Filogenetyka molekularna

advertisement
Paweł Golik
Instytut Genetyki i Biotechnologii
Uniwersytet Warszawski
[email protected]
Początki
Charles Darwin
1809-1882
Biologia ewolucyjna?
Nothing in Biology Makes Sense
Except in the Light of Evolution
Theodosius Dobzhansky (1900-1975)
Biologia ewolucyjna?
“Więc ja już 40 przeszło lat mówię prozą, nie mając o
tym najmniejszego pojęcia!”
Molière
Każdy biolog korzysta z teorii ewolucji, nawet jeżeli nie zdaje
sobie z tego sprawy!
Pierwsza synteza
 Darwinizm + genetyka klasyczna + genetyka
populacji  Syntetyczna teoria ewolucji
 Mutacje jako podstawa zmienności ewolucyjnej
 W populacjach naturalnych występują rozmaite allele
wielu genów, nowe powstają w wyniku mutacji
 Ewolucja jako zmiany częstości alleli w populacji
Pierwsza synteza
 4 główne siły ewolucji
 Mutacje
 Przepływ genów
 Dobór naturalny
 Dryf genetyczny
Druga synteza
 Darwinizm + genetyka molekularna 
molekularna
ewolucja
 Molekularne mechanizmy ewolucji
 Jak zachodzą zmiany sekwencji DNA (i białek), jak ewoluują
genomy
 Jak działa dobór naturalny na poziomie sekwencji
 Genetyczna kontrola rozwoju w ewolucji (“evo-devo”)
 Ewolucja molekularna jako narzędzie do poznawania
funkcji genów i genomów
Podobieństwo i homologia
 Homologia: podobieństwo wynikające ze
wspólnego pochodzenia ewolucyjnego –
cecha odziedziczona od wspólnego przodka
Homologia czy homplazja
Podobieństwo i homologia
sekwencji
 Przy dostatecznie dużym podobieństwie można założyć,
że sekwencje są homologiczne
 Podobne struktury przestrzenne i/lub funkcje mogą być
determinowane przez różne sekwencje
 Liczba możliwych sekwencji aminokwasowych o nietrywialnej
długości jest gigantyczna
 Na poziomie sekwencji praktycznie nie stwierdza się
konwergencji, homoplazje są przypadkowe
Paralogi i ortologi
 Paralogi – geny homologiczne w tym samym genomie,
powstałe w wyniku duplikacji genu - np. α-globina i βglobina człowieka
 Ortologi – geny homologiczne powstałe w wyniku
specjacji, pochodzące od genu u wspólnego przodka – np.
α-globina człowieka i α-globina myszy
Ewolucja globin
Nowe geny powstają dzięki
duplikacji DNA
 Duplikacje wewnątrz genu
 Tasowanie eksonów
 Duplikacje całych genów
 Duplikacje fragmentów i całych chromosomów
(aneuploidia)
 Duplikacje genomu (poliploidia)
Ewolucja genów opsyn
Ewolucja widzenia kolorów
Homologia genów jako źródło
informacji
 Duplikacje paralogiczne są źródłem nowych genów i
nowych funkcji, ale często działających na podobnej
zasadzie
 Np. poszukiwanie nowych enzymów o funkcji zbliżonej do
już znanych
 Geny ortologiczne z reguły (choć nie zawsze) zachowują
funkcję
 organizmy modelowe – wnioskowanie o funkcji genów na
podstawie badań nad innymi organizmami
 np myszy, a nawet drożdże jako modele do badania chorób
człowieka
Białka składają się z domen
Tasowanie eksonów
Wspólne motywy w różnych
genach
Możemy stawiać hipotezy
dotyczące funkcji nieznanych
białek na podstawie motywów
znajdowanych w sekwencji.
Podstawa większości
współczesnych badań
biochemicznych!!
Genomika
 Genomika jest dziedziną zajmującą się badaniem całych
genomów (kompletu informacji genetycznej) różnych
organizmów
 Techniki biologii molekularnej + robotyka + informatyka
 Sekwencjonowanie i charakteryzowanie genomów
 Badanie funkcji zawartych w nich genów
Craig Venter
Francis Collins (NIH)
Co to znaczy?
TCACAATTTAGACATCTAGTCTTCCACTTAAGCATATTTAGATTGTTTCCAGTTTTCAGCTTTTATGACTAAATCTTCTAAAATTGTTTTTCCCTAAATGTATATTTTA
ATTTGTCTCAGGAGTAGAATTTCTGAGTCATAAAGCGGTCATATGTATAAATTTTAGGTGCCTCATAGCTCTTCAAATAGTCATCCCATTTTATACATCCAGGCAATAT
ATGAGAGTTCTTGGTGCTCCACATCTTAGCTAGGATTTGATGTCAACCAGTCTCTTTAATTTAGATATTCTAGTACATACAAAATAATACCTCAGTGTAACCTCTGTTT
GTATTTCCCTTGATTAACTGATGCTGAGCACATCTTCATGTGCTTATTGACCATTAATTAGTCTTATTTGTTAAATGTCTCAAATATTTTATACAGTTTTACATTGTGT
TATTCATTTTTTAAAAAATTCATTTTAGGTTATATGTATGTGTGTGTCAAAGTGTGTGTACATCTATTTGATATATGTATGTCTATATATTCTGGATACCATCTCTGTT
TCATGCATTGCATATATATTTGCCTATTTAGTGGTTTATCTTTTCATTTTCTTTTGGTATCTTTTCATTAGAAATGTTATTTATTTTGAGTAAGTAACATTTAATATAT
TCTGTAACATTTAATGAATCATTTTATGTTATGTTTAGTATTAAATTTCTGAAAACATTCTATGTATTCTACTAGAATTGTCATAATTTTATCTTTTATATACATTGAT
ATTTTTATGTCAAATATGTAGGTATGTGATATTATGCACATGGTTTTAATTCAGTTAATTGTTCTTCCAGATGTTTGTACCATTCCAACATCATTTAAATCATTAAATG
AAAAGCCTTTCCTTACTAGCTAGCCAGCTTTGAAAATCCATTCATAGGGTTTGTGTTAATATATTTTTGTTCTTTTTTTTCCTTTCTACTGATCTCTTTATATTAATAC
CTACTGTGGCTTTATATGAAGTCATGGAATAATACGTAGTAAGCCCTCTAACACTGTTCTGTTACTGTTGTTATTGTTTTCTCAGGGTACTTTGAAATATTCGAGATTT
TATTATTTTTTAGTAGCCTAGATTTCAAGATTGTTTTGACGATCAATTTTTGAATCAATTGTCAATATTTTTAGTAATAAAATGATGATTTTTGATTGGAAATACATTA
AATCTATAAGCCAAATTGGAGATTATTGATATATTAACAAAAATGAGTTTTCCAGTCCATGAATGTATGCACATTATAAAATTCATTCTTAAGTATGTCATTTTTTAAG
TTTTAGTTTCAGCAGTATATGTTTGTTACATAGGTAAACTCCTGTCATGGGGGTTAGTTGTACAGGTTATTTTATCATCCAGGCATAAAGCCCAGTACCCAGTAGTTAT
CTTTTCTGCTCCTCTCCCTCCTGTCACCCTCCACTCTCAAGTAGACCCCAGTTTCTGTTGTTCTCTTCTTTGCATTAATGACTTCTCATCATTTAGATTGCACTTGTAA
GTGAGAACAGGACGTATGTGGTTTTCTACTCCTGTGTTAGTTTGCTAAGGATAACCACCTCCATCTCCATCCATGTTCCCACAAAAGACATGATCTCCTTTTTTATGGC
TGCATATTATTCCATGGTATATATGTACCACATTTTCTTTATCCAATCTGTCATTGATGGACATTTAGGTTGTTTCCACATCATTGCCGTTGTAAATACTGCTGCAGTG
AATATTCGTGTGTATGTCTTTATGGTAGAATGATTTATATTCCTCTGGGTATATTTCCAAGTAATGGGATGGTTGGGTCAAATGGTAATTCTGCTTTTAGCTTTTTGAG
GAATTGCCATATTGCCTTTCACAACGGTTGAACTAATTTATACTCCCAAGAGTGTATAAGTTGTTCCTTTTTCTCTGCAACCTCGACATCACCTGTTATTTATGACTTT
TATATAATAGCCATTCTGCTGGTCTGAGATGGTATCTCATTATGATTTTGATTTGCATTTCTCTAATGCTCAGTGATATTGAGCTTGGCTGCATATATGTCTTCTTTTA
AAAATATCTGTTCATGTCCTTTGCCTAATTTATAACGGGGTTGTTTGTTTTTCTCTTGTAAATTTGTTTAAGTTCCTTATAGATTCTAGGTATTAAACCTTTTTTCAGA
GGCGTGGCTTGCAAATATTTTCTCCCATTCTATAGGTTGTCTGTTTATTCTGTTGATAGTTTCCCTTGCTGTGCAGAAGCTCTTAACTTTAATTAGATCCGACTTGTCA
ATTTTTGCTTTGGTCGCAATTGCTTTTGATGTTATTGTCGTGAAATCTTTGCTAGTTCTTAGGTCCAGGATGATATTGCCCAAGTTGTCTTCCAGGGCTTTTATAATTT
TGGATTTTACATTTAAGTCTTAATATATTTATTAAATTTGTTAGGGTTTCAGGATACAAGGACAATATAGCAGCAAACAATGTAAAAGTAAAATCTGAAAAATAATAGA
AAACAGTTTAATTGAACACTTTACCATTATGTAATGCCCTTCTTTGTCTTTCCTGATCTTTGTTGGTTTGAAGTTCAAAAAAGACAAACTTAATGGTACAATAGGTATT
GTAGATTTCAGGACTTTCTGTATAAAATATTTTGTATATATGAATAGATCATTTTTTATTTCCAGTCTTTAAACATTTTCTTAACATTTTCTTCTATTGCTTCACTTCA
CTCGCTAGGACCATCAGGACAGTGTTGAACAGAAATTGTCAGACTGATCATCACAACTTTTTCTAGATTTTAGAAGGAAATTTTTCTTTATTTCAACATAAAGCAGCAT
GTTAATGCCAAGTTTTAATATGTGTTATCAGATTGAAATTTTTTTGTATATTTCTACATTACCAAGAATTTTTAGCAAGAGTTTTTGTTGAGTTTTAATTTAAAAATCA
TTTGTTAATTTCATCTGATTTTTTTATTTCTCTTTTTACCTTAAGAGATTAAACTGACTACAGATTGAATATAAACAAACAAACAAACAAACAAAAACTCTAAAATGCT
GTGGATCAACACCACTTAGTAATTTGTATACTTGGATTCAATTTGCTGAAATTTTGTTAGACATTTTTGCGTCGATATTTATGAGGGATGTTGATCTGTAAAAGTATTA
AAATGCCTTTGACAGATAGTGTCACCATATAAAAAACTTTGAACAAAATCAGATTATATCACTGTGGATATTTCTATTTTGAACTAACTTAGATGATAATTTTAATCTA
TATCCTAGATGAACT
Mały fragment chromosomu 21
Co to znaczy?
 Bez teorii ewolucji nie mielibyśmy możliwości poznania
odpowiedzi na to pytanie
 Odszukujemy geny podobne do genów już zbadanych
 Możemy badać geny przez “odwrotną genetykę” –
tworzenie mutantów u organizmów modelowych
 Porównując genomy możemy wnioskować o biologii
organizmu
Genomika porównawcza bakterii
sposobem poznania ich fizjologii
 Bakterie mają genomy podobnej wielkości, mieszczące
2000-6000 genów
 Około połowy genomu tworzą rodziny podobnych genów
powstałych przez powielenie (duplikację) – tzw. rodziny
paralogów
 To, które geny są powielone świadczy o kierunku
specjalizacji ewolucyjnej bakterii
Genomika porównawcza bakterii
 E. coli – heterotrof pasożytniczy – powielone geny
kodujące białka rozkładające różne związki organiczne
 Methanococcus janaschii – chemoautotrof – powielone
geny kodujące enzymy szlaków biosyntetycznych
 Pseudomonas aeruginosa – groźny patogen oporny na
wiele leków i szybko dostosowujący się do zmian
środowiska– powielone geny kodujące białka usuwające
antybiotyki, rozkładające substancje organiczne,
umożliwiające zagnieżdżanie się w powierzchniach.
Metagenomika
 Analiza sekwencji całości DNA wyizolowanego ze
zbiorowiska organizmów
Metagenomika
 Pozwala na




badanie bioróżnorodności
odkrywanie nowych gatunków
badania ekologiczne (interakcje organizmów i środowiska)
wyszukiwanie nowych, przydatnych enzymów, białek o
właściwościach leczniczych itp.
 A to wszystko dzięki teorii ewolucji
 identyfikacja sekwencji w metagenomach na podstawie
podobieństwa do sekwencji genomów znanych gatunków
 badanie pokrewieństwa
Co tempo zmian sekwencji mówi
o funkcji?
Mutacje
 Szkodliwe – są szybko eliminowane przez dobór negatywny
(oczyszczający)
 Neutralne – nie wpływają na funkcję produktu, nie podlegają
selekcji
 Korzystne – są szybko utrwalane w populacji przez dodatni
dobór naturalny
Teoria neutralna (Kimury)
 Większość obserwowanych różnic w sekwencjach,
zarówno wewnątrzpopulacyjnych, jak i
międzygatunkowych to mutacje neutralne,
utrwalane przez dryf genetyczny
 Mutacje niekorzystne są eliminowane i nie
obserwujemy ich (modyfikacja – mutacje „prawie
neutralne” nie są w pełni eliminowane i mogą się w
pewnych warunkach utrwalać)
 Mutacje korzystne są bardzo rzadkie, mają
znaczenie ale w analizach ilościowych są pomijalne
Tempo zmian białka jest
kształtowane przez dobór naturalny
 Tzw. sekwencje “zachowawcze” (konserwowane) –
zmieniają się powoli, zmiany eliminowane przez dobór –
sekwencje o kluczowej i niezmiennej funkcji
 Sekwencje o mniej znaczącej lub zmieniającej się w toku
ewolucji funkcji zmieniają się szybciej
Tempo zmian
Tempo zmian jest różne w
różnych obszarach sekwencji
Obszary silnie zachowawcze odpowiadają najważniejszym dla funkcji
miejscom w białku.
Mutacja czy polimorfizm?
 Wykrywamy różnicę w DNA u chorego na jakąś chorobę
 Może to być
 Mutacja powodująca chorobę
 Niezwiązana z chorobą cecha zmienna w populacji
 Jak to sprawdzić?
Mutacja czy polimorfizm?
Ewolucjonizm w poszukiwaniu
tajemnicy człowieczeństwa
Różnice ewolucyjne
 Nowe geny
 Utrata genów
 Zmiany liczby kopii
(paralogów) genów
 Zmiany w genach
(mutacje)
 Zmiany w ekspresji
Różnice na poziomie białek
 Przeciętne białko ludzkie różni się 2 aminokwasami od
szympansiego odpowiednika
 29% białek jest identycznych
Różnice w genach
 Około 500-600 genów – znaczące odchylenia od
hipotezy zegara molekularnego (sugeruje odstępstwa
od neutralności)
 Około 200 obszarów o przyspieszonej ewolucji w linii
człowieka (HAR – Human Accelerated Regions) –
przeważnie obszary niekodujące, ale w pobliżu
sekwencji regulatorowych
 Geny o Ka/Ks (ω) >1 – układ odpornościowy,
spermatogeneza, apoptoza
Jak szukać śladów działania
doboru
 Większość sekwencji genów zmienia się jednostajnie, w
tempie wyznaczanym przez eliminację mutacji
niekorzystnych – “zegar molekularny”
 Odstępstwa od jednostajnego tempa w określonej gałęzi –
dobór specyficzny dla tej gałęzi
Równomierne tempo
zmian
Przyspieszone zmiany
Spowolnione zmiany
Zmiany genów – „gen mowy”
Rzadka choroba
dziedziczna objawiająca
się zaburzeniami mowy,
niezdolnością do
tworzenia struktur
składniowych i
gramatycznych.
Gen FOXP2
FOXP2 – szybka ewolucja
Enard et al. (2002) Nature 418, 869-72
MYH16
 Jedna z form łańcucha ciężkiego
miozyny
 Mutacja ok. 2,5 mln lat temu –
związek z ewolucją kształtu
czaszki – osłabienie mięśni
szczęki, zmniejszenie
twarzoczaszki, wzrost
mózgoczaszki
Gen mikrocefaliny
Mikrocefalia
Chory 13 lat
Zdrowy 11 lat
Kouprina et al., PLoS Biology, 2004, 5:E126
Szybka ewolucja genu u człowieka
Inne geny o przyspieszonej
ewolucji
 ASPM
◦ homologia do białka Drosophila odpowiadającego za
wykształcanie wrzeciona podziałowego
◦ mutacje u człowieka powodują mikrocefalię
 MGC8902
◦
◦
◦
◦
zawiera wiele powtórzeń domeny DUF1220,
liczba powtórzeń wzrosła w linii człowieka,
ekspresja w korze mózgowej,
nieznana funkcja
◦ Prodynorfina (prekursor przekaźników w układzie
nerwowym)
Podsumowanie
 Nie ma jednego, czy kilku “genów człowieczeństwa”
 Za różnice między ludźmi a innymi gatunkami odpowiada
kumulacja wielu, pozornie niewielkich, różnic
 Niewielkie zmiany sekwencji mogą pociągać znaczne
zmiany fenotypowe
 Istotne są też różnice na poziomie regulacji – trudniejsze
do zbadania
Triumf Darwina
 Ewolucja cech specyficznie ludzkich była związana z
szeregiem cząstkowych zmian dotykających różnych
genów
 Koncepcja Darwina wyrażona językiem genomiki
porównawczej!
“różnica między człowiekiem a innymi zwierzętami ma
charakter ilościowy, a nie jakościowy”
Organizmy modelowe
“Les éléments vitaux étant de nature
semblable dans tous les êtres vivants, ils
sont soumis aux mêmes lois
organiques...”
“Podstawowe jednostki życia, mając u
wszystkich żyjących istot podobną naturę,
rządzone są tymi samymi prawami
organicznymi...”
Claude BERNARD (1813-1878)
Modele w naukach
przyrodniczych
 Modele analogii przyczynowej CAM
 Przyczyny i skutki w układzie modelowym i docelowym są takie
same.
 Nie mogą zaistnieć „jakiekolwiek istotne przyczynowo braki
analogii między modelem a modelowanym zjawiskiem“.*
 Modele analogii hipotetycznej (HAM)
 Doprowadzenie do sformułowania hipotez, które mogą mieć
ogólne znaczenie tak dla układu modelowego, jak i docelowego.
 Nie dostarczają danych mających bezpośrednie znaczenie dla
medycyny człowieka, jednak polepszając nasze rozumienie zjawisk
biologicznych mogą one sugerować możliwe mechanizmy
fizjologiczne u człowieka.
Saccharomyces cerevisiae
Drożdże jako organizm
modelowy
 Łatwa hodowla i testy fenotypowe
 Fizjologia typowa dla mikroorganizmów
 Bezpieczne i nieszkodliwe dla środowiska
 Dobrze poznana genetyka klasyczna (analiza tetrad,
mapy)
 Łatwe manipulacje genetyczne (“odwrotna genetyka”,
plazmidy)
 Znana od 1996 sekwencja genomu
Genomy
S. cerevisiae
H. sapiens
~1,2 x 107 bp
~3 x 109 bp
~6500 genów
~25 000 genów
~1800 genów wykazuje homologie z
genami H. sapiens (30%)
~ 4000 genów wykazuje homologie z
genami S. cerevisiae (13%)
Wiele podstawowych funkcji komórki jest zachowanych.
Niekiedy możliwa wymienność białek drożdżowych i
ludzkich (np. Ras, Oxa1)
Przykładowe drożdżowe modele chorób
 Progerie Wernera i Blooma
 Choroby związane z defektami naprawy DNA
(HNPCC, ataksja-telangiektazja)
 Ataksja Friedreicha
 Zaburzenia komunikacji jądrowo mitochondrialnej (PEO)
 Choroby wywołane mutacjami w mtDNA (NARP)
 Poszukiwanie leków za pomocą drożdży
Zespół Wernera
 Normalny rozwój w
dzieciństwie.
 Przedwczesne starzenie
rozpoczyna się wraz z wiekiem
dojrzewania.
 Niski wzrost, owrzodzenia,
zwapnienia.
Przyczyna:
mutacje genu WRN kodującego
helikazę DNA z rodziny RecQ
 Pacjenci dożywają średnio 47
lat.
 Przyczyną śmierci z reguły
choroba nowotworowa, albo
schorzenia sercowonaczyniowe.
SGS1 – model drożdżowy
 Gen SGS1 jest drożdżowym homologiem genów WRN i BLM.
 Fenotyp delecji SGS1:
 zwiększona rekombinacja mitotyczna (zwłaszcza subtelomerowa)
 zaburzenia segregacji chromosomów
 zaburzenia mejozy
 Białko Sgs1p jest zaangażowane w hamowanie nieuprawnionej
rekombinacji i utrzymywanie stabilności genomu.
 Ludzkie geny BLM i WRN częściowo komplementują fenotyp
delecji SGS1
HNPCC (zespół Lyncha)
 HNPCC - dziedziczny rak jelita grubego
niezwiązany z polipowatością
 Około 5% wszystkich raków jelita grubego
 Mutacje w genach kodujących białka
zaangażowane w naprawę niedopasowanych
nukleotydów (mismatch repair)
 Podwyższona częstość mutacji, zwłaszcza
niestabilność traktów z powtórzeniami
 Najczęściej mutacje genów hMSH2 i hMLH1
Drożdżowy model HNPCC
W mutantach drożdżowych
wzrost spontanicznej mutagenezy
Alfred & Borts (2007) Biochem Soc Trans, 35:1525-28
Dla dokładniejszego zbadania efektu konkretnych mutacji ludzkich
stworzono hybrydowe geny, w których fragmenty genu S.
cerevisiae zastępuje się pochodzącymi z genów człowieka tak, by
zachować funkcję w drożdżach (tzw. humanizowanie drożdży).
Ataksja Friedreicha
 Choroba układu nerwowego i mięśni
 zaburzenia czucia
 obniżone napięcie mięśniowe
 kardiomiopatia, deformacje kręgosłupa i
stóp
 Autosomalna recesywna; 1/50 000
 Mutacja dynamiczna w genie frataksyny
 Akumulacja żelaza w mitochondriach:
 Zaburzenia systemów naprawczych mtDNA
 Zaburzenia w oddychaniu
 Stres oksydacyjny
Bramwell: Atlas of Clinical Medicine
YFH1 – drożdżowy homolog frataksyny
 Białko wiążące żelazo
 Mitochondrialny magazyn żelaza
 Detoksykacja nadmiaru żelaza
 Włączanie żelaza do centrów Fe-S
YFH1 – drożdżowy homolog frataksyny
 Fenotyp delecji:
◦ defekt oddychania mitochondrialnego
◦ zwiększona wrażliwość na stres oksydacyjny
◦ akumulacja żelaza w mitochondriach: 10-krotnie większe
stężenie od szczepu dzikiego
◦ zależna od żelaza oksydacyjna degradacja centrów Fe-S
 Ludzki gen kompensuje delecję genu drożdżowego
Cavadini i wsp., (2000), Hum Mol Genet, 9:2523-30
Choroby wywołane mutacjami w mtDNA
 Np. NARP – Neurogenic Ataxia Retinitis Pigmentosa
 Mutacja w genie ATP6
 W komórkach 70-90% zmutowanego DNA
 Obniżona aktywność syntezy ATP
 Mechanizm nieznany
Drożdże w poszukiwaniu
nowych leków
 Systemy homologiczne
 Interaktory białek drożdżowych homologicznych
do białek ludzkich
 Białka docelowe dla znanych związków
drobnocząsteczkowych
 Systemy heterologiczne
 Interaktory białkowe – system dwuhybrydowy
 Ekspresja w drożdżach białka (np. ludzkiego) i
poszukiwanie ligandów
 np. choroby degeneracyjne związane z agregacją białek:
choroba Alzheimera, Huntingtona itp.
 poszukiwanie ligandów toksyn bakteryjnych
Organizmy modelowe
“Podstawowe jednostki życia, mając u wszystkich
żyjących istot podobną naturę, rządzone są tymi
samymi prawami organicznymi...”
Claude BERNARD (1813-1878)
Ale dlaczego?
Ponieważ wszystkie żyjące gatunki łączy wspólne
pochodzenie.
Charles DARWIN (1809-1882)
Medycyna ewolucyjna
Medycyna ewolucyjna
 Dlaczego chorujemy?
 Przyczyny bezpośrednie
 Bo zainfekował nas wirus, bo złamaliśmy nogę itp.
 Przyczyny pierwotne
 Wyścig ewolucyjny pasożytów i gospodarzy
 Dlaczego nasze ciało jest zbudowane tak a nie inaczej –
ewolucyjne kompromisy
 Historia ewolucji naszych przodków a przystosowanie do
współczesnego środowiska
 Nowotwór jako proces ewolucyjny
 Dlaczego się starzejemy?
Wyścigi z patogenami
 Sekwencje genów kodujących białka układu
odpornościowego należą do najszybciej zmieniających się
w ewolucji
 Sekwencje białek wirusów, bakterii itp. też szybko się
zmieniają
 Szukając tych obszarów sekwencji, które zmieniają się
najszybciej możemy wskazać, które białka powinny być
celem dla leków, który szczep wirusa będzie najgroźniejszy
itp.
 Bakterie i wirusy szybko uodparniają się na leki
Ciało człowieka - ekosystem
Ciało człowieka zawiera około 1015 (biliard, 1000 bilionów) komórek
Ale tylko 5-10% to nasze, ludzkie komórki!
Demodex folliculorum
roztocza
Helicobacter pylori
- bakterie w żołądku
Wyścig z patogenami - oporność
Staphylococcus aureus





1928:
1943:
1947:
1997:
Dziś:
odkrycie penicyliny (Alexander Flemming)
masowa produkcja i stosowanie penicyliny
odkryte pierwsze oporne szczepy S. aureus
S. aureus nabywa oporność na wankomycynę
50% infekcji S. aureus oporne na penicylinę,
metycylinę, erytromycynę i tetracyklinę
 Problem: oporność nie tylko na pojedyncze, ale i na
wiele antybiotyków
Doug Green -- SMC Bio -- 29 March 2004
FYS 163: Science as a Way of Knowing
Oporność na penicylinę
Pneumococcus u dzieci (Islandia)
Wyścigi z patogenami
 Terapia wieloelementowa (HAART, np. AIDS)
 Pojedyncze leki przeciwwirusowe nie są skuteczne – bardzo
szybko ewoluują oporne wirusy
 Sposób – stosowanie kilku różnych leków działających na
różne procesy cyklu życiowego wirusa – nie daje szansy na
wyewoluowanie oporności
Szczepionki przeciw grypie
•Każdego roku powstaje wiele (ok. 10-11) różnych
wariantów wirusa.
•Trzeba przewidzieć, który z nich będzie zagrożeniem w
następnym sezonie, żeby przygotować szczepionkę
•Analiza ewolucyjna wskazała 18 kodonów w genie
kodującym hemaglutyninę wirusa, które podlegają
silnemu działaniu doboru dodatniego
•Ten ze szczepów, u którego jest najwięcej zmian w
tych kodonach najprawdopodobniej będzie źródłem
następnej infekcji
Trafność: 9 na11 = 0,818
Historia gatunku a choroby
 Każdy gatunek to efekt kompromisu ewolucyjnego
(przystosowanie kontra ograniczenia)
 Człowiek nie jest naprawdę dobrze przystosowany do
chodzenia na dwóch nogach
 problemy z kręgosłupem i stawami
 kształt miednicy, ciężki poród
 oko (nerwy nad siatkówką) – plamka ślepa, odklejanie
siatkówki – problem wszystkich kręgowców
Historia gatunku a choroby
 Środowisko człowieka współczesnego nie jest tym, do
którego przystosował się w ewolucji
 Dostępność pokarmów bogatych w tłuszcz i węglowodany
 Nasi przodkowie (jak inne zwierzęta) nie znali sytości
 Przewlekły stres
 Mechanizm stresu powstał w ewolucji jako przystosowanie
(mechanizm walki lub ucieczki, mobilizacja w sytuacji
krytycznej)
 Pomaga poradzić sobe z niebezpieczeństwem gdy trwa krótko,
ale jest zabójczy gdy trwa dłużej
Mitochondria
 Liczba mitochondriów w komórce ludzkiej
wynosi przeważnie kilkaset do kilku tysięcy
 Każde mitochondrium zawiera od 1 do około
10 cząsteczek mitochondrialnego DNA
(mtDNA)
 Komórki są w stanie żyć bez mtDNA, nie zaś
bez mitochondriów
 Mitochondria u człowieka dziedziczą się od
matki
Dobór naturalny a migracje
Ewolucyjna medycyna mitochondrialna
 Niektóre polimorfizmy mtDNA mają znaczenie
selekcyjne
 Warianty zaadoptowane do zimnego klimatu: słabsze
sprzężenie OXPHOS z wytwarzaniem ATP, część
energii gradientu protonowego rozpraszana w postaci
ciepła
 Warianty zaadoptowane do ciepłego klimatu: wydajne
sprzężenie OXPHOS z wytwarzaniem ATP, optymalne
wykorzystanie energii z pokarmu
Adaptacje mtDNA – konsekwencje
Ciepły klimat
Zimny klimat
Silne sprzężenie OXPHOS z
wytwarzaniem ATP
Słabsze sprzężenie OXPHOS z
wytwarzaniem ATP
Wydajne wykorzystanie kalorii z
pokarmu
Mniej wydajne wykorzystywanie
kalorii z pokarmu, termogeneza
W połączeniu z wysokokaloryczną
dietą zwiększone wytwarzanie ROS
Mniejsze wytwarzanie ROS przy diecie
wysokokalorycznej
Krótszy czas życia
Długowieczność
Podatność na choroby degeneracyjne
(np. AD), cukrzycę.
Mniejsza zapadalność na choroby
degeneracyjne (AD, PD, cukrzyca).
Mniejsza zapadalność na choroby
związane z defektami OXPHOS (np.
LHON).
Większa zapadalność na choroby
związane z defektami OXPHOS (np.
LHON).
To nie wszystko
 “Ekologia ewolucyjna” (tak naprawdę nie ma innej)
 Biologia rozwoju
 Fizjologia
 Antropologia i archeologia
 Ochrona środowiska
 ... a nawet psychologia
Download
Random flashcards
123

2 Cards oauth2_google_0a87d737-559d-4799-9194-d76e8d2e5390

Create flashcards