.2015 r.
Ocena wpływu biodegradowalnej warstwy polimerowej (PLGA) na
korozję podłoża ze stopów tytanu
W pracy przedstawiono wyniki badań wpływu środowiska korozyjnego na proces degradacji
implantów metalowych pokrytych warstwą biodegradowalnego polimeru. Na podstawie przeprowadzonej analizy danych literaturowych można stwierdzić, że dotychczas nie analizowano tego
typu zagadnień. Oceniano odporność korozyjną metalowego podłoża po długotrwałej ekspozycji
na środowisko korozyjne oraz ilość produktów degradacji. Ponadto przeprowadzono obserwacje
makroskopowe powierzchni próbek.
Do badań wytypowano próbki ze stopu tytanu Ti6Al4V ELI oraz Ti6Al7Nb o składzie
chemicznym, strukturze i własnościach mechanicznych zgodnych odpowiednio z normami
ASTM F136-08e1 oraz ISO 5832-11. Próbki metalowe poddano obróbce wstępnej (szlifowaniu,
utlenianiu anodowemu), następnie naniesiono powłokę biodegradowalnego polimeru.
Zastosowano biodegradowalny poli(D,L-laktyd-ko-glikolid) składający się w 85%
z kwasu mlekowego i 15 % z kwasu glikolowego, o 20% stężeniu.
Badania odporności na korozję wżerową w roztworze Ringera wykonano metodą potencjodynamiczną. Badania przeprowadzono dla próbek po 90 – dniowej ekspozycji na środowisko
korozyjne. Ilość jonów przenikających do roztworu określano z wykorzystaniem metody emisji
atomowej z plazmą wzbudzoną indukcyjnie ICP-AES. Obserwacje makroskopowe próbek po
badaniach korozyjnych przeprowadzono z wykorzystaniem mikroskopu stereoskopowego.
Na podstawie obserwacji makroskopowych stwierdzono niejednorodność warstwy polimerowej
oraz uszkodzenia mechaniczne próbek powstałe przed nałożeniem PLGA. Powierzchnia próbek
po długotrwałej ekspozycji na środowisko korozyjne wykazała wzrost, względem stanu
wyjściowego, liczby uszkodzeń warstwy PLGA niezależnie od rodzaju podłoża. Naniesienie
warstw polimerowych na podłoże metalowe spowodowało wzrost odporności na korozję
wżerową oraz obniżenie kinetyki degradacji metalowego podłoża, wyznacznikiem czego było
355
Magdalena Grygiel-Pradelok, Janusz Szewczenko, Wojciech Kajzer, Magdalena Antonowicz
stężenie jonów metali przenikających z podłoża do środowiska zewnętrznego. Długotrwała
ekspozycja w środowisku korozyjnym nie zainicjowała zmian korozyjnych na próbkach, co
świadczy o dobrych właściwościach ochronnych polimerowej warstwy PLGA.
Podsumowując, stwierdzono, że warstwa polimeru PLGA wpływa na poprawę odporności
korozyjnej stopów tytanu Ti6Al4V ELI i Ti6Al7Nb oraz ogranicza przenikanie jonów metali do
roztworu symulującego środowisko organizmu ludzkiego. Zastosowanie warstwy polimerowej
powoduje poprawę biotolerancji badanych biomateriałów metalowych.
W dalszej kolejności zostaną przeprowadzone badania wpływu warstwy polimerowej na
odporność korozyjną stali CrNiMo oraz ocena własności mechanicznych biodegradowalnych
warstw polimerowych na biomateriałach metalowych. Planuje się również badania degradacji
polimeru.
Influence of biopolymer layer (PLGA) on degradation process of metal
substrate
The paper presents results of influence of a corrosive environment on degradation process of
metal implants coated with a biodegradable polymer layer. Based on analysis of literature data it
can be said that this type of issues has not been analysed. Metal ion concentration in solution and
corrosion resistance of metal substrate were evaluated after prolonged exposure to the corrosive
environment. In addition, a macroscopic observation of the samples surfaces were conducted.
Ti6Al4V ELI and Ti6Al7Nb titanium alloys samples were used in the tests. Their chemical
composition, structure and mechanical properties met the requirements of ASTM F136-08e1 and
ISO 5832-11 standards respectively. Prior to polymer coating the surfaces of titanium alloys were
ground and additionally subjected to anodic oxidation. Metal substrates were coated with
biodegradable layer of poly(D,L-lactide-co-glycolide) composed of 85% lactic acid and 15%
glycolic acid, at 20% concentration by the dip-coating method.
Resistance to pitting corrosion in the Ringer’s solution was tested by the potentiodynamic
method. Tests were conducted for samples after 90-day exposure to the corrosive environment.
Metal ion concentration in the solution was measured with use of inductively coupled plasma –
atomic emission spectrometry (ICP-AES). The surface observation of the samples before and
after corrosion study was analysed using stereoscopic microscope.
Based on the microscopic observations heterogeneity of the polymer layers and mechanical
damage of samples arose prior the PLGA application were observed. Surface samples after long
term exposure to the corrosive environment showed an increase (in relative to initial state)
number of PLGA’s layer damage independently from the type of metal substrate. The increase in
resistance to pitting corrosion and reduction of degradation kinetics were caused by application of
the polymeric layers on the metal substrate. This is confirmed by low concentration of metal ions
penetrating from substrate to the external environment. Long term exposure in the corrosive
environment did not initiate the changes of corrosion on samples, so this indicates good protective
properties of the PLGA polymer layer.
In conclusion, it was found that the polymer layer positively influences corrosion resistance of the
Ti6Al4V ELI and the Ti6Al7Nb alloys. Furthermore, the amount of metal ions released to the
solution simulating the environment of a human body was reduced. Application a polymer layer
improved biocompatibility of the studied biomaterials.
Subsequently, a study of influence of polymer layer on corrosion resistance of stainless steel will
be carried out. Evaluation of mechanical properties of biodegradable polymeric layers on metal
biomaterials will be performed as well. Studies of polymer degradation are also planned.
356
Adrian Dubicki1
Współcześnie stosowane metody przywrócenia
utraconych w wyniku schorzeń i uszkodzeń
funkcji miednicy
1. Wstęp
Ostatnimi laty możemy spotkać się z coraz częstszymi przypadkami
osób z problemami układu mięśniowo-szkieletowego, z anomaliami
struktury kostnej. Mogą być one wywołane poprzez zmiany
zwyrodnieniowe, onkologiczne czy też urazy. Nieustannie rosnące tempo
życia sprawia, że mamy coraz mniej czasu żeby zadbać o to co jest
najważniejsze - o nasze zdrowie. Pomimo wysyłanych przez organizm
sygnałów, wielu ludzi bagatelizuje problem i zgłasza się do lekarza już
z zaawansowanymi zaburzeniami. Medycyna w takich przypadkach
wypracowała szereg standardowych rozwiązań, lecz często rozległość
uszkodzeń nie pozwala na ich zastosowanie. W takich przypadkach coraz
częściej stosowanym rozwiązaniem są implanty indywidualne.
2. Cel pracy
Celem niniejszej pracy jest przedstawienie współcześnie stosowanych
metod leczenia, mających na celu przywrócenie utraconych funkcji
miednicy. Do każdej metody przypisane zostały schorzenia i uszkodzenia,
przy których jest ona najczęściej stosowana.
Szczególną uwagę poświęcono implantom indywidualnym, które są
często jedynym ratunkiem dla pacjentów z zaawansowanymi zmianami lub
uszkodzeniami.
3. Metody przywrócenia funkcji miednicy
We współczesnej medycynie możemy zaobserwować wypracowane na
przestrzeni lat liczne, standardowe procedury leczenia dysfunkcji miednicy.
Niestety w niektórych przypadkach, zaawansowanie zmian nie pozwala na
ich zastosowanie. Tacy pacjenci wymagają intensywnej, spersonalizowanej
terapii.
1
[email protected], Katedra Inżynierii Materiałowej i Biomedycznej, Wydział
Mechaniczny, Politechnika Białostocka, www.pb.edu.pl
357
Adrian Dubicki
Do standardowych, stosowanych w obrębie obręczy kończyny dolnej,
nieinwazyjnych
procedur
leczenia,
można
zaliczyć
leczenie
farmakologiczne, unieruchomienie opatrunkiem gipsowym lub wyciągiem
oraz rehabilitację. Każda z tych form kuracji stosowana jest w innych
przypadkach [1].
Leczenie farmakologiczne stosowane jest, wraz z odciążeniem chorej
kości, przy jałowej martwicy kości. Wykorzystywane niesteroidowe środki
przeciwzapalne pozwalają na złagodzenie bólu i zahamowanie
rozprzestrzeniania się stanu zapalnego. Niekiedy w przypadku tego
schorzenia podaje się również, zapobiegające obumieraniu tkanki kostnej
leki, stosowane przy leczeniu osteoporozy [2].
Farmakologiczne leczenie ma również miejsce w przypadku terapii
onkologicznych, wymagających często leczenia skojarzonego. W skład
takiej formy leczenia wchodzi radioterapia i chemioterapia oraz chirurgia.
Mają one na celu zniszczenie komórek nowotworowych poprzez ich
usunięcie (chirurgia), naświetlanie (radioterapia) oraz podanie leków
(chemioterapia). Obecnie lekami o najlepszej skuteczności są
bisfosfoniany, powodujące ograniczenie możliwości przerzutów komórek
oraz zahamowaniem ich rozrostu w ognisku choroby. Charakteryzują się
one dwutorowym działaniem - wbudowują się w kość, wzmacniając jej
strukturę oraz ograniczają namnażanie i rozprzestrzenianie komórek
kościogubnych. Skuteczność leczenia w przypadku choroby nowotworowej
jest mocno zależna od rodzaju nowotworu i jego zaawansowania [1, 3].
Jednym ze stosowanych unieruchomień kości są opatrunki gipsowe.
Obecnie wykorzystywane są coraz rzadziej, głównie przy rozejściu się
spojenia łonowego oraz złamaniach kości łonowej i kulszowej, gdy nie
wystąpią znaczne ich przemieszczenia i nie dojdzie do obrażeń narządów
wewnętrznych. W większości przypadków wystarczające jest odciążenie
miednicy poprzez leżenie pacjenta w łóżku lub stosowanie opasek
elastycznych. Ze względu na kształt jaki przybierają opatrunki gipsowe,
obejmując cały uszkodzony odcinek ciała, nazywane są one opatrunkami
okrężnymi. Niemal zawsze posiadają podściółkę z bandaży lub waty, aby
zminimalizować ryzyko wystąpienia podrażnień i otarć skóry [1].
Podczas zakładania opatrunku gipsowego, należy zawsze zwrócić
szczególną uwagę na odciążanie wypukłych fragmentów kostnych
(m.in. okolicy kości krzyżowej), a po jego zastosowaniu na możliwość
powstania obrzęków, zaburzeń krążenia i unerwienia, które wymagają
natychmiastowego jego usunięcia. Założony opatrunek unieruchamiający nie
powinien być też zbyt obcisły lub luźny, gdyż nie spełni wtedy swojej roli [1].
Do nastawienia odłamów kostnych i utrzymania ich w odpowiedniej
pozycji stosowane są również wyciągi. Dzieli się je na bezpośrednie
i pośrednie. Bezpośrednie mocowane są do metalowych elementów
358
Współcześnie stosowane metody przywrócenia utraconych
w wyniku schorzeń i uszkodzeń funkcji miednicy
wprowadzanych, wkręcanych w kość, a pośrednie zewnętrznie, do skóry
przy pomocy klejów lub z wykorzystaniem pętli czy specjalnego obuwia [1].
W leczeniu, a dokładniej osiągnięciu optymalnego poziomu
funkcjonowania fizycznego i zmniejszenia dolegliwości, często stosowana
jest rehabilitacja. Dzieli się ją na opartą o wykonywanie ćwiczeń
kinezyterapię oraz na wykorzystującą czynniki fizykalne fizykoterapię.
Głównym celem jest przywrócenie w jak największym zakresie sprawności
fizycznej, ale i psychicznej sprzed choroby. Metody fizykalne pomagają
ponadto w uśmierzeniu towarzyszących chorobom kostnym silnych bóli,
w zmniejszeniu odczynów zapalnych oraz zniwelowaniu napięcia mięśni [1].
Przedstawione powyżej metody stosowane są w łagodnych, nie
zaawansowanych dysfunkcjach miednicy. Bardziej złożone, zaawansowane
zmiany chorobowe, czy urazy wieloodłamowe wymagają bardziej
skomplikowanego, często chirurgicznego leczenia. Konieczne może się
okazać zastosowanie implantów kostnych (płytek, wkrętów kostnych,
gwoździ śródszpikowych) lub endoprotez. Najcięższe przypadki mogą
wymagać opracowania spersonalizowanych wszczepów, wykonywanych
pod konkretnego pacjenta. Dostępne rozwiązania dotyczące wszczepianych
podczas zabiegów chirurgicznych implantów zostały przedstawione
w poniższych podrozdziałach.
3.1. Osteosynteza złamań kości
Jedną z operacyjnych metod zespolenia złamań kości jest osteosynteza.
Jest to proces zespolenia kości we właściwym ustawieniu, podczas zabiegu
chirurgicznego, z użyciem metalowych implantów dokostnych (np. płytek,
wkrętów, klamer, gwoździ), wykonanych z niewywołujących po ich
wprowadzeniu do organizmu niekorzystnych reakcji (m.in. stanów
zapalnych) materiałów biozgodnych [4].
Początkowe próby stosowania osteosyntezy polegały na operacyjnym
nastawieniu kości i ich zespoleniu przy użyciu drutów i gwoździ, co nie
było dobrym mechanicznie rozwiązaniem. Współczesne rozwiązania
zostały zaprojektowane przez szwajcarską organizację Arbeitsgemeinschaft
für Osteosynthesefragen (A-O), która nadal nadzoruje ich rozwój.
Osteosynteza często jest nazywana zespoleniem A-O, od nazwy
wspomnianej organizacji. Stabilizujące implanty dokostne pozwalają na
leczenie złamania, bez konieczności stosowania unieruchomień
zewnętrznych (np. gipsowych). Umożliwia to rozpoczęcie wczesnej
rehabilitacji ruchowej [1].
Bezwzględnym wskazaniem do stosowania operacyjnego zespolenia
kości są złamania otwarte i nienastawialne lub niezdolne do utrzymania
nastawienia odłamów oraz powodujące uszkodzenie tkanek i narządów
359
Adrian Dubicki
wewnętrznych. Rozwój chirurgii i anestezjologii spowodował że
operacyjną stabilizację stosuje się także w przypadkach złamań:
- możliwych do nastawienia, z zagrożeniem przemieszczenia odłamów,
- przez stawowych z przemieszczeniami odłamów,
- wielomiejscowych, wieloodłamowych (zdruzgotania kości).
Takie typy uszkodzeń kości wymagają dokładnego nastawienia oraz
wczesnego podjęcia procesu rehabilitacji, co pomimo ryzyka zakażenia
sprawia, że osteosynteza jest w tych przypadkach chętnie stosowana [1, 5].
Podczas operacyjnego zabiegu osteosyntezy należy spełnić następujące
warunki:
- prawidłowe, anatomiczne nastawienie odłamów,
- stabilne zespolenie, bez ruchomości odłamów,
- obciążenia przenoszone przez odłamy, nie przez implanty stabilizujące,
- zachowanie stabilności zespolenia do czasu zrostu kości.
Przedstawione warunki są bardzo ważne, niezbędne dla prawidłowości
przeprowadzanej terapii osteosyntezy, skutkującej otrzymaniem
prawidłowego i wytrzymałego zrostu kostnego [1].
W zależności od tego czy elementy wchodzące w skład stabilizatora
znajdują się w trakcie terapii wewnątrz organizmu czy na zewnątrz,
dokonuje się podziału na osteosyntezę stabilną wewnętrzną oraz
osteosyntezę zewnętrzną [1].
3.1.1. Osteosynteza stabilna wewnętrzna
W zależności od elementu pełniącego funkcję stabilizatora, osteosyntezę
stabilną wewnętrzną dzieli się na zespolenia za pomocą śrub (dociskowe),
płytek (osiowe) lub gwoździ śródszpikowych. Wszystkie odpowiadające
sobie implanty ortopedyczne, niezależnie od firm je produkujących,
charakteryzują się podobną budową, a różnią się tylko drobnymi
szczegółami. Większe różnice można zaobserwować w konstrukcji
dostarczanego instrumentarium, chociaż narzędzia te wykorzystywane są
do tych samych celów [1, 6].
360
Współcześnie stosowane metody przywrócenia utraconych
w wyniku schorzeń i uszkodzeń funkcji miednicy
Rysunek 1. Stabilizacja przy użyciu płytek i długich wkrętów kaniulowanych [6]
Większość przypadków złamań miednicy wymaga zastosowania
zarówno śrub jak i płytek stabilizujących. Czasami zdarza się, że do
zespolenia mogą być wykorzystane tylko śruby, głównie krótkie. Takie
rozwiązanie stosowane jest przy nieskomplikowanych złamaniach,
w których wystarczające jest przeważnie unieruchomienie, ale przy okazji
operacyjnej stabilizacji poważniejszych dysfunkcji, dokonuje się również
utwierdzenia takiego odłamu. Długie, dodatkowo kaniulowane (wydrążone
na całej długości w celu zastosowania prowadnic z drutu Kirschner’a)
śruby mogą być samodzielnie stosowane do złamań kości krzyżowej.
W pozostałych przypadkach wykorzystuje się je również w połączeniu
z płytkami (rys. 1) [7].
Płytki do osteosyntezy stabilnej miednicy (rys. 2) występują w różnych
rozmiarach, kształtach i konfiguracjach rozmieszczenia otworów.
Projektowane są w taki sposób, aby możliwe było ich zastosowanie
w złamaniach występujących w każdym rejonie miednicy [6, 7, 8].
Rysunek 2. Zestawy płytek do stabilizacji wewnętrznej kości miednicy (A - Stryker, B - DePuy
Synthes) [6 ,7]
361
Adrian Dubicki
We współpracy z lekarzami, firmy ortopedyczne produkują płytki
i wkręty tak, aby zapewnić ich odpowiedni kształt oraz możliwość jego
zmiany w trakcie zabiegu (rys. 3). Wykonane implanty muszą również
charakteryzować się odpowiednią wytrzymałością, odpowiednim przeniesieniem sił oraz biozgodnością [7].
Rysunek 3. Dostosowanie kształtu płytki przy użyciu wyginaka wielopłaszczyznowego [8]
Wgłębienia występujące pomiędzy otworami sprawiają że płytki mają
mniejszą masę, ale przede wszystkim pozwalają na ich płynne
wyprofilowanie. Gdyby nie stosowano tego rozwiązania, płytka podczas jej
profilowania zginałaby się w miejscu otworu.
Większość oferowanych płytek posiada wewnątrz otworu
nagwintowaną powierzchnię. Pozwala to, w połączeniu ze specjalnym
wkrętem kostnym, na zablokowanie płytki w wybranym położeniu. Płytki
takie nazywane są blokowanymi (rys. 4) [8]. Pierwszy raz takie
rozwiązanie zastosowano w polskich systemach Zespol i Polfix. Pozwalają
one na zablokowanie położenia płytki np. nad kością, dzięki czemu nie
występuje bezpośredni nacisk na nią i nie dochodzi do uszkodzeń okostnej.
Dodatkowo umożliwiają one wprowadzanie wkrętów do kości pod kątem
nawet 35o [1].
362
Współcześnie stosowane metody przywrócenia utraconych
w wyniku schorzeń i uszkodzeń funkcji miednicy
Rysunek 4. Płytki blokowane do osteosyntezy Stryker (A - możliwość wprowadzania wkrętów do
kości pod kątem, B - gwintowany otwór, umożliwiający blokowanie położenia płytki) [7]
W przypadku stosowania płytek blokowanych należy unikać
nadmiernego wyginania i deformowania otworów. Znaczne zniekształcenie
może prowadzić do uszkodzenia gwintu w otworze i utraty możliwości
blokowania płytki [8].
Jednym z rodzajów osteosyntezy stabilnej wewnętrznej jest zespolenie
śródszpikowe. Polega ono na rozwierceniu jamy szpikowej i wprowadzeniu
gwoździ o odpowiedniej średnicy lub bezpośrednim (bez rozwiercania)
umieszczeniu w jamie prętów, np. Endera. Zespolenie śródszpikowe
stosowane jest do leczenia złamań kości długich. W stabilizacji kości
miednicy ta metoda nie znalazła jednak zastosowania [1, 5].
3.1.2. Osteosynteza zewnętrzna
Osteosynteza zewnętrzna jest metodą pozwalającą na działanie poza
ogniskiem złamania. Przyczynia się do zmniejszenia ryzyka powstania
powikłań biologicznych w przypadkach, w których interwencja chirurgiczna
w miejscu urazu może pogłębić istniejące zaburzenie. Zakładany ponad
skórą aparat, pozwala uniknąć wprowadzania elementów metalowych
w miejsce złamania, co mogłoby przyczynić się do powstania kolejnych
uszkodzeń, powstania odczynu zapalnego czy alergicznego [1, 5].
Pierwsza koncepcja tego typu stabilizacji miednicy pojawiła się w 1897
roku, a jej autorem był Clayton Parkhill. Przez lata była ona modyfikowana, aż w 1950 roku została po raz pierwszy zastosowana przez
Pennalla i Sutherlanda. Na przestrzeni lat stwierdzono, że zastosowanie
stabilizacji zewnętrznej przyczynia się do zmniejszenia liczby przypadków
śmiertelnych u osób po urazach miednicy. Zmniejszyła się również liczba
krwi potrzebna do transfuzji podczas operacyjnego nastawiania i unieruchamiania złamania [9].
363
Adrian Dubicki
Osteosynteza zewnętrzna może być wykorzystana w różnych fazach
leczenia chorych ze złamaniami miednicy. Stosowana może być na etapach:
- postepowania resuscytacyjnego (do kontroli krwawienia),
- tymczasowej stabilizacji złamań (umożliwiająca transport chorego),
- pierwotnej lub ostatecznej stabilizacji dla niektórych typów złamań.
Przeciwskazaniem do stosowania metody jest rozwinięta choroba
osteoporotyczna lub ryzyko uszkodzenia czy demontażu stabilizatora przez
pacjenta. Wykorzystaniu stabilizatorów zewnętrznych mogą towarzyszyć
problemy związane z utratą repozycji, odpowiedniego nastawienia kości
i utrzymaniem stabilizatora w odpowiednim położeniu przez kilka,
kilkanaście tygodni oraz powstające miejscowe infekcje wokół wszczepów
i powikłania ogólnoustrojowe [9].
Do stabilizacji miednicy mogą być wykorzystane aparaty
jednopłaszczyznowe lub dwupłaszczyznowe. Zbudowane są najczęściej
z głowic, które są miejscem łączenia stabilizator-kość (za pomocą wkrętów
kostnych, bądź drutów Kirschner’a) oraz elementów nośnych, które
przenoszą obciążenia między odłamami kostnymi (belki, pierścienie). Taka
budowa pozwala na dowolną konfigurację aparatu stabilizującego [1, 5].
Rysunek 5. Przykłady stabilizatorów zewnętrznych wykorzystywanych do osteosyntezy
miednicy (A - ChM, B - Stryker, C - DePuy Synthes) [6, 7, 10]
Większość firmy produkujących implanty, posiada w swojej ofercie
aparaty do stabilizacji zewnętrznej. Wykorzystują one możliwość modułowej
budowy takich stabilizatorów, projektując aparaty z możliwością ich
regulacji i dostosowania do rodzaju i miejsca lokalizacji złamania. Na
powyższym rysunku 5 przedstawiono przykładowe stabilizatory zewnętrzne
firmy ChM, Stryker i DePuy Synthes [6, 7, 10].
Stabilizatory zewnętrzne mogą być stosowane w przypadkach
przerwania ciągłości spojenia łonowego i stawu biodrowo-krzyżowego oraz
złamań kości kulszowej i łonowej. Odpowiednio przestrzennie zbudowana
konstrukcja stabilizatora i wprowadzone do kości wszczepy, pozwalają na
364
Współcześnie stosowane metody przywrócenia utraconych
w wyniku schorzeń i uszkodzeń funkcji miednicy
ustabilizowanie złamania oraz wczesną jego dynamizację poprzez
umożliwienie pacjentowi poruszania się [10].
3.2. Endoprotezoplastyka
Jednym z najczęściej wykonywanych zabiegów ortopedycznych jest
endoprotezoplastyka stawu biodrowego, nazywana również alloplastyką.
Zabieg ten polega na przywróceniu uszkodzonemu stawowi utraconych
czynności, poprzez wprowadzenie do organizmu elementów obcych,
tworzących zamiennik zdegradowanych powierzchni stawowych.
Wszystkie elementy wchodzące w skład endoprotez, muszą być
wykonywane z materiałów biozgodnych, takich jak metale i ich stopy,
tworzywa sztuczne czy ceramika [11].
Koncepcja endoprotez stawu biodrowego została opracowana ok. 1890
roku przez niemieckiego lekarza, polskiego pochodzenia – Themistoklesa
Glucka. Pierwsze wszczepiane przez niego protezy wykonywane były
z kości słoniowej. Do lat pięćdziesiątych XX wieku, czyli do czasu kiedy to
rozpoczęto próby stosowania materiałów konstrukcyjnych, przeprowadzano próby używania w endoprotezoplastyce materiałów takich jak
szkło, żywice fenolowe, a nawet kauczuk. Dopiero rozwój inżynierii
biomedycznej spowodował wypracowanie materiałów stosowanych
(z modyfikacjami) do czasów współczesnych. Do takich materiałów należą:
- stal nierdzewna (316L),
- stop CoCrMo (Vitalium (obróbka plastyczna), Endocast (odlewniczy)),
- stop tytanu (Ti6Al4V),
- ceramiki (ZrO2, Al2O3),
- tworzywa sztuczne (polimetakrylan metylu (PMMA), polietylen
(PE-UHMW, HDPE).
Oprócz posiadania wymaganej biozgodności, pozwalają one na
otrzymanie odpowiednich właściwości tribologicznych (elementy trące
endoprotez wymagają zastosowania materiałów zapewniających zarówno
niski współczynnik tarcia, jak też wysoką odporność na zużycie, co jest
przedmiotem badań i analiz tribologii) [12].
Głównym celem zabiegu alloplastyki jest zniesienie przewlekle
trwającego bólu stawu oraz przywrócenie jego prawidłowych funkcji. Do
schorzeń, które mogą doprowadzić do konieczności wykonania
endoprotezoplastyki należą:
- choroby zwyrodnieniowe stawu biodrowego,
- choroby reumatyczne,
- skomplikowane i powikłane złamania miednicy i kości udowej
(bliższy koniec),
- martwice w obrębie miednicy i głowy kości udowej,
365
Adrian Dubicki
- nowotwory kości.
Pierwszym etapem leczenia może być zastosowanie metod
farmaceutycznych, rehabilitacji i ćwiczeń oraz stosowanie sprzętu
pomocniczego. Jeżeli te zabiegi nie przyniosą rezultatów, przeprowadza się
alloplastykę stawu [13, 14].
Od czasów powstania pierwszych endoprotez, zostały wypracowane
dziesiątki rozmaitych rozwiązań, różniących się budową, materiałem i
sposobem mocowania. Obecnie stosowane endoprotezy można podzielić ze
względu na:
- zasięg implantacji:
- endoprotezy połowiczne (częściowe),
- endoprotezy całkowite:
- endoprotezy trzpieniowe,
- endoprotezy do kapoplastyki;
- konstrukcje panewki:
- endoprotezy z panewką jednolitą,
- endoprotezy z panewką modułową;
- konstrukcje trzpienia:
- endoprotezy jednolite (stałe połączenie głowa-trzpień),
- endoprotezy dzielone (głowa z trzpieniem połączona na wcisk);
- mocowanie w kośćcu:
- endoprotezy cementowe,
- endoprotezy bezcementowe.
Stosowanie danego rodzaju endoprotez jest uzależnione od wielu
czynników. Podstawowym jest rodzaj schorzenia, ale wpływ ma również
wiek chorego czy poziom jego aktywności fizycznej [11, 14].
Endoprotezy całkowite, są najczęściej stosowanymi rodzajami
implantów stawowych. Podczas zabiegu endoprotezoplastyki wymianie
podlegają zarówno panewka, jak i głowa kości udowej. W skład takich
implantów wchodzi trzpień z głową stałą lub nakładaną oraz panewka
jednolita lub modułowa (z wkładką z tworzywa). Stosowane są one
w przypadku zaawansowanych zmian zwyrodnieniowych stawów lub
rzadziej, złamania szyjki kości udowej. Podczas zabiegu usuwana jest
głowa i szyjka kości udowej oraz powierzchnie stawowe panewki stawu
biodrowego. W jamie szpikowej kości udowej formowany jest odpowiedni
otwór, odpowiadający kształtowi trzpienia. Następnie w przygotowane
struktury, mocowane są elementy endoprotezy. Mocowanie może odbywać
się przy udziale cementu kostnego lub poprzez wciśnięcie i późniejszą
integrację, przerośnięcie tkanką kostną porowatej powierzchni implantu.
Postępowanie przy całkowitej endoprotezoplastyce przedstawione zostało
na rysunku 6.
366
Współcześnie stosowane metody przywrócenia utraconych
w wyniku schorzeń i uszkodzeń funkcji miednicy
Rysunek 6. Schemat postępowania w przypadku alloplastyki całkowitej [11]
Endoprotezy połowiczne (rys. 7) są stosowane głównie u osób
starszych, u których nie ma znacznych uszkodzeń powierzchni stawowych
panewki, a doszło do urazu i złamania szyjki kości udowej. Podczas
zabiegu zachowywana jest panewka, a wymianie poddawana jest głowa
kości udowej. W porównaniu do protez częściowych, głowa charakteryzuje
się większym rozmiarem, zbliżonym do rzeczywistych rozmiarów głowy
kości udowej pacjenta. Postępowanie w trakcie zabiegu jest podobne do
wcześniej omawianej techniki operacyjnej, stosowanej w endoprotezach
całkowitych. Mocowanie protez może odbywać się w sposób cementowy
lub bezcementowy [11].
Rysunek 7. Przykłady protez połowicznych (A – Moore’a,
B – Thompson’a, C – bipolarna Monka) [11]
Stosowanie endoprotez całkowitych i połowicznych wiąże się również
z problemami. Najpoważniejszymi z nich są ryzyko zwichnięcia stawu,
poluzowania elementów endoprotezy, jak również zużycie materiału na
367
Adrian Dubicki
powierzchni sztucznego stawu. Wprowadza to konieczność ograniczenia
aktywności osób po alloplastyce, a w przypadku zużycia endoprotezy – jej
wymiany. Protezy wtórne nazywane są rewizyjnymi. Niestety zużycie
takiej protezy może wiązać się z koniecznością unieruchomienia stawu
biodrowego, a co za tym idzie – również pacjenta [11].
Rozwiązaniem, szczególnie polecanym w przypadku młodych
pacjentów jest kapoplastyka. Zaliczana jest ona do całkowitych endoprotezoplastyk. Polega ona na zastąpieniu tylko naturalnych powierzchni
stawowych, przy użyciu metali o niskiej ścieralności. Postępowanie
podczas zabiegu (rys. 8) jest podobne jak w przypadku poprzednich typów
endoprotez. Pierwszym krokiem jest usunięcie chrząstki wraz z przylegającymi warstwami kostnymi z obrębu panewki stawowej oraz usunięcie
chrząstki i uformowanie w postaci stożka głowy kości udowej. Następnie
w tak przygotowanej głowie kości udowej wierci się otwór, mający za
zadanie odpowiednio ustawić kapę i ją utrzymać. Część panewkowa
mocowana jest zazwyczaj na wcisk, do procesu osteointegracji, natomiast
część udowa na cement kostny [11].
Rysunek 8. Schemat postepowania przy kapoplastyce (z lewej – uformowanie kości,
z prawej – zamocowanie na ich powierzchniach kapy) [11]
Kapoplastyka umożliwia oddalenie w czasie konieczności
przeprowadzenia endoprotezoplastyki całkowitej, czy też możliwość
zastosowania endoprotezoplastyki połowicznej (możliwość wykorzystania
panewki z kapoplastyki) [11].
368
Współcześnie stosowane metody przywrócenia utraconych
w wyniku schorzeń i uszkodzeń funkcji miednicy
W przypadku gdy dojdzie do obluzowania lub zwichnięcia w stawie
biodrowym, powikłaniem może być przemieszczenie się panewki. Może
ono być również spowodowane jej nieprawidłowym umocowaniem lub
zapaleniem czy zakażeniem kości, co w rezultacie może prowadzić do
zaniku kości i przemieszczeń panewki. W tym przypadku rozwiązaniem
jest endoproteza rewizyjna panewki (rys. 9) [15].
Rysunek 9. Przykłady dostępnych panewek rewizyjnych
(A – pressfitowa, B – indywidualna firmy Biomet, C – antyprotuzyjna) [15, 16, 17]
Dużym problemem towarzyszącym przemieszczeniu panewki jest
ubytek tkanki kostnej. Do takich uszkodzeń stosowane są:
- panewka pressfitowa (mocowana śrubami),
- panewka z siatką do mocowania wkrętami i wcementowywana
panewka,
- systemy antyprotruzyjne (z wypustkami i uzupełniającymi bloczkami
metalowymi).
Ubytek tkanki kostnej powoduje konieczność opracowania
indywidualnego umocowania panewki rewizyjnej i uzupełnienia braków
przeszczepami kostnymi. Takie rozwiązania nie zawsze spełniają
w dostateczny sposób swoje funkcje. Lekarz podczas zabiegu musi mieć
przygotowany plan, na ewentualność, gdy nie będzie w stanie dostosować
standardowych implantów do zmian w obrębie miednicy [15].
W takich zaawansowanych przypadkach może być wykorzystana
technika, pozwalająca na zaplanowanie operacji przy użyciu programów
komputerowych lub nawet na wykonanie indywidualnego implantu dla
pacjenta [15].
3.3. Implanty indywidualne
Często jedynym ratunkiem w przypadku zaawansowanych zmian
w obrębie kośćca miednicy mogą okazać się implanty indywidualne. Nie są
one obecnie powszechnie stosowanym rozwiązaniem, ale zyskują coraz
większą przychylność. Mogą być wykorzystywane w przypadku skompli-
369
Adrian Dubicki
kowanych złamań i ich powikłań, zwyrodnień, martwic i powstających z tej
przyczyny deformacji oraz w chorobach onkologicznych kości.
Przy obecnym stanie nauki i techniki, lekarze we współpracy
z inżynierami mogą tworzyć implanty niemal każdej części ciała. Oprócz
wytwarzanych z różnych materiałów wszczepów, mogących zastąpić kości,
coraz częściej można spotkać się z uzupełnieniem innych tkanek. Rozwój
produkcji resorbowalnych rusztowań dla rozwoju i namnażania komórek
macierzystych, powoli prowadzi nas do ery „produkcji” zamiennych
organów. Nad wyprodukowaniem narządów pracuje między innymi
amerykańska firma Organovo, która już ma za sobą pierwsze sukcesy.
Naukowcy z tej korporacji stawiają sobie za cel wszczepienie już za 10 lat
pierwszych organów pochodzących z ich firmy [18].
Zaprojektowanie indywidualnego implantu oraz jego wytworzenie
wymaga zastosowania kilku innowacyjnych technik. Pierwszym etapem jest
otrzymanie modelu z badań diagnostycznych (inżynieria odwrotna
– ang. Reverse Engineering). Następnie otrzymany model jest wykorzystany
do projektowania przy użyciu oprogramowania komputerowego (projektowanie wspomagane komputerowo – ang. Com-puter Aided Design)
implantu dla pacjenta. Ostatnim krokiem jest wytworzenie indywidualnego
wszczepu z wirtualnego modelu, przy wykorzystaniu technik przyrostowych
(szybkie prototypowanie – ang. Rapid Prototyping). Połączenie tych
wszystkich kroków daje nam spersonalizowany, idealnie pasujący do
pozostałych struktur organizmu implant [19, 20].
Obecnie najczęściej spotykanymi, wykonywanymi dla konkretnego
pacjenta implantami są wszczepy stomatologiczne oraz płytki służące do
zastąpienia ubytków kostnych czaszki. W literaturze można spotkać
również przykłady trzpieni endoprotez, panewek, implantów żuchwy, głów
kości ramiennej oraz stawów paliczkowych [19, 20, 21, 22]. Wybrane
z nich zostały przedstawione na rysunku 10.
370
Współcześnie stosowane metody przywrócenia utraconych
w wyniku schorzeń i uszkodzeń funkcji miednicy
Rysunek 10. Przykłady implantów indywidualnych (A – żuchwy,
B – panewka biodrowa, C – implant uzupełniający ubytek czaszki) [19, 22]
Świat medycyny zaczyna powoli stosować również indywidualne
implanty w obrębie miednicy. W porównaniu do przedstawionych powyżej
przykładowych wszczepów, implanty miednicy muszą oprócz zastąpienia
struktury kostnej, przejąć jej funkcje przenoszenia ciężaru ciała na
kończyny dolne. Wiąże się to z koniecznością otrzymania odpowiedniej
wytrzymałości oraz odporności na uszkodzenia zmęczeniowe. Otrzymana
konstrukcja indywidualnego implantu musi więc dodatkowo wytrzymać
codzienną aktywność pacjenta przez długi okres czasu.
Z przykładami implantów w obrębie miednicy można zapoznać się
przede wszystkim na portalach internetowych, prezentujących nowinki
techniczne z zakresu druku 3D. Pierwszym przykładem jest przypadek
pacjenta z chińskiego szpitala Wojskowej Akademii Medycznej w Xi’an.
Został zdiagnozowany u niego złośliwy nowotwór - mięsak Ewinga.
W celu ratowania życia pacjenta, aby nowotwór nie dał przerzutów na inne
tkanki należało usunąć objętą zmianami tkankę - większą część kości
biodrowej. Zachowaniu uległa panewka stawu biodrowego [23].
Na podstawie zdjęć z rezonansu magnetycznego wykonano
trójwymiarowy modeli i zaprojektowano implant (rys. 11). W celu
zmniejszenia masy, wszczep w części swojej struktury ma ażurową
konstrukcję. Do implantu dodane zostały również otwory umożliwiające
połączenie go z pozostałymi kośćmi miednicy za pomocą wkrętów [23].
371
Adrian Dubicki
Rysunek 11. Zaprojektowany w szpitalu w Xi'an implant części kości biodrowej [23]
Implant części kości biodrowej wykonany został przy użyciu techniki
przyrostowej – selektywnego spiekania laserowego (SLS) z biokompatybilnych proszków tytanu. Następnie został on wszczepiony pacjentowi,
który po okresie rekonwalescencji i rehabilitacji odzyskał zdrowie
i sprawność [23].
Kolejnym przykładem jest piętnastoletnia szwedka, która otrzymała
indywidualny implant stawu biodrowego. Cierpiała ona na łagodną
odmianę nowotworu - nerwiako-włókniaka. Podczas jego usunięcia doszło
do powikłań, które doprowadziły do ciężkich deformacji i w rezultacie do
unieruchomienia dziewczyny na wózku inwalidzkim. Z pomocą przyszła
belgijska firma Mobelife. Przy wykorzystaniu obrazów z tomografii
komputerowej opracowano dokładny model i na jego podstawie
zaprojektowany został implant (rys. 12). Panewka posiadała porowatą
powierzchnię zewnętrzna, służącą do zmniejszenia masy implantu, ale
przede wszystkim do osteointegracji z kością. Dodatkowymi elementami
mocującymi były wypustki z otworami, do przymocowania implantu przy
użyciu wkrętów [24].
372
Współcześnie stosowane metody przywrócenia utraconych
w wyniku schorzeń i uszkodzeń funkcji miednicy
Rysunek 12. Zaprojektowany przez belgijską firmę Mobelife
implant panewki stawu biodrowego [24]
Wydrukowany implant, już po osiemnastu miesiącach od operacji,
pozwolił nastolatce na sprawne poruszanie się, nawet bez użycia sprzętu
pomocniczego [24].
Z przykładami stosowania indywidualnych implantów możemy spotkać
się również na terytorium Polski. Zabiegowi wszczepienia implantu na
wymiar została poddana 66-letnia pacjentka krakowskiego szpitala.
W wyniku poważnych zmian zwyrodnieniowych biodra, licznych operacji
i powikłań doszło do przerwania ciągłości pierścienia kostnego miednicy.
Implant został opracowany na podstawie zdjęć z tomografu komputerowego przez belgijską firmę. Wydrukowany wszczep pozwolił uzupełnić
kostny ubytek w obrębie miednicy i zapewnił jej stabilność. Operacja
zakończyła się sukcesem, a pacjentka wraca do zdrowia [25, 26].
Oprócz firm spoza granic naszego kraju, wykonywaniem indywidualnych
implantów, na mniejszą skalę, zajmują się również nasi rodzimi producenci.
Pracownia implantów znajduje się m.in. w łódzkim Bionanoparku oraz
w białostockiej firmie ChM [27, 28].
Wytwarzanie spersonalizowanych implantów zyskuje coraz większą
popularność.
4. Wytwarzanie implantów indywidualnych
Wytwarzanie standardowych implantów oparte jest na procesach
odlewania, kucia, cięcia, wiercenia oraz toczenia i frezowania. Opracowane
przez firmy z branży ortopedycznej procesy technologiczne pozwalają na
373
Adrian Dubicki
seryjną produkcję standardowych wyrobów, które będą spełniać wszystkie
stawiane im wymagania, a koszty ich produkcji pozwolą na
konkurencyjność z innymi korporacjami.
Implanty indywidualne wymagają innego podejścia. Jednostkowa
produkcja takiego wyrobu sprawia, że wykorzystanie metod stosowanych do
produkcji masowej staje się nieopłacalne, a wręcz niemożliwe ze względu na
konieczność dokładnego odwzorowania kształtu implantu indywidualnego.
Proces projektowania indywidualnych implantów z obrazów pochodzących z
urządzeń diagnostycznych zachęca, ale i wymusza zastosowanie technik
wytwarzania ze wspomaganiem komputerowym (ang. Computer Aided
Manufacturing – CAM).
Najczęściej spotykaną formą wytwarzania implantów spersonalizowanych są techniki przyrostowe. Pozwalają one na dokładne
odwzorowanie komputerowego modelu implantu i jego niemal
natychmiastowe wszczepienie. Nie są one jednak jednym możliwym
rozwiązaniem. Rozwój współczesnych urządzeń do wytwarzania implantów
metodą ubytkową (która opiera się na sterowaniu przez system
komputerowy) sprawił, że mogą być one z powodzeniem wykorzystane w
produkcji nawet skomplikowanych implantów.
5. Podsumowanie
Coraz szybszy tryb życia, brak troski o prawidłowe odżywianie
i zdrowie sprawia, że coraz częściej możemy zaobserwować w społeczeństwie problemy zdrowotne. Dotykają one między innymi obręczy
kończyny dolnej, która odgrywa w organizmie bardzo ważną rolę
– podporową i lokomocyjną.
Każdy rodzaj schorzenia czy uszkodzenia wymaga indywidualnego
podejścia. W każdym z przypadków wdrażane są inne postępowania
mające na celu przywrócenia sprawności i komfortu pacjentowi.
W przypadku skomplikowanych złamań kości miednicy, wieloodłamowych oraz tych z przemieszczeniami, często stosowaną metodą jest
stabilna osteosynteza wewnętrzna. Innym rozwiązaniem wykorzystywanym
głównie przy przerwaniu ciągłości spojenia łonowego i stawu biodrowokrzyżowego jest osteosynteza zewnętrzna. Charakterystyczna dla tej metody
jest możliwość działania poza ogniskiem złamania. Endoprotezoplastyka jest
metodą stosowaną przy chorobie zwyrodnieniowej, martwicach kości, ale
również przy skomplikowanych i powikłanych złamaniach miednicy
i bliższego końca kości udowej oraz nowotworach.
Każde z przedstawionych rozwiązań stosowane jest przy typowych
złamaniach oraz innych chorobach. Szereg rodzajów implantów czy
374
Współcześnie stosowane metody przywrócenia utraconych
w wyniku schorzeń i uszkodzeń funkcji miednicy
stabilizatorów, o dopasowanych do kości kształtach i wymiarach może być
wykorzystywanych w większości przypadków.
Zaawansowane zmiany wywołane wysokoenergetycznymi wypadkami
komunikacyjnymi czy upadkami oraz zaawansowane zmiany onkologiczne
czy powikłania często nie pozwalają na ich wykorzystanie. W takich
przypadkach, przedstawionych również w niniejszej pracy, konieczne jest
zastosowanie implantów indywidualnych. Nie są one obecnie powszechnie
stosowanym rozwiązaniem, ale zyskują coraz większą przychylność. Do
popularyzacji indywidualnych implantów przyczynia się również rozwój
techniki, który umożliwia przygotowanie i wytworzenie idealnie
dopasowanych wszczepów.
W niedługim czasie, indywidualne wszczepy mogą być powszechnie
stosowanym sposobem na przywrócenie utraconych funkcji pełnionych
przez tkanki kostne.
Literatura
Ortopedia i traumatologia. Praca zbiorowa pod redakcją naukową T. S.
Gaździka. Warszawa: Wydawnictwo Lekarskie PZWL, 2010, strony 45-48,
263-277, 433-456, 473-486 i 532-573, ISBN 978-83-200-4165-1
2. Jałowa martwica kości [online]:
http://zdrowie.gazeta.pl/zdrowie/1,101580,14002449, jalowa_martwica_kosci
[dostęp: 4 VI 2015 r.]
3. Rak kości [online]: www.przychodnia.pl/rbt/index.php [dostęp: 4 VI 2015 r.]
4. Nowacki J., Dobrzański L. A., Gustavo F.: Implanty śródszpikowe
w osteosyntezie kości długich. Gliwice: Open Access Library – Scientiic
International Journal of the World Academy of Materials and Manufacturing
Engineering, 2012, numer 11 (17), ISSN 2083-5191
5. Ebeltt-Paprotny G.: Fizjoterapia. Praca pod redakcją R. Preis. Wrocław:
Elsevier Urban i Partner, 2012, strony 557-591, ISBN 978-83-7609-309-3
6. Pelvic & Acetabular. Fracture Treatment Solutions [katalog]. Freiburg:
Stryker, 2011
7. Pelvic Implants and Instruments. A dedicated system for reconstructive pelvic
and acetabular surgery [katalog]. Oberdorf: Johnson & Johnson – DePuy
Synthes, 2014
8. Płytki rekonstrukcyjne. Zespolenie miednicy [katalog]. Lewickie: ChM, 2015
9. Olszewski G., Misztal M.: Przednia stabilizacja zewnętrzna miednicy. Lublin:
Nowiny lekarskie, 2006, tom 75, numer 2, strony 129-133, ISSN 2353-9801
10. Stabilizator zewnętrzny BigCharstab [katalog]. Lewickie: ChM, 2013
11. Madej T.: Modelowanie strefu ruchowej endoprotezy stawu biodrowego
w aspekcie biomateriałów. Kraków: 2008, Praca doktorska, Wydział inżynierii
mechanicznej i robotyki, Akademia Górniczo-Hutnicza
12. Kowalewski P.: Modelowanie tarcia w endoprotezie stawu kolanowego.
Wrocław: 2007, Praca doktorska, Wydział mechaniczny, Politechnika
Wrocławska
1.
375
Adrian Dubicki
13. Ortopedicum: Sztuczny staw biodrowy. Informacje dla pacjentów [broszura].
Kraków: http://www.ortopedicum.pl [dostęp: 6 VI 2015 r.]
14. Oddział Ortopedyczny Wielospecjalistycznego Szpitala w Miliczu:
Endoproteza stawu biodrowego. Przewodnik dla pacjenta [broszura]. Milicz:
http://www.mcm-milicz.pl [dostęp: 6 VI 2015 r.]
15. Wojciechowski P., Kopeć K., Nowak M., Borowski M., Kamiński J., Kusz D.:
Zaopatrywanie ubytków dna kostnego panewki w endoprotezoplastyce
rewizyjnej stawu biodrowego [prezentacja]. Ustroń Śląski: Międzynarodowe
Sympozjum KOKSARTROZA, 2012
16. GRIPTION TF Acetabular Revision System[online]:
https://www.depuysynthes.com/hcp/hip/ products/qs/GRIPTION- TF-AcetabularRevision [dostęp: 6 VI 2015 r.]
17. Biomet PMI Patient-matched Implants [online]:
http://www.biomet.com/wps/portal/internet/ Biomet/HealthcareProfessionals/products/orthopedics [dostęp: 6 VI 2015 r.]
18. KuberaG.: Druk 3Dprzyszłością biomedycyny[online]
http://www.pcworld.pl/artykuly/394433_1/Druk.3D.przyszloscia.biomedycyny.html
[dostęp: 6 VI 2015 r.]
19. Trusscott M., Beer D., Vicatos G., Hosking K., Barnard L., Booysen G.,
Campbrll R. I.: Using RP to promote collaborative design of customised
medical implants. Bloemfontein-Cape Town: Rapid Prototyping Journal,
2007, tom 13, numer 2, strony 107-114, ISSN 1355-2546
20. Markowska O., Budzik G.: Innowacyjne metody wytwarzania implantów
kostnych za pomocą inżynierii odwrotnej (RE) oraz technik szybkiego
prototypowania (RP). Sosnowiec: X Forum Inżynierskie ProCAx, 2011
21. Jardini A. L., Larosa M. A., Filho R. M., Zavaglia C. A., Bernardes L. F.,
Lambert C. S., Calderoni D. R., Kharmandayan P.: Cranial reconstruction: 3D
biomodel and custom-built implant created using additive manufacturing.
Campinas: Journal of Cranio-Maxillo-Facial Surgery, 2014, tom 42, numer 8,
strony 1877-1884, ISSN 1010-5182
22. Raghatate S. C., Kuthe A. M., Deshmukh T. R., Dahake S. W.: Rapid
prototyping-assisted fabrication of the customized metatarsophalangeal joint
implant (SamKu). Nagpur: Rapid Prototyping Journal, 2014, tom 20, numer 4,
strony 270-279, ISSN 1355-2546
23. W Chinach wszczepiono pacjentom drukowane kości [online]:
http://swiatdruku3d.pl/w-chinach-wszczepiono-pacjentom-drukowane-kosci
[dostęp 6 VI 2015 r.]
24. Implantstawu biodrowego z drukarki 3D pozwolił 15-latce znowu chodzić
[online]: http://www.benchmark.pl/aktualnosci/implant-druk-3d-stawbiodrowy-wozek-chodzi [dostęp: 6 VI 2015 r.]
25. Pionierski zabieg w Krakowie [online]:
http://pulsmedycyny.pl/2848221,19711, pionierski-zabieg-w-krakowie
[dostęp: 6 VI 2015 r.]
26. Nota prasowa Szpitala Specjalistycznego im. Ludwika Rydygiera w Krakowie
z dnia 8.11.2012 [online]:
www.rydygierkrakow.pl/str_www_x/nota_prasowa.pdf [dostęp: 6 VI 2015 r.]
376
Współcześnie stosowane metody przywrócenia utraconych
w wyniku schorzeń i uszkodzeń funkcji miednicy
27. Bionanopark w Technoparku w Łodzi [online]: http://technopark.lodz.pl/
bionanopark/struktura [dostęp: 6 VI 2015 r.]
28. Implanty na wymiar [online]: http://chm.eu/produkty/implant-na-wymiar
[dostęp: 6 VI 2015 r.]
Współcześnie stosowane metody przywrócenia utraconych w wyniku
schorzeń i uszkodzeń funkcji miednicy
Streszczenie
Obręcz kończyny dolnej odgrywa w organizmie ważną rolę - jest narządem podpory dla całego
ciała i uczestniczy w lokomocji. Z tego powodu, wystąpienie w jej obrębie nawet najmniejszych
dysfunkcji, może prowadzić do poważnych zaburzeń w prawidłowej realizacji statyki i dynamiki.
Medycyna przy wykorzystaniu techniki wypracowała szereg rozwiązań mających na celu
przywrócenie jej prawidłowej funkcji.
W pracy przedstawiono współcześnie stosowane metody leczenia dysfunkcji miednicy, takich jak
osteosynteza złamań, endoprotezoplastyka oraz implanty indywidualne, które są obecnie
najbardziej rozwijaną z tych metod. Spersonalizowane implanty są często jedynym ratunkiem
w przypadku zaawansowanych zmian.
Contemporary methods of restoration of pelvic function lost due to
diseases and damages
Abstract
The rim of the lower limb plays an important role in the body - it is an organ supporting the entire
body and participates in locomotion. For this reason the occurrence of even the slightest
dysfunction can lead to serious disturbance in the proper implementation of the statics and
dynamics. Medicine by means of technology has developed a series of solutions in order to
restore its proper function.
This article presents the contemporary methods of treatment of pelvic dysfunction, such as
osteosynthesis of fractures, arthroplasty and individual implants, which are currently the most
expandable of these methods. Personalized implants are often the only salvation in case of
advanced changes in human body.
377
Indeks autorów
Antonowicz M. .......................277, 344
Bednarczyk M................................... 94
Cwynar A. .........................18, 179, 192
Dereń N. ............................................ 27
Dubicki A. .............. 141, 161, 325, 357
Dyńda M. .......................................... 47
Gadomska-Gajadhur A. ................. 254
Gawroński M. ...................35, 131, 204
Goede A. ................................... 35, 204
Grygiel-Pradelok M................277, 344
Janicka A. ..........................18, 179, 192
Kajzer A. ......................................... 277
Kajzer W. ........................................ 344
Kątska K.......................................... 121
Kimsa M.......................................... 265
Kołodziejczyk-Czepas J. ................ 223
Kosior-Jarecka E. ........................... 121
Kowalska W. .................................... 77
Kruk A............................................. 254
Lach D. ............................................ 112
Łabejszo A. ..................................... 131
Mazurek U. ....................................... 94
Mierzejewska Ż. A.7, 161, 293, 308, 325
Muc-Wierzgoń M. ............................ 94
Nowak P. ......................................... 223
Ostrowski J. .................................... 121
Posmysz A. ....................................... 66
Ruśkowski P. .................................. 254
Siemińska E. ..................................... 18
Sieradzka M. ................................... 223
Sikora B........................................... 265
Sikora J. ..................................... 18, 192
Simińska E. ....................................... 27
Skubis A. ......................................... 265
Szewczenko J.................................. 344
Waldowska M................................... 77
Wandtke T.........................35, 131, 204
Woś J. ................................................ 77
Woźniak J. ........................................ 27
Wybranowski T. ............................. 179
Ziomkowska B. ................18, 179, 192
378
Download
Random flashcards
123

2 Cards oauth2_google_0a87d737-559d-4799-9194-d76e8d2e5390

ALICJA

4 Cards oauth2_google_3d22cb2e-d639-45de-a1f9-1584cfd7eea2

bvbzbx

2 Cards oauth2_google_e1804830-50f6-410f-8885-745c7a100970

Create flashcards