KARTA PRACY-in¿ynieria genetyczna

advertisement
KARTA PRACY-INśYNIERIA GENETYCZNA
Ćw.1. Pocięte DNA (np. bakterii EcoR I) moŜna nakładać na odpowiednie
Ŝele, które umieszcza się w polu elektrycznym. Fragmenty DNA
wędrują w polu elektrycznym z róŜną prędkością zaleŜną od ich
wielkości. Na podstawie ruchliwości DNA określa się liczbę par zasad
(pz) w danym fragmencie.
a) Na podstawie rysunku określ, od czego zaleŜy prędkość, z jaką
przemieszczają się w Ŝelu poszczególne fragmenty DNA.
………………………………………………………………
b) Wyjaśnij korzystając z tekstu, jaki jest cel przeprowadzania
elektroforezy Ŝelowej.
……………………………………………………………..
Ćw.2. Zakładając, ze po dwóch cyklach replikacyjnych PCR ( w czasie 2
minut) powstają cztery cząsteczki dwuniciowego DNA:
a) oblicz, o ile zwiększy się próbka DNA po 10 cyklach
b) Na podstawie wyniku obliczeń określ krótko cel stosowania reakcji
PCR:
………………………………………………………………………………………
Ćw.3. „Część DNA zawartego w chromosomach zawiera powtarzające się sekwencje występujące w róŜnych
miejscach genomu. Liczba tych sekwencji 2-6 par zasad, zwanych mikrosatelitami, jest róŜna u
poszczególnych osób i wynosi od 4 do 40. Genom człowieka ma wiele róŜnych mikrosatelitów. DuŜa
zmienność mikrosatelitów powoduje, Ŝe kaŜdy człowiek dziedziczy inny ich wariant od ojca i inny od
matki. Zjawisko to zostało wykorzystane przy pracowaniu metody tzw. profilowania DNA, zwanego
teŜ ”genetycznym odciskiem palca”. Profilowanie DNA jest przydatnym narzędziem w badaniach
sądowych, do stwierdzenia pokrewieństwa genetycznego lub poszukiwania konkretnego genu.”(fragm.
podr. " Biologia 3-Seria z tangramem - zakres podstawowy")
Na podstawie tekstu i własnej wiedzy odpowiedz na pytania:
a) wyjaśnij pojęcie: mikrosatelity
……………………………………………………………………………………….
b) Na rysunku obok przedstawiono „genetyczny odcisk palca”
pozostawiany przez sprawcę na miejscu przestępstwa (kolumna 1)
oraz osoby podejrzanej (kolumna 4).Przedstaw wniosek na
podstawie przedstawionych wyników.
c) Na rysunku przedstawiono wynik badania DNA matki, dwójki dzieci oraz domniemanego ojca. Na
podstawie wyników badania DNA określ, czy badany męŜczyzna mógłby być ojcem :
- dziecka I
- dziecka II.
Swój pogląd w kaŜdym przypadku uzasadnij.
Określ wynikające z wyników takiego badania moŜliwe korzyści społeczne.
Ćw.4. ZałóŜmy, ze w celu pocięcia podanej niŜej sekwencji DNA uŜyto
enzymu restrykcyjnego BamH I.
Enzym
restrykcyjny
EcoR I
BamH I
Hae III
Hind III
Hpa I
Hpa II
Miejsce
rozpoznawane
GAATTC
GGATTC
GGCC
AAGCTT
GTTAAC
CCG
AAATGGGTACGCACAGTGGATCCACGTAGTAATGCGATGCGTAGT
GTTTATGGAGAGAAAGAAAAACGCGTCGCCTTTTATCGATGCTGT
ACGGATCGGAAGTGGCGATGAGGATCCATGCAAATCGCGGCCGAT
CGTAATAT
a) na podanej sekwencji obwiedź kółkiem kaŜde miejsce rozpoznawane, które
moŜe być przecięte przez enzym restrykcyjny BamH I.
b) napisz, ile fragmentów DNA zostanie utworzonych w wyniku cięcia
sekwencji DNA.
Ćw.5.
Na rysunku poniŜej przedstawiono podział komórki bakterii, u której obecny jest plazmid z
wstawionym genem kodującym ludzką insulinę.
a) Na rysunku powyŜej wskaŜ literę oznaczającą plazmid…..
b) Przy klonowaniu genu za pomocą wektorów plazmidowych kolonie bakterii zawierające plazmid z genem
kodującym insulinę są wymieszane z koloniami bakterii bez plazmidów. Wszystkie kolonie wyglądają tak
samo, ale niektóre otrzymały plazmid z ludzkim genem i genem odporności na antybiotyk, niektóre bez
ludzkiego genu i genu odporności na antybiotyk, a niektóre nie otrzymały Ŝadnego plazmidu.
Wyjaśnij w oparciu o rysunek i tekst, w jaki sposób moŜna zidentyfikować kolonie z plazmidami
zawierającymi ludzki gen.
…………………………………………………………………………………………………….
Ćw.6. Tabela przedstawia wyniki sekwencjonowania ludzkiego genomu.
a) Przedstaw na diagramie udział poszczególnych sekwencji w genomie człowieka.
b) Określ udział sekwencji niekodujących w DNA człowieka.
Rodzaj
sekwencji
długie
powtórzenia
krótkie
powtórzenia
Eksonysekwencje
kodujące
Udział(%)
53
8
1,5
introny
25,5
inne
12
Download
Random flashcards
123

2 Cards oauth2_google_0a87d737-559d-4799-9194-d76e8d2e5390

ALICJA

4 Cards oauth2_google_3d22cb2e-d639-45de-a1f9-1584cfd7eea2

bvbzbx

2 Cards oauth2_google_e1804830-50f6-410f-8885-745c7a100970

Create flashcards