wielkie religie świata wobec roślin i ich modyfikacji

advertisement
ZESZYTY PROBLEMOWE POSTĘPÓW NAUK ROLNICZYCH 2006 z. 523: 11-32
WIELKIE RELIGIE ŚWIATA
WOBEC ROŚLIN I ICH MODYFIKACJI
Jerzy Brusiło
Zakon Braci Mniejszych Konwentualnych,
Międzywydziałowy Instytut Bioetyki Papieskiej Akademii Teologicznej w Krakowie
Wprowadzenie
Najbardziej pierwotne zainteresowanie człowieka przyrodą wiązało się z jej
zrozumieniem i wykorzystaniem, szczególnie jeśli chodzi o rośliny. Stanowiły one jego
bezpośrednie otoczenie, były pierwszym poŜywieniem, paliwem, lekarstwem, bronią i
materiałem do budowy domów. Bez względu na to, czy pierwotny człowiek rozpoczął
swoją ewolucję na afrykańskich sawannach, czy Ŝe stworzony został przez Boga w
Rajskim Ogrodzie - Edenie, jako istota z natury religijna stawał przed czczonymi przez
niego bóstwami lub Bogiem w otoczeniu roślin. To one właśnie prawdopodobnie były
jako pierwsze składane w ofierze. Sięgając do historii róŜnych religii, szczególnie tych
najbardziej znanych i mających najliczniejszych wyznawców, rośliny jako otoczenie i
poŜywienie w buddyzmie, hinduizmie, islamie, judaizmie i chrześcijaństwie odgrywały
i nadal odgrywają waŜną rolę. Ich kształty, właściwości i specyfika powodują, Ŝe są
obiektem kulturowym, przemysłowym i naukowym. Religia „stanowi integralną część
świata ludzkiego zanurzonego w naturze”1 i jest obszarem badań prowadzonych od
staroŜytności. Nas jednak w tym miejscu interesuje religijny wymiar tylko wąskiego
wycinka szeroko pojętej natury, który jest najbliŜej człowieka, tj. trawa i kwiaty pod
nogami, liście i drzewa w zasięgu ręki, rośliny pól, lasów, mokradeł, oaz na pustyni
i wysokich gór.
Najstarsze religijne odniesienia do świata roślin
1
BURKERT W. 2006. Stwarzanie świętości. Ślady biologii we wczesnych wierzeniach religijnych.
Wydawnictwo Domini, Kraków: 12.
12
J. Brusiło
Rośliny jako środowisko Ŝycia na Ziemi zaczęły się rozwijać z pierwszych sinic
w oceanach, aby około 500 mln lat temu na błotnych brzegach ówczesnych mórz w
formie zielonych glonów rozpocząć fotosyntezę z powietrza atmosferycznego i słońca.
Przez kolejne miliony lat powstawały rośliny zarodnikowe i zaląŜkowe, zróŜnicowane
na wiele gatunków o coraz bardziej skomplikowanej budowie i funkcji2. Gdy mniej
więcej 12 tysięcy lat temu homo sapiens rozpoczął etap Ŝycia osiadłego (neolit),
zwiększyła się jego ingerencja w środowisko przyrodnicze, pojawiło się rolnictwo,
udomowił niektóre gatunki roślin i zwierząt3. Powstały warunki do rozwoju miast,
gospodarki i handlu oraz na tym tle zaczęła funkcjonować kultura i zorganizowana
religia (najstarsze groby z prostymi oznakami wiary w Ŝycie pośmiertne są znacznie
wcześniejsze i pochodzą sprzed 28 tys. lat; Sungira, Rosja)4.
Rośliny, zwłaszcza o cechach leczniczych, wydają się być szczególnie waŜnym
elementem o charakterze religijnym w powstawaniu i rozwoju relacji nadprzyrodzonej
między ubóstwianym światem przyrody a człowiekiem, i to znacznie wcześniej niŜ
rolnicza rewolucja neolityczna5. Nic dziwnego, Ŝe w dojrzalszych religiach
staroŜytnych ok. II tysiąclecia przed Chrystusem, niektóre rośliny stają się duchowymi
„narzędziami” w kontaktach z wiecznością. W mezopotamskiej epopei „Gilgamesz”
pojawia się wiele magicznych opisów przyrody. Czytamy tam o cedrowym lesie
zamieszkałym przez bogów6 i tajemniczym zielu, które ma niezwykłe właściwości: „To
zioło, Urszanabi, to kwiat niezwykły, który leczy z niepokoju, człowiek moŜe dzięki
niemu Ŝycia dostąpić. Do Uruku warownego wezmę to zioło, lud nim nakarmię i mocy
doświadczę”7.
Podobnie drzewa i rośliny występują w opisie stworzenia świata8, ogrodu
rajskiego i drzewa Ŝycia w Starym Testamencie, w muzułmańskim Koranie i w starych
opowiadaniach chińskich, sprzed kilku tysięcy lat, o wyspach Penglai, Fangzhang i
Yingzhou z magicznymi ziołami nieśmiertelności9. BliŜej naszego kręgu kulturowego,
2
SWERDLOW J.L. 1001. Medycyna naturalna. Rośliny, które leczą. National Geographic Society.
Wydawn. G+J RBA, Warszawa: 8.
3
Udomowienie roślin i zwierząt nastąpiło w róŜnym czasie i w róŜnych rejonach świata, gdzie
rozwinęły się najpierw ośrodki rolnicze a później staroŜytne cywilizacje: Bliski Wschód (tzw.
śyzny PółksięŜyc w deltach rzek): uprawy pszenicy samopsza i płaskurka, jęczmień, soczewica,
groch oraz zwierzęta: kozy, owce, bydło (10.000 lat temu); Ameryka Środkowa: kukurydza,
dynia, fasola, bawełna, tykwa pospolita (9.000 lat temu); Chiny: ryŜ, proso, soja, pochrzyn,
kolokazja, groch i ze zwierząt - świnie (7.000 lat temu). LEWIN R. 2002. Wprowadzenie do
ewolucji człowieka. Prószyński i S-ka, Warszawa: 379-383.
4
NOWAK B. (rRed.) 2006. Encyklopedia Świat Człowieka. Wydawn. Nauk. PWN, Warszawa: 33.
5
Na terenie obecnego Iraku, w odkrytym przez archeologów grobowcu z okresu neandertalskiego
(sprzed 60.000 lat) znaleziono pyłek co najmniej ośmiu gatunków roślin do dziś występującym w
tym kraju, lecz zastanawiające jest, Ŝe siedmiu z nich uŜywa się do leczenia ran, dyzenterii,
astmy, stanów zapalnych, bólów zębów i innych. Bardzo prawdopodobne, Ŝe zebrano je w celach
leczniczych a jeden z pochowanych w jaskimi osobników mógł być np. uzdrowicielem...
SWERDLOW J.L. Medycyna naturalna. dz. cyt.: 9.
6
„Widzą górę cedrów, mieszkanie bogów, tron śmiertelnej Irnini. Przed górą cedry pysznie się
wznoszą, cień ich dobry i wielce przyjemny. Porosły w nim ciernie, porosły krzaki, pod cedrami
wonny rósł oleander”. GILGAMESZ, STILLER R. 1967, (oprac. i tłum.), PIW, Warszawa: 39.
7
TamŜe: 86.
8
Bóg rzekł: „Niechaj ziemia wyda rośliny zielone: trawy dające nasiona, drzewa owocowe
rodzące na ziemi według swego gatunku owoce, w których są nasiona” (Rdz 1, 11), Pismo Święte
Starego i Nowego Testamentu, wyd. III popr., Pallottinum, Poznań 1980: 24. Wszystkie cytaty
biblijne pochodzą z tego wydania Pisma Świętego.
9
SWERDLOW J.L. Medycyna naturalna. dz. cyt.: 9.
WIELKIE RELIGIE ŚWIATA WOBEC ROŚLIN I ICH MODYFIKACJI
13
rzymscy autorzy staroŜytni opisują mistyczne ogrody w Grecji (poświęcone Zeusowi
dęby), Galii, i Germanii (z Yggdrasill, mitycznym świętym jesionem, wiecznie
zielonym centrum świata, pod którym zbierali się bogowie na narady), a u Celtów
istotną rolę w ich religii odgrywały święte gaje (drunemetony) stanowiąc centra kultu i
element łączący poszczególne plemiona. U Skandynawów, Germanów i Słowian, w
okresie przedchrześcijańskim, gdy północną Europę porastały nieprzebrane puszcze,
święte lasy i poszczególne drzewa (zwłaszcza wybrane dęby) były oczywistą częścią
ówczesnych religii. Poza dębem i jesionem, w przedchrześcijańskich tradycjach
religijnych Europy, czczono takŜe jabłoń, cis, jarzębinę, lipę, jawor, klon i brzozę.
Nawet kiedyś na wzgórzach wokół pogańskiego Rzymu (na Watykanie i wzgórzu
Tibur) - jak wspomina Pliniusz - rosły święte dęby, pod którymi wyrocznie wróŜyły z
szumu drzew10.
Nieprzypadkowo wiele elementów roślinnych, jak wspomniane drzewa, mają
podobne znaczenie teologiczne w wielu starych religiach juŜ nieistniejących i stanowią
waŜny element duchowy we współczesnych, nie tylko wielkich religiach świata, ale i w
wierzeniach prymitywnych, o mniejszych zasięgu geograficznym i kulturowym. W
wierzeniach animistycznych, ubóstwiających przyrodę, dziś istniejących jeszcze w
Afryce, niektórych częściach Ameryki Południowej, Azji i Australii, nie tylko drzewa,
ale i inne egzotyczne rośliny, zwierzęta, a nawet nieoŜywione części krajobrazu
utoŜsamia się z duchami i demonami. Dla afrykańskich Pigmejów najwyŜszym bogiemstwórcą świata jest Las i wiele drzew (najczęściej wiekowe baobaby), stanowiące
miejsce kultu jako łącznik między niebem i ziemią.
Przyroda i jej rośliny miały znaczenie nie tylko w dawnych religiach pogańskich,
ale dziś w chrześcijańskiej kulturze zachodniej przeniosły dawne znaczenie w nowe
formy Ŝycia codziennego. Kwiaty, np. róŜe, które w staroŜytności stanowiły atrybut
bogiń miłości - Afrodyty i Wenus, dziś utraciły co prawda swoją „boskość”, lecz
pozostały symbolem miłości. Lilia, w staroŜytnej Grecji uznana za atrybut Hery,
patronki kobiet, opiekunki małŜeństwa i rodziny, wierności (ale teŜ i zazdrości), w
tradycji chrześcijańskiej nie ma juŜ znaczenia boskiego, lecz symbolizuje dziewictwo i
czystość, takŜe w kontekście poświęcenia Bogu. Koniczyna, u kapłanów germańskich i
celtyckich (druidów) była rośliną świętą i czarodziejską, dziś trójlistna koniczyna jest
symbolem Trójcy Świętej11 (ale nie uosabia Boga), natomiast czterolistna koniczyna
zapowiada w powszechnym rozumieniu szczęście. Nic więc dziwnego, Ŝe przyroda, a
zwłaszcza rośliny słuŜące za pokarm dla ludzi, drzewa, rośliny ozdobne i lecznicze
stanowią środek w kontaktach ze światem nadprzyrodzonym we współczesnych,
wielkich systemach religijnych świata.
Buddyzm (buddyzm tybetański)
Buddyzm to religia (światopogląd, filozofia), która swoim zasięgiem dociera
najbardziej na wschód (Japonia, buddyzm zen) i rozkłada się na dwa główne nurty.
Pierwszy, therawada (doktryna starszych) występuje głównie w Tajlandii, Laosie,
KambodŜy i na Cejlonie i jest prostszą formą buddyzmu o charakterze realistycznym i
konserwatywnym. Drugi nurt mahajana występuje głównie w Nepalu, Chinach, Korei i
10
BANEK M. 2003. Rośliny, w: Religia. Encyklopedia PWN, Gadacz T., Milerski B. (Red.), t. 8,
Wydawn. Nauk. PWN, Warszawa: 485-486.
11
TamŜe: 487.
14
J. Brusiło
Japonii12, o charakterze bardziej nadprzyrodzonym i duchowym. Buddyzm (wszystkich
większych szkół) liczy ok. 800 milionów wyznawców13 i w trakcie swego rozwoju,
poza wspomnianymi głównymi nurtami, ukształtował szereg odłamów, np. buddyzm
tybetański, buddyzm zen, które w istocie są późniejszymi, rozwiniętymi formami
wcześniejszych źródeł buddyzmu „indyjskiego”, np. buddyzm tantryczny (wadŜrajana).
W kosmologii buddyjskiej występuje wiele światów (poziomów istnienia), koło
ponownych narodzin i róŜne sfery duchowych. Trudno tam wyróŜnić dokładnie świat
roślin czy podobnych materialnych bytów, chociaŜ mówi się o reinkarnacji w postacie
zwierząt. W tym wszechogarniającym kosmosie moŜna wyróŜnić nawet 31 pięter,
światy powstają, mijają lub odpoczywają przed kolejnym cyklem przemijania14. Rośliny
(drzewa, kwiaty) pojawiają się w opowiadaniach związanych z początkiem buddyzmu,
w Both Gaji, miejscu przebudzenia Buddy rośnie pęd drzewa pod którym Budda doznał
oświecenia, na ołtarzach stawia się kwiaty i kadzidła jako oznaki oddania bóstwu przez
osoby składające ofiary15.
W wykładach współczesnych buddyjskich autorytetów religijnych, w temacie
roślin mówi się, Ŝe nie są to istoty czujące, obdarzone świadomością; do tego - mówiąc
językiem zachodnim - potrzeba nie tylko procesów chemicznych, ale coś w rodzaju
procesów (impulsów) elektrycznych, zatem u roślin brak świadomości, woli, a jedynie
występuje nieintencyjna reaktywność na bodźce. Częściej mówi się o całej przyrodzie i
środowisku. Dalajlama XIV (Tenzin Giaco) - duchowy i polityczny przywódca
Tybetańczyków na emigracji powiedział: „Zawsze podkreślam, Ŝe musimy się
zastanawiać, jak nasze działania mogą wpłynąć na środowisko i na naszych bliźnich.
Przyznaję, Ŝe często trudno to przewidzieć. Nie wiemy, jakie będą dalekosięŜne skutki
karczowania lasów, jak wpłynie ono na glebę, lokalne opady czy wreszcie na klimat
całej planety. śadnych wątpliwości nie budzi tylko fakt, Ŝe my ludzie, jesteśmy
jedynym gatunkiem, który moŜe zniszczyć Ziemię. Nie zrobią tego ptaki, nie zrobią
owady, nie zrobi Ŝaden inny ssak. JeŜeli jednak moŜemy Ziemię zniszczyć, to moŜemy
teŜ ją chronić”16.
Biorąc pod uwagę buddyjskie spojrzenie na przyrodę jako całość, zwraca uwagę
buddyzm tybetański, który rozwinął się na Dachu Świata na bazie przedbuddyjskiej
religii bon. W Tybecie, na wysokości ok. 4000-5000 m n.p.m. przyroda ukazuje,
zarówno swoje piękno, jak i surowość, stąd religia bon oraz buddyzm w tamtym kraju
otacza kaŜdą trawkę, drzewo czy kwiat szczególną czcią. Ofiary z kwiatów, jedzenia i
kolorowe ozdoby, to charakterystyczne przejawy ubóstwienia wszelkich przejawów
Ŝycia, mocy i mistyki. Nigdzie na świecie, Ŝadna inna religia nie oddaje czci takiej
liczbie bóstw, duchów i demonów, jak w Tybecie. Drzewa, skały, góry i jeziora, w
Tybecie uwaŜa się za oŜywione. W czasach przedbuddyjskich wyobraŜano je sobie jako
potęŜniejsze od ludzi, duchowe postacie o kształtach ludzkich z wielkimi kłami,
wywieszonym jęzorem, potęŜnych ramionach i olbrzymich brzuchach. Całą przyrodę
oŜywioną i nieoŜywioną oraz samych siebie Tybetańczycy uwaŜają za skupisko energii
a surowość klimatu, niedostępność miejsc oraz ubóstwo materialne nadają buddyzmowi
tybetańskiemu cechy mistyczne. W tych warunkach problemem jest wyŜywienie oparte
na zwierzętach i roślinach przy jednoczesnym zachowaniu odnawialnych zasobów
12
Buddyzm, w: Encyklopedia Audiowizualna Britannica. Filozofia i religia. Wydawn. Kurpisz,
Poznań 2006: 25.
13
Dane podawane przy liczbie wyznawców wielkich religii są szacunkowe, na podstawie średniej
z wielu źródeł.
14
BARTZ U. Buddyzm. Oficyna Wydawn. „Interspar”, Warszawa b.r.w.: 37-38.
15
TamŜe: 86-87.
16
Dalajlama, Etyka na nowe tysiąclecie, Politeja, Warszawa 2000: 116-117.
WIELKIE RELIGIE ŚWIATA WOBEC ROŚLIN I ICH MODYFIKACJI
15
przyrody. W Tybecie podstawowym poŜywieniem jest praŜona mąka jęczmienna,
masło, ser i mięso, uprawia się warzywa, zbiera rośliny dziko rosnące (np. pokrzywę
stanowiącą poŜywienie pustelników), zioła, a w cieplejszych dolinach wykorzystuje się
owoce i orzechy17.
Z religijnego punktu widzenia, ciekawą formą ukazania przyrody, kwiatów
i motywów roślinnych w buddyzmie tybetańskim jest sztuka ikonograficzna zwojów
malowanych. W niezwykle barwnych i wieloelementowych malowidłach buddyjskich
chodzi o jak najdokładniejsze i umiejętne ukazanie wizji oświecenia, symboliki
religijnej, psychologicznej i kosmologicznej18. Nie brak tam elementów roślinnych o
religijnym znaczeniu. Biała Tara, jedna z najbardziej czczonych bogiń sprzyjającej
nieśmiertelności, jest przedstawiona na malowidle z jedwabiu, z przełomu XIX i XX
wieku, na lotosowym tronie w pozycji medytacyjnej, trzymając w lewej ręce lotos
współczucia dla wszystkich istot czujących. Na jednej łodydze znajduje się trójkwietny,
biały lotos w róŜnym stadium rozkwitu. Zamknięte lub opadające kwiaty symbolizują
buddów przeszłości, otwarte - buddów teraźniejszości, zaś pączki - buddów przyszłości.
Pośrodku otwartego kwiatu lotosu znajduje się sylaba TA - związana z imieniem Tary19.
Lotos jest jednym z ośmiu najwaŜniejszych, najstarszych znaków buddyzmu - symbol
spontanicznego rodzenia się i boskiego pochodzenia, płodności i czystego ducha,
czystości umysłu, niewinności i dobra. Zamknięty kwiat lotosu w kształcie jaja
przedstawia stworzenie wynurzające się z pierwotnych wód. Dla indyjskiej filozofii
lotos był ucieleśnieniem bóstwa, a dla buddystów przedstawia narodziny i naturę
Buddy. W tej roślinie wykorzystuje się symbolikę koloru kwiatu (czerwone Nelumbium speciosum, N. nucifera, N. rubrum plenum; niebieskie - Nymphaea
caerulea; białe - Nymphaea alba, N. pubescens), liczbę płatków, zamknięcie czy
otwarcie pąku20.
Z punktu widzenia wykorzystania roślin i ich modyfikacji, według pierwszej
zasady etyki buddyjskiej, „powstrzymanie się od zabijania wszystkich oddychających
istot i troska o pomyślność wszystkich stworzeń” dotyczy przede wszystkim ludzi i
zwierząt21, stąd moŜna wnioskować, Ŝe wykorzystywanie roślin, ich przetwarzanie i
spoŜywanie nie jest niemoralne. Biorąc pod uwagę całą przyrodę, Padmasiri da Silva
przedstawił zasady współczesnej buddyjskiej etyki środowiska naturalnego: a)
środowiskiem jest człowiek, zwierzę, roślina, ziemia i zasoby wodne; człowiek jest
odpowiedzialny za całe środowisko, ale poszczególne sfery środowiska nie mają takiej
17
RAWSON Ph. 1994. Święty Tybet. Wydawn. Artes, b.m.w.: 6-7.
„(...) Dzieła sztuki tybetańskiej są czymś więcej aniŜeli zwykłymi dekoracjami o estetycznej
wartości. Są one przedstawieniami wyŜszej rzeczywistości zrodzonymi z wizji wewnętrznego
przeŜycia. Ich język formalny jest tak precyzyjny jak na przykład język mapy czy formuły
naukowej, a jednocześnie tak naturalny i bezpośredni w swym działaniu jak piękno jakiegoś
kwiatu czy zachodu słońca”. LEWANDOWSKA-MICHALSKA K. 2003. Ikonografia buddyjskich
zwojów malowanych ze zbiorów Muzeum Narodowego w Warszawie, Wydawn. Neriton,
Warszawa: 28.
19
TamŜe: 89-90.
20
Według Jogi Kundalini gałązka lotosu to duchowa oś świata, na której rosną kwiaty coraz
bardziej rozwinięte i doskonałe aŜ do boskiej korony kwiatu z 1000 płatków i przepięknym
blasku. LEWANDOWSKA-MICHALSKA K. Ikonografia buddyjskich zwojów malowanych, dz. cyt.:
111-112.
21
„Budda krytykował zabijanie i męczenie zwierząt; jego zdaniem, władca powinien chronić
dzikie zwierzęta Ŝyjące na terenie jego włości (...) Ponadto zabraniał mnichom kopania ziemi,
poniewaŜ moŜna w ten sposób uszkodzić Ŝyjące w niej stworzenia”. Cyt. za: GRELA J. 2005.
Etyka buddyzmu, w: Wartości etyczne w róŜnych tradycjach religijnych. KUDELSKA M. (Red.),
Wydawn. Uniwersytetu Jagiellońskiego, Kraków: 117.
18
16
J. Brusiło
samej wartości, np. zwierzęta stoją w hierarchii wyŜej niŜ rośliny, b) etyka środowiska
wymaga rozwagi, postępowania zgodnie z zasadami, c) obok prawa do przetrwania
stawia się prawo do godności człowieka, zwierząt i środowiska, d) naleŜy obchodzić się
z bogactwami naturalnymi, wodą, powietrzem, gospodarką rolną i przemysłem w taki
sposób, Ŝeby respektować prawa innych (...)”22.
Hinduizm
Hinduizm, jedna z najstarszych religii świata dzieli się na trzy grupy wyznań
liczących w sumie ok. 900 milionów wiernych (głównie w Indiach): wisznuizm
(ok. 70% wyznawców), śiwaizm (25-30% wyznawców) i śaktyzm (3-4% wyznawców).
Cechą charakterystyczną hinduizmu jest potraktowanie całego wszechświata jako
całości, dlatego nie mówi się osobno o człowieku czy przyrodzie, ale o całym świecie,
którego częścią jest człowiek, zwierzę i roślina. Myśl hinduska nie widzi róŜnicy
między istnieniem człowieka a istnieniem innego stworzenia. Wszystko jest
podporządkowane dharmie („porządkowi istnienia i powinności”) i ta fundamentalna
zasada świata, przyrody i człowieka konstytuuje pięć form materii. Jedną z form
ukazujących wegetację są drzewa w Indiach i one razem z innymi roślinami posiadają
narządy duchowe i zmysłowe. Na przykład drzewo figowe pipal (ficus religiosa)
symbolizuje trójcę najwaŜniejszych bóstw hinduskich: Brahmę (korzenie), Wisznu
(pień) i Siwę (liście i gałęzie). Poza tym jeszcze w okresie istnienia religii
przedhinduskiej całe lasy były traktowane jako święte, zwłaszcza, jeśli pokrywały góry
- siedlisko bogów (nie tylko w hinduizmie). Do dziś w Ghatach Zachodnich w stanie
Maharasztra (Indie) istnieje ponad 200 chronionych, świętych lasów, w których
występuje prawie 90 gatunków roślin poświęconych bóstwom. W tych świętych gajach
zabronione są polowania i wypas zwierząt, a wolno zbierać tam tylko uschłe drewno. W
XV wieku z racji religijnych guru MaharadŜ DŜambadŜi przywódca Bisznoi, wydał
nakaz sadzenia drzewa i zakaz zabijania wszelkich istot Ŝywych. Z ochroną przyrody
nie tylko ze względów religijnych, ale takŜe ekonomicznych i społecznych moŜna
spotkać się w Indiach w naszych czasach z powodu wycinania lasów, wysuszenia wód
gruntowych i stosowania nawozów, co sprawiło wielkie straty na Ŝyznych równinach
Indusu i Gangesu. Współcześnie ruchy społeczne w Indiach przeciwne dewastacji
środowiska, oprócz akcji protestacyjnej, nabierają ponownie cech religijnych
(hinduistycznej jedności całej przyrody) w głoszonych hasłach: „Czyńcie pokój z
górami i rzekami, lasami i drzewami, ptakami i zwierzętami”23.
Hinduizm posiada wiele świętych ksiąg. Historie i opowiadania o bóstwach
przyrody, tajemne nauki hinduskie przekazane ludziom zawierały nie tylko hymny,
modlitwy i rytualne formuły, ale takŜe informacje o uŜyciu roślin leczniczych. W
Wedach, Brahma bóg-stworzyciel przekazał „mądrość długiego Ŝycia” innym bóstwom
oraz ludziom - oświeconym mędrcom, aby zapobiec ludzkiemu cierpieniu. W scenie,
która odsłania istotę wedyjskiego podejścia do roślin, lekarz przygotowuje się do
leczenia osoby cięŜko chorej. Po medytacji nad stu uzdrawiającymi ziołami błogosławi
je, następnie błogosławi pacjenta. Wysławia go jako tego, „w którym rośliny zbierają
się jak królowie na apelu” i wyraŜa nadzieję, Ŝe „rośliny usunęły wszystkie rany, które
były w ciele” i Ŝe „zstępując z nieba powiedziały: ten człowiek nie dozna szkody...”.
Prezentując roślinę, której zamierza uŜyć, lekarz mówi: „Jesteś najwyŜsza, [jesteś]
22
KLÖCKER M., TWORUSCHKA M, TWORUSCHKA U. 2002. Etyka wielkich religii. Mały słownik,
Wydawn. Verbinum, Warszawa: 126.
23
TamŜe: 127-128.
WIELKIE RELIGIE ŚWIATA WOBEC ROŚLIN I ICH MODYFIKACJI
17
lekiem stosownie do potrzeb i błogosławieństwem dla serca”. Następnie przemawia do
wszystkich roślin, prosząc je o przyjście z pomocą swojemu współplemieńcowi i
dopełnienie kuracji (...)”24. Jest to część Ajurwedy (sanskryt: połączenie słów „Ŝycie” i
„wiedza”), sztuki leczenia związanej z hinduizmem, która opiera się przede wszystkim
na preparatach roślinnych. Inna nauka medyczna o roślinach jest zawarta w Rygweda,
która mówi o uzdrawianiu w kontekście duchowym, a pozostałe teksty wedyjskie takŜe
zawierają treści lecznicze25. Związek medycyny ajurwedyjskiej z religią jest bardzo
silny, uzdrowiciele są święci i do dziś w tradycyjnej sztuce uzdrawiania roślinami czy
minerałami uwaŜa się, Ŝe jednocześnie z ciałem uzdrawia się umysł i duszę.
Szczególne znaczenie roślin (równieŜ w taoizmie i medycynie chińskiej) ma
podwójny wymiar: leczniczy i kultowy. Najbardziej rozwinięty sposób wykorzystania
setek gatunków roślin znajdujemy w formułach ziół leczniczych (kwiatów, nasion,
kory, łodyg, liści), które dawniej stosowane w ścisłej zaleŜności z religią, dziś znajdują
zastosowanie nie tylko w mistycznej Ajurwedzie, ale takŜe w Tradycyjnej Medycynie
Chińskiej (racjonalnej i empirycznej)26. Niektóre rośliny znajdujące się w chińskich
zielnikach medycznych znajdują takŜe zastosowanie w ofiarach rytualnych np. Hong
Hua (krokosz barwierski) - wykorzystuje się kwiaty do przygotowania oleju, którym
namaszcza się wiernych w ceremoniach inicjacyjnych; Huo Xiang (brodziec paczułki,
Agastache) - wytwarza się z tej rośliny barwnik do celów obrzędowych27. W celach
religijnych, do kadzideł i balsamów uŜywa się teŜ znanych w chrześcijaństwie: mirry
(Mo-yao) oraz Ŝywice do kadzidła Cartera (Ru Xiang).
Podobnie, jak w opisanym wcześniej buddyzmie (faktycznie hinduizm jest
wcześniejszy od buddyzmu i symbolika buddyjska pochodzi z hinduizmu), szczególne
znaczenie religijne ma lotos, przedstawia stworzenie świata (z niego Brahma formułuje
trzy światy), jest symbolem czystości. W malarstwie religijnym, z pępka śpiącego
Wisznu wyrasta lotos a z kielicha kwiatu ukazuje się Brahma. Innymi świętymi
roślinami hinduizmu są: tulasi (poświęcone Wisznu), kuśa i darbha28.
Współczesny hinduizm nie ma jednolitego stosunku do roślin czy zwierząt, ale
jego cechą charakterystyczną przeniesioną z przeszłości jest szczególna relacja do
krowy, którą utoŜsamia się z Matką Ziemią - stąd zakaz zabijania krów (od 1000-800 r.
przed Chr.)29. Jednocześnie ze względu na krowy i inne zwierzęta, hinduizm (zwłaszcza
24
SWERDLOW J.L. Medycyna naturalna. dz. cyt.: 14.
„Kora z wysokiego wiecznie zielonego drzewa dita (Alstonia scholaris), uprawianego w całych
Indiach, jest uŜywana do leczenia malarii, chronicznej biegunki, gorączki i chorób skórnych.
Owoce z drzewa kleszcza smakowitego (Aegle marmelos) leczą biegunkę, dyzenterię oraz
schorzenia jelit; jego korzenie usuwają melancholię i uspokajają palpitację serca; liści zaś moŜna
uŜywać w postaci okładu dla złagodzenia oparzeń. Dwa gatunki szkarłatu (Amaranthus) czerwono i biało kwitnący - uŜywane są do leczenia anemii, chorób serca, kaszlu, kolki jelitowej i
ukąszeń Ŝmij. Czerwono kwitnący szkarłat leczy takŜe bezsenność, reumatyzm i przewlekły
alkoholizm (...) Ćaraka samhita zawiera opisy i wskazówki uŜycia 500, a Suśrata Samhita 760
roślin leczniczych”. SWERDLOW J.L., Medycyna naturalna. dz. cyt.: 15.
26
OU XING LIN. Classical and Modern Chinese Herbal Formule and Research. b.r. m.w.
27
HIM-CHE YEUNG 1996. Handbook of Chinese Herbs. Institute of Chinese Medicine, Los
Angeles: 263.
28
BANEK M. Rośliny. dz. cyt.: 487-488.
29
W kontekście szacunku dla Ŝycia, niezabijanie zwierząt i nie niszczenie roślin, istotną tendencją
w najnowszej historii Indii (i hinduizmu) jest upolitycznienie staroindyjskich ideałów
ascetycznych przez Mahatmę Gandhiego. Ideały: niestosowania przemocy, Ŝycie w prawdzie,
nieposiadanie majątku, opanowanie ciała przez ducha i celowo podjęte posty, zostały
wykorzystane przez Gandhiego w wymiarze społecznym jako „najwyŜsza forma religii”. Te
ideały wprowadzane w Ŝycie w czasie przemian politycznych w Indiach (zdobycie
25
18
J. Brusiło
w krajach ubogich) z troską i szacunkiem odnosi się do roślin (uprawnych) i pasz, które
stanowią waŜny składnik poŜywienia świętej krowy. Biorąc pod uwagę ogólne
załoŜenia hinduizmu (wszechświat jako całość i kaŜda roślina jako Ŝywa część tej
całości) nie moŜna przeceniać szczególnego stosunku hinduizmu do roślin i ich
modyfikacji, poniewaŜ ta religia traktuje przyrodę jako jeden, połączony system Ŝycia w
róŜnych formach (reinkarnacja). śycie w formie roślinnej w innym wcieleniu moŜe być
zwierzęciem, w innym owadem, a w jeszcze innym - człowiekiem ...
Islam
Islam jest religią monoteistyczną i w odróŜnieniu od religii (filozofii) Dalekiego i
Środkowego Wschodu, ma wiele punktów wspólnych z chrześcijaństwem i judaizmem.
Sięga teŜ do tych samych korzeni i tradycji (głównie biblijnych), co nie przeszkadza
muzułmanom współcześnie stanowić główne wyzwanie dla chrześcijaństwa (w
zachodnich krajach Europy), oraz zagraŜać judaizmowi (państwo Izrael w konfrontacji
z krajami arabskimi Bliskiego Wschodu). W islamie liczącym ok. 1 miliarda 200
milionów wyznawców (Bliski Wschód, Północna Afryka i Indonezja) moŜna wyróŜnić
trzy nurty: sunnizm, charydŜyzm i szyizm.
Religia muzułmanów powstała w Arabii w VII wieku za przyczyną proroka
Mahometa w oparciu o cztery źródła: Koran (święta księga), sunna (tradycja), idŜma
(konsensus) oraz idŜtihad (indywidualne myślenie). Surowe warunki pustynne w
środowisku powstania religii niewątpliwie były przyczyną dowartościowania
roślinności, zarówno jako źródła poŜywienia jak i lekarstwa. W jednej surze Koranu
czytamy: „Proszę popatrz na to, co cię otacza na ziemi: rośliny, zwierzęta, ptaki, owady,
ryby, przedmioty codziennego uŜytku... Czy nie widzisz w tym wszystkim doskonałej
harmonii, która kontroluje kaŜdą z istot i ukierunkowuje ją? (...) Ten, który stworzył te
wszystkie stworzenia, i który je kontroluje, jest Jeden, Jedyny, bowiem gdyby miał
wspólnika w tworzeniu wszechświata, to całe to stworzenie uległoby zniszczeniu. Ten
Jeden, Jedyny to Allach, prawdziwy Bóg”. W ten sposób roślina w islamie jest
dowodem na istnienie Boga i większość tekstów przyrodniczych miało taki cel
teologiczny: ukazanie stwórczej, sprawiedliwej, litościwej wszechmocy Boga30.
Głównie moc stwórcza Boga jest podkreślona w teologii muzułmańskiej, a jej
wyrazem staje się w Koranie stworzenie roślin: „On jest tym, który spuścił z nieba
wodę i dzięki niej wyrastają wszelkie rośliny. Z nich wyprowadziliśmy zieleń, a potem
ziarna skupione w kłosach; a z palmy daktylowej kiście daktyli nisko zwisających; i
ogrody winnej latorośli, drzewa oliwne i drzewa granatu podobne do siebie i
niepodobne. Popatrzcie na ich owoce, gdy one owocują i dojrzewają! Zaprawdę, w tym
są znaki dla ludzi, którzy wierzą” (6, 99).
W kontekście wykorzystania roślin jako lekarstwa, w ziołolecznictwie często
opartym na doświadczeniach religii Wschodu, w islamie wykorzystuje się tytoń
i marihuanę jako substytut zabronionego przez Mahometa alkoholu. Marihuana jest
niepodległości) mogą w dalszej perspektywie rzutować nie tylko na stosunki społeczne ale i na
relację człowiek-przyroda (pośrednio: człowiek-roślinność środowiska naturalnego). Por. MEISIG
K. 2006. Wojna i przemoc w hinduizmie, w: Wojna i przemoc w religiach świata. Fakty i
przyczyny. Khoury A. Th., Grundmann E., Müller H.-P. (oprac.), Wydawn. Jedność, Kielce:
82-84.
30
„Zwierzęta i ptaki, podobnie jak ludzie, są pod pieczą Boga i w dniu sądu ostatecznego równieŜ
będą odpowiadać za swoje czyny. Wolno jeść mięso zwierząt, z wyjątkiem padliny, wieprzowiny
i krwi, jeśli tylko nad zarzynanym zwierzęciem wzywane było imię Boga”. Koran, rozdz. VI.
WIELKIE RELIGIE ŚWIATA WOBEC ROŚLIN I ICH MODYFIKACJI
19
obecna wśród wielu wyznań świata juŜ od tysiącleci i była uznawana za środek
komunikacji ze światem nadprzyrodzonym. Muzułmanie w celach towarzyskich palą
shishę (fajkę wodną) często z domieszką słabych narkotyków, natomiast zdarza się częściej w religiach Dalekiego Wschodu - Ŝe do celów religijnych (stany mistyczne i
ekstazy) uŜywa się grzybów halucynogennych i pewnych roślin narkotycznych
(konopie indyjskie - haszysz w muzułmańskiej sekcie asasynów)31.
Z religijnego punktu widzenia, muzułmanie przede wszystkim w tradycji
i komentarzach teologicznych zajmują się obecnie bardziej problemami politycznymi,
społecznymi i rodzinnymi (etyką ludzkiej prokreacji), niŜ normami Ŝywienia32 i
zagadnieniami przyrodniczymi („Jedzcie i pijcie, ale nie trwońcie” - Koran 7, 29).
Mimo tego praktycznego podejścia, w islamie znajdujemy pewne dane antropologiczne,
z których moŜna określić miejsce roślin w hierarchii stworzeń poza sferą ludzi i
zwierząt. Człowiek jednoznacznie przewyŜsza zwierzęta (w przeciwieństwie do
„niewiernego bydła” ma rozum i jest zdolny do wiary i niewiary - Koran 5, 1; 8, 22; 8,
57), ale istnieje zasadnicza społeczna równość między człowiekiem a zwierzęciem: „I
nie ma zwierząt na ziemi i ptaków latających na skrzydłach, które by nie tworzyły
społeczności podobnych do waszych” (Koran 6, 38).
W podobieństwach do poglądów biblijnych moŜna zaakcentować prawdę o Bogu,
który stwarza cały świat istot Ŝywych (w tym równieŜ rośliny), oraz mocno zaznaczone
jest potępienie ludzkiej pychy (głównie w kontekście braku szacunku dla zwierząt
gospodarskich - waŜne dla koczowników, właścicieli zwierząt). Podobnie jak w Biblii,
Koran udowadnia, Ŝe zlecone przez Boga człowiekowi zadanie panowania nad światem
jest obwarowane określonymi warunkami („nie czynić zła” - afsada) i człowiek będzie
musiał zdać sprawę z ingerencji („obchodzeniem się”) ze środowiskiem. Poza tym,
główne nurty islamu nie podejmują dyskusji o środowisku naturalnym (w krajach
muzułmańskich prowadzi się często nadmierną eksploatację lasów, stepów i zasobów
wodnych), i za najwaŜniejsze uwaŜa się problemy rozwojowe, a nie ekologiczne
(wyjątkiem są opinie mistyków muzułmańskich, środowiska sufickie, afirmujące
przyrodę). Są to poglądy teocentryczne, zwracające uwagę na ziemię i rośliny nie tylko
ze względu na człowieka, ale głównie ze względu na przestrzeganie przykazań
BoŜych33.
W porównaniu z religiami Wschodu, islam wnosi nową cechę w rozumienie
religijnych znaczeń świata roślin i całej przyrody. Są to mianowicie wartości kulturowe,
estetyczne i ekonomiczne (rolnicze i domowe wykorzystanie roślin), związane ze
środowiskiem naturalnym. Pierwszą dziedziną związaną z praktycznym zastosowaniem
religii Mahometa było ogrodnictwo i rozwój duchowości tzw. „raju muzułmańskiego”.
Nie moŜe dziwić troska muzułmanów w całej swej historii, o kwiaty, drzewa czy
rośliny ogrodowe tam, gdzie islam zmagał się z pustynią, surowym klimatem i
niegościnnym środowiskiem Ŝycia. Zachwyca skala i bogactwo bajecznych ogrodów w
Bagdadzie, Kairze, Damaszku w Azji, a takŜe w hiszpańskiej Sewilli, w europejskiej
części dawnego imperium muzułmańskiego. Geometria, regularność, obfitość gatunków
roślin, a jednocześnie swoboda i spontaniczność z jaką przyroda ukazywała się
31
BANEK M. Rośliny. dz. cyt.: 488.
„Powiedz: »Ja nie znajduję w tym, co mi zostało objawione, niczego zakazanego dla człowieka
w jego poŜywieniu z wyjątkiem tego, co jest martwe, albo rozlanej krwi, albo mięsa świni – bo to
jest obrzydliwe – albo tego, co zostało złoŜone na ofiarę czemuś innemu niŜ Bogu. A kto został
zmuszony, nie będąc ani buntownikiem, ani przestępcą, to, naprawdę, twój Pan jest
przebaczający, litościwy!«„ (6, 145).
33
KLÖCKER M., TWORUSCHKA M, TWORUSCHKA U. Etyka wielkich religii. dz. cyt.: 122-124.
32
20
J. Brusiło
troszczącym się o nią ludziom, to zasługa nie tyle estetów arabskich, co wiernych
muzułmanów, którzy ze względu na Boga dobierali kolory, zapachy i kompozycje
roślinne w oazach, przy meczetach i domach sunnitów czy szyitów (kojarzy się tu
kontynuacja ze staroŜytnym cudem świata: wiszące ogrody królowej Semiramidy w
Babilonie).
Tam, gdzie na sztukę tworzenia ogrodów nakładały się ograniczenia przepisów
religijnych, gaje z mnóstwem egzotycznych roślin zostały utrwalone w mozaikach
meczetów, np. w Damaszku, dając nadprzyrodzone wyobraŜenie raju dla wiernych,
którym Allach obiecywał nagrodę za poboŜność i sprawiedliwość. Drzewa, gęstwina
zieleni i kwiatów, kolory i cuda ogrodów ze snu34, to nie tylko arcydzieło artystyczne,
ale i swoista „katecheza” o nagrodzie nieba, zarówno dla bogatego kalifa w Mekce
(święte miasto islamu), jak i ubogiego muzułmanina na Pustyni Arabskiej.
Na przykładzie arabskiej Hiszpanii, moŜna się przekonać o drugiej „świeckiej”
dziedzinie (poza tworzeniem bajecznych ogrodów tarasowych) religijnego znaczenia
roślin w islamie. Z całego świata na Półwysep Iberyjski sprowadzano nasiona i rośliny
obce w Europie. Uprawiano odmiany jęczmienia i pszenicy znane wcześniej tylko ze
starych ksiąg przyrodniczych. Nowymi roślinami strączkowymi były groch, soczewica
i łubin, zaś z warzyw bakłaŜany, ogórek, czosnek, kapusta, burak, marchew, por,
szpinak, karczoch, melon i arbuz. Z roślin przemysłowych Arabowie sprowadzili
bawełnę, len, konopie, szafran, sumak i trzcinę cukrową. Islam przyniósł Hiszpanii nie
tylko zmianę religii, ale takŜe rozwój rolniczy i gospodarczy. Uboga chrześcijańska
Hiszpania została przekształcona na wzór Syrii w bogaty kalifat. Uprawa roślin z
klimatu monsunowego wymagała szczególnych zabiegów agrotechnicznych,
wprowadzono więc nawadnianie (koła nawadniające, szadufy, zegary wodne),
nawoŜenie i pielęgnacje roślin nieznanych wcześniej w tym kraju. W tak zmienione
środowisko wprowadzano drzewa cytrusowe i palmę daktylową - symbol arabskich i
muzułmańskich tradycji.
Islam i kultura arabska to równieŜ bogactwo przypraw z całego świata. Zaczęto
więc importować i uprawiać w Hiszpanii majeranek, kolendrę, kmin rzymski, sezam,
kapary, koperek i anyŜ. W ogrodach pojawiły się drzewa ozdobne (mirt, dąb, pinie),
które wzbogaciły kwiaty roślin juŜ zadomowionych: róŜe, chryzantemy, fiołki, kosaćce
i lilie wodne. Większość z tych roślin do dziś moŜna spotkać w miastach hiszpańskich.
Z Hiszpanii, poprzez rozwój islamu, wiele arabskich osiągnięć rolniczych i ogrodowych
rozpowszechniło się na całą Europę35. Rozwój rolnictwa, wprowadzanie nowych
gatunków roślin, ich systemowa i naukowa aklimatyzacja, towarzyszyły ekspansji
nowej religii. Islam stworzył warunki do naukowych badań i gromadzenia wiedzy na
temat przyrody, nowoczesnych upraw rolniczych i hodowli roślin36.
34
LORREY DE E., BERCHEM VAN M. 1929. Les Mosaîques de la Mosquée des Ommaiades ŕ
Damas, w: Mon. Piot. t. XXX: 111-139.
35
Dla przykładu: system uprawy lasów przejęto z arabskiej Hiszpanii do Niemiec. DANECKI J.,
Co zawdzięczamy islamowi, http://www.opoka.org.pl/biblioteka/I/IR/co_islamowi. html, (13 IV
2007).
36
Do dziś zachowane dzieła w oryginale, bądź w tłumaczeniu na hiszpański i kataloński
zdumiewają objętością i poziomem, a autorów było teŜ bardzo wielu: Ibn Wafida, Ibn Bassala,
Abu al-Chajra, Ibn HadŜdŜadŜa, At-Tighnariego, Ibn al-Awamma. Ten pierwszy, znany był
później w średniowieczu jako farmakolog Abenguefith i przypisuje mu się autorstwo MadŜmu alfilaha (Zbiór o rolnictwie) a jego praktyczne dokonania to projekt i wykonanie słynnych ogrodów
w Toledo, załoŜonych tuŜ przed rekonkwistą (powrotem) chrześcijan do Hiszpanii. Późniejsze
renesansowe juŜ dzieła agronomiczne (np. Gabriela Alonso de Herrera Agricultura general) to w
duŜej mierze nic innego jak dzieła uczonych muzułmańskich. WATSON A.M. 1974. Agricultural
Innovation in the Early Islamic World. Cambridge 1983 oraz tenŜe, The Arab Agricultural
WIELKIE RELIGIE ŚWIATA WOBEC ROŚLIN I ICH MODYFIKACJI
21
Powiązanie zasad wiary z wykorzystaniem rolnictwa, ogrodnictwa i całego
środowiska naturalnego to przykład na szersze pojęcie religii w środowisku muzułmańskim. Wpływ islamu na kulturę, gospodarkę i środowisko przyrodnicze, tak jak
w religiach Wschodu wpływ, np. buddyzmu czy taoizmu na rozwój medycyny, jest
cechą charakterystyczną nowego podejścia do świata i człowieka. W islamie, tak jak w
judaizmie i chrześcijaństwie, moŜemy mówić o większym wpływie religii na całe Ŝycie
człowieka, niŜ tylko na sferę nadprzyrodzoną, duchową. W islamie teŜ, z tego powodu,
pojawiają się pierwsze w religiach monoteistycznych, oceny dotyczące modyfikacji,
zmian i wykorzystania roślin. Jedna z sur Koranu (5, 76) brzmi: „Nie szerzcie zepsucia
na ziemi po jej udoskonaleniu” a to sugeruje granice, której z nakazu Boga człowiek nie
powinien przekraczać w swojej ingerencji w naturę37.
Judaizm
Religia śydów jest duchem Starego Testamentu bardzo blisko chrześcijaństwa.
ChociaŜ obecnie oficjalnie judaizm wyznaje tylko około 12 milionów wiernych
(głównie w Izraelu i USA), to ze względu na prastare źródła i wpływ, jaki judaizm
wywarł na cywilizację zachodnią i historię całego świata, religia ta jest uznawana za
jeden z najwaŜniejszych wielkich systemów religijnych na Ziemi. WyróŜniającą cechą
judaizmu jest jego związek z jednym narodem - Izraelem, dla którego przez długie lata
utraty niepodległości, jedyną ostoją jedności i kultury była właśnie religia. Do dziś,
przez prawo i tradycje świętych ksiąg Biblii, Tory, Miszny i Talmudu, religia ta
znacząco wpływa na wszelkie dziedziny Ŝycia śydów, w tym równieŜ na kwestie
przyrodnicze38. W literaturze hagadycznej i Talmudzie naturę uwaŜa się za „Ŝyjącą,
czującą i myślącą”, a wypracowane na tej podstawie prawo o charakterze religijnym
moŜna dziś uznać za pierwsze w historii zasady etyczne w ochronie środowiska
naturalnego. NaleŜy do nich zasada dotycząca ograniczania „cierpienia zwierząt” (caar
baale chajjim) i zasada „nie niszcz” (bal taszchit)39. W pierwszej chodzi o niezdawanie
bólu zwierzętom (tylko ludzie mogą cierpieć - czyli rozumowo, intencyjnie przeŜywać
ból), w drugiej zasadzie punktem wyjścia jest werset z Księgi Powtórzonego Prawa,
dotyczący konkretnie drzew: „JeŜeli przez wiele dni będziesz oblegał miasto i walczył z
nim, nie zetniesz jego drzew podkładając siekierę, bo będziesz spoŜywał z nich owoce.
Dlatego ich nie zniszczysz. Czy drzewo to człowiek, byś je oblegał” (20, 19).
W zapisach Starego Testamentu (głównie Księgi Rodzaju) znajduje się
podstawowa treść religijnej hierarchii stworzeń (rośliny jako pokarm dla zwierząt i
ludzi), roli człowieka w kształtowaniu przyrody i potrzeby szacunku dla Ŝycia zarówno
Revolution and its diffusion 700-1100, Journal of Economic History 34: 8-35.
37
W islamie, szeroko pojęte zasady bioetyczne (nie tylko związane z roślinami) nie są jeszcze
dokładnie określone i wiele z nich opiera się nie na danych biomedycznych lecz na ustaleniach
religijnych i tradycyjnych, np. wg Koranu za osobę ludzką przyjmuje się zarodek po trzech
miesiącach i jednym tygodniu od zapłodnienia (setny dzień ciąŜy) a w na sztuczne zapłodnienie
religia muzułmańska zezwala tylko legalnym małŜonkom i z udokumentowanym pochodzeniem
dawcy gamet wg słów proroka Mahometa: „Poznajcie waszą genealogię, co pozwoli wam baczyć
na związki krwi” (Hadis).
38
Po odzyskaniu niepodległości, państwo Izrael na terenach Palestyny rozpoczęło wielkie dzieło
odbudowy ekologicznego rolnictwa, zalesiania wzgórz, osuszania bagien, zagospodarowywania
pustyń i ugorów. Powstały ogrody i wydajne pola uprawne wykorzystano staroŜytne i
współczesne sposoby upraw roślin gromadzących sól. KLÖCKER M., TWORUSCHKA M,
TWORUSCHKA U. Etyka wielkich religii. dz. cyt.: 121.
39
TamŜe: 120.
22
J. Brusiło
na poziomie roślin, jak i zwierząt: „Wszystko, co się porusza i Ŝyje, jest przeznaczone
dla was na pokarm, tak jak rośliny zielone, daję wam wszystko. Tylko nie wolno wam
jeść mięsa z krwią Ŝycia” (Rdz 9, 3-4). Silny wpływ religii na postawę wobec przyrody
ujawnia się nawet w sadzeniu drzew (chodzi o święto Nowego Roku Drzew Rosz-haSzana la-Ilanot obchodzonym współcześnie w Izraelu). Wywodzi się to z nakazu Księgi
Kapłańskiej (19, 23-25), Ŝeby przez trzy lata nie spoŜywać owoców nowo posadzonych
drzew, a czwartego roku owoce ofiarować w świątyni. Poza religijnym znaczeniem
drzew (ochrona wobec drzew figowych), szczególną wartość miały winna latorośl, dąb
(w Mamre, pod którym Abraham miał zbudować ołtarz), oliwka (zwiastun końca
potopu dla Noego), czy palma (symbol pełnego Ŝycia)40. Zniszczenie winnicy lub upraw
rolniczych wiązało się z cięŜką karą BoŜą. Kto załoŜył winnicę, albo nie zebrał jeszcze
plonów, był zwolniony nawet ze słuŜby wojskowej (Pwp 20, 6).
Księga Mądrości sławi obecność Boga we wszechświecie przypominając, Ŝe „z
wielkości i piękna stworzeń poznaje się przez podobieństwo ich Stwórcę” (Mdr 13, 5).
Wysławia ją równieŜ Ŝydowska tradycja chasydzka: „Gdziekolwiek idę, Ty!
Gdziekolwiek przystaję, Ty (...), gdziekolwiek się zwracam, gdziekolwiek spoglądam,
znowu Ty, zawsze Ty” (M. Buber „Opowieści chasydów”). Poza Pismem Świętym,
tradycja judaistyczna podaje szereg zapisów, które świadczą o znaczeniu roślin nie
tylko w Ŝyciu religijnym, ale i świeckim. Jedno ze źródeł odnotowuje wypowiedź rabina
Joachima ben Zakaja (I w. po Chr.): „Gdy trzymasz w ręku roślinę i ktoś ci mówi
»Mesjasz przyszedł«, zasadź ja najpierw, a później idź Go powitać”. W Ŝydowskim
„Rozdziale Pieśni” (Pereg szira), którego treść wskazuje na pochodzenie od mistyków,
kilka rozdziałów omawia świat fizyczny, świat roślin i drzew, świat zwierząt
pełzających, świat ptaków i zwierząt lądowych. Omówienie kaŜdego rozdziału opiera
się na cytatach z Pisma Świętego i przedstawia ścisły związek opisywanej przyrody z
porządkiem społecznym, zasad moralnych, ludzkiej pomyślności oraz troski człowieka
o stworzenie41. Nieprzypadkowo wybór tekstów biblijnych uzasadnia takie integralne
widzenie rzeczywistości. Opisy przyrody, księgi poetyckie i psalmy, cała Biblia ukazuje
prawdę o Bogu, człowieku i m.in. o roślinności, która towarzyszy dziejom zarówno
całego narodu izraelskiego, jak i kaŜdemu religijnemu śydowi. Słowo „roślina” jest
uŜyte w Starym Testamencie tylko 19 razy ale juŜ słowo „drzewo” występuje
w róŜnych kontekstach 310 razy, owoc - 162 razy, las - 46 razy a kwiat - 50 razy (nie
licząc oczywiście tekstów Nowego Testamentu).
Wszystkie nauki judaizmu pozwalają sformułować zasadę: wszelkie zmiany w
obszarze przyrody, wykorzystanie, spoŜywanie roślin jest moŜliwe na podstawie
znanego tekstu „czynienia sobie ziemi poddaną”, ale działanie człowieka ma: a) być
zgodne z wolą BoŜą; b) słuŜyć dobru człowieka; c) budować jedność świata
stworzonego. Nawet przez analogię moŜna zaryzykować twierdzenie o religijnym
przyzwoleniu na modyfikację genetyczną roślin, poniewaŜ niektóre autorytety religijne
judaizmu dopuszczają techniki genetyczne u człowieka, przynajmniej w celu leczenia
człowieka (rabbi Azriel Rozenfeld)42.
W judaizmie, jeszcze bardziej niŜ w islamie i zupełnie inaczej niŜ w innych
wielkich Religach Wschodu, przyroda jest podporządkowana człowiekowi, a rośliny
wykorzystywane przez człowieka. Podstawową zasadą w Ŝydowskim stosunku do
świata jest koncepcja istoty ludzkiej, w której ciało i dusza tworzą nierozdzielną całość.
Na tym tle naleŜy analizować kwestie „ekologiczne” i „biotechnologiczne”. Człowiek
40
BANEK M. Rośliny. dz. cyt.: 485-487.
KLÖCKER M., TWORUSCHKA M, TWORUSCHKA U. Etyka wielkich religii. dz. cyt.: 119.
42
DORFF E.N. 1998. Matters of Life and Heath. A Jewish Approach to Modern Medical Ethics,
The Jewish Publication Society, Philadelphia and Jerusalem 5758: 162-163.
41
WIELKIE RELIGIE ŚWIATA WOBEC ROŚLIN I ICH MODYFIKACJI
23
przedstawia sobą mikrokosmos, składający się z wielu duchowych i fizycznych
komponentów, zharmonizowanych w doskonałą jedność, tworzących precyzyjną,
idealną równowagę, której zakłócenie przynosi natychmiast negatywne skutki (rabin E.
Munk). W tej jedności zawarta jest równieŜ wartość roślin, drzew, upraw rolnych i
piękna przyrody, lecz wkomponowana w hierarchię waŜności i podporządkowana
człowiekowi43.
Chrześcijaństwo
Religia chrześcijańska44, najlepiej znana w naszym kręgu kulturowym, ma chyba
najwięcej elementów i symboli roślinnych związanych z wiarą i tradycjami duchowymi.
Są one często wpisane w zwyczaje i Ŝycie codzienne wielu katolików w Polsce. W
związku z tym, problematyka chrześcijaństwa wobec roślin i ich modyfikacji wymaga
osobnego opracowania (zwłaszcza wśród mistyków środowiska naturalnego - na
przykładzie św. Franciszka z AsyŜu i w czasach najnowszych, co wynika z nauczania
Kościoła katolickiego na temat środowiska naturalnego i ekologii), i w tym miejscu
będzie jedynie zasygnalizowana.
Podstawowym punktem wyjścia w powiązaniu religii i roślin, wspólnym dla
judaizmu i chrześcijaństwa, jest opis stworzenia roślin w dniu trzecim: „I rzekł [Bóg]:
»Niechaj ziemia wyda rośliny zielone: trawy dające nasiona, drzewa owocowe rodzące
na ziemi według swego gatunku owoce, w których są nasiona «.I stało się tak” (Rdz 1,
11). W dziejach chrześcijaństwa rośliny były poświęcane, błogosławione i
egzorcyzmowane. Były takŜe poŜywieniem, lekarstwem, miały znaczenie ekonomiczne,
społeczne i kultowe (w Eucharystii, najdoskonalszej ofierze, wykorzystuje się mąkę
zbóŜ i sfermentowany moszcz winnej latorośli). Bardzo rozpowszechnione były
motywy roślinne w dekoracji świątyń chrześcijańskich45, w sztuce, architekturze, w
symbolice religijnej i w analizach teologicznych (jako znaki i atrybuty)46.
W Europie i w kręgu kultury zachodniej w naukach o roślinach, czy to prowadzonych w sposób tradycyjny, czy w zaawansowanych modyfikacjach roślin (takŜe
genetycznych), religia chrześcijańska ma znaczący udział w kształtowaniu nie tylko
etyki środowiska roślinnego człowieka, ale takŜe w budowaniu oryginalnej koncepcji
szeroko rozumianego Ŝycia, które w pięknie, zastosowaniach i moŜliwościach świata
roślin stanowi część chrześcijańskiej duchowości. Jest ona oparta o dane Pisma
Świętego, teologii i filozofii chrześcijańskiej tradycji oraz współczesnych dokumentów
43
Jedność powinna dotyczyć takŜe ludzkiego serca i rozumu, takŜe sprawiedliwość i miłosierdzie
stapiają się w jedno: tsedek. W etyce tsedek oznacza to samo: sprawiedliwość i miłosierdzie.
GUIGUI A. 1996. Moralność Ŝydowska wobec medycyny i biotechnologii, w: Medycyna a prawa
człowieka. Normy i zasady prawa międzynarodowego, etyki oraz moralności katolickiej,
protestanckiej, Ŝydowskiej, muzułmańskiej i buddyjskiej. Kleczewska B. (red.), przekład Iwona
Kaczyńska, Wydawn. Sejmowe, Warszawa: 42.
44
Chrześcijaństwo naleŜy rozumieć w połączeniu trzech części: katolicyzm, prawosławie i
protestantyzm, w sumie ok. 1 miliarda 700 milionów wiernych, i w tym ujęciu jest to największa i
najbardziej rozpowszechniona religia na świecie. W niniejszym opracowaniu religijne role roślin
mogą być rozumiane, zarówno w pierwszych wiekach chrześcijaństwa niepodzielonego, jak i w
tradycjach róŜnych kościołów w dobie współczesnej.
45
Piękną syntezę teologii stworzenia (witraŜ „Bóg Stwórca”), motywów roślinnych na polichromiach Stanisława Wyspiańskiego oraz franciszkańskiego przeŜywania przyrody znaleźć
moŜna w Bazylice Franciszkanów w Krakowie.
46
KOBIELUS St. 2006. Florarium christianum. Symbolika roślin - chrześcijańska staroŜytność i
średniowiecze. Tyniec. Wydawn. Benedyktynów, Kraków: 13-15.
24
J. Brusiło
Kościoła katolickiego. Nowy Testament daje podstawy do całkiem nowej w historii
wszystkich religii teologii wszystkich istnień Ŝywych, które wraz z człowiekiem (na
odpowiednim dla siebie poziomie) bierze udział w dziele odkupienia i doskonalenia
przez Boga: „Stworzenie z upragnieniem oczekuje objawienia się synów BoŜych.
Stworzenie bowiem zostało poddane marności - nie z własnej chęci, ale ze względu na
Tego, który je poddał - w nadziei, Ŝe równieŜ i ono zostanie wyzwolone z niewoli
zepsucia, by uczestniczyć w wolności i chwale dzieci BoŜych. Wiemy przecieŜ, Ŝe całe
stworzenie aŜ dotąd jęczy i wzdycha w bólach rodzenia” (Rz 8, 19-22).
Św. Paweł w „Liście do Rzymian” otwiera głęboko duchową perspektywę świata
stworzonego, świata roślin, który nie tylko „jest dobry”, jak mówi Bóg przy stworzeniu
(Księga Rodzaju), ale mimo skaŜenia złem i śmiercią (wskutek grzechu człowieka),
odradza się i dostępuje „wyzwolenia z niewoli zepsucia”. Świat roślin jest zatem
miejscem objawienia się Boga, miejscem przyjścia Syna BoŜego i miejscem
zamieszkania Ducha Świętego w ludzkim ciele. Świat ten nie jest jednak światem na
sposób panteistyczny, jak w innych religiach, lecz jest światem świętości, mistyki,
uczestnictwa w Ŝyciu Stwórcy. Jest to obecność w świecie stworzonych roślin
wszystkich Trzech Osób Boskich i spirytualizacja materii47 (m.in. wspomniany symbol
trójlistnej koniczyny niesie w swoim kształcie tą treść teologiczną). Chrześcijaństwo
uczy, Ŝe Chrystus jako „ośrodek wszechświata i historii”48 przez Wcielenie wkracza w
Ŝycie świata, a przez dzieło Odkupienia wybawia świat z grzechu, cierpienia i śmierci.
Jednak świat to człowiek i stworzenie, dlatego moŜemy mówić, Ŝe Chrystus odkupił nie
tylko samego człowieka, ale równieŜ przyrodę, rośliny i zwierzęta. „KaŜda roślina,
której nie sadził mój Ojciec niebieski, będzie wyrwana” (Mt 15, 13) powiedział Jezus
do faryzeuszy, którzy odrzucili Dobrą Nowinę o zbawieniu. Świata stworzonego jednak
nie potępił. W sensie ścisłym, w myśl Pisma Świętego, nauczania Kościoła i refleksji
teologicznej, moŜna powiedzieć, Ŝe fakt zmartwychwstania Chrystusa jest obietnicą i
nadzieją dla całej przyrody49, i roślin równieŜ. Nieprzypadkowo, świat roślin był dla
Chrystusa nie tylko środowiskiem Ŝycia, lecz takŜe pozwalał na wykorzystanie do głoszonych przez siebie prawd. Jezus mówił o liliach, które były piękniejsze od przepychu
Salomona (Mt 6, 27-29), o ziarnku gorczycy (Mt 13, 31-32), o trzcinie (Mt 12, 20), o
chwaście (Mt 13, 37-38), o kłosach zbóŜ (Mt 12, 1), o drzewie figowym (Łk 21, 29-30).
Tak jak w ludzkiej historii zbawienia, dopełnieniem stworzenia jest paruzja, powtórne
przyjście Chrystusa na końcu czasów, tak teŜ obecny świat przyrody (świat roślin)
równieŜ zostanie odrodzony, pozbawiony niedoskonałości („I ujrzałem niebo nowe i
ziemię nową” Ap 21, 1). Będzie to świat rzeczywisty, a zarazem doskonały, złoŜony tak
samo, jak obecnie z roślin i krajobrazu, lecz przekształcony na doskonałe środowisko
Ŝycia dla nowego człowieka. Bóg mocą zmartwychwstania odnowi świat na końcu
czasów i rośliny nie przestaną istnieć, tylko zostaną przeniknięte BoŜą miłością, która
nie unicestwia, lecz wyzwala z „niewoli znikomości”50. (MoŜe taką namiastką wiecznej
miłości w świecie roślin jest kwiat róŜy ...)
Ta głęboka teologia przyrody była bliska początkom chrześcijańskiej nauki (w
prostej katechezie), oraz średniowiecznym dziełem scholastycznym. Zawsze
47
URBAŃSKI St. 2001. Mistyka ekologicznej duchowości świata, w: Ochrona środowiska społeczno-przyrodniczego w filozofii i teologii. Dołega J.M., Czartoszewski J.W., Skowroński A.
(Red.), Wydawn. Uniwersytetu Kardynała Stefana Wyszyńskiego, Warszawa: 313-314.
48
Jan Paweł II, Encyklika Redemptor hominis 1.
49
KĘDZIERSKI P. 1997. Kościół i ekologia. WyŜsze Seminarium Duchowne w Rzeszowie, Rzeszów: 64, 70.
50
Konstytucja duszpasterska o Kościele w świecie współczesnym Soboru Watykańskiego II
(KDK 39). Cyt. za: Paruzja dopełnieniem stworzenia, (oprac. zespołu), w: Konferencje ekologiczne, Fetkowski A. (Red.), Zakład Ekologii Człowieka KUL, Lublin 1995: 104-105.
WIELKIE RELIGIE ŚWIATA WOBEC ROŚLIN I ICH MODYFIKACJI
25
chrześcijańskie widzenie świata roślin i zwierząt było przeniknięte Duchem, a wielu
świętych i uczonych tamtych czasów opierało swoją wiarę i wiedzę przede wszystkim
na Bogu i na interpretacji dzieła stworzenia. Na przykład Filon z Aleksandrii
udowadniał, Ŝe stworzenie roślin w trzecim dniu, przed słońcem w czwartym dniu, ma
pokazać człowiekowi, Ŝe nie słońce jest dawcą Ŝycia i wzrostu, lecz Bóg51. W wiekach
średnich panowała nawet oryginalna doktryna teologiczno-przyrodnicza zwana
„egzemplaryzmem” - sztuką odnajdywania Boga we wszystkich stworzeniach, które są
Jego symbolem lub obrazem. W staroŜytnych i średniowiecznych florariach moŜna
znaleźć przeróŜne symbole religijne roślin, drzew, ziół, przypraw, zbóŜ, jarzyn i
kwiatów52 oraz opisy religijnych znaczeń części roślin: kłosu, kory, korzenia, skórki
owocu, kwiatu, liści, słomy (łodygy), czy ziarna.
Przedmiotem religijnej refleksji poddawano nie tylko Ŝywe rośliny, ale takŜe, np.
drewno, materiał czysty, szlachetny, wzbudzający szacunek i sympatię. W
średniowieczu chrześcijańskim uwaŜano drewno za materia prima, wykorzystując je w
rzeźbie sakralnej (aniołowie, święci), oraz sięgając głębiej - do ideału drewna Świętego
KrzyŜa, nieprzypadkowo podkreślając teŜ, Ŝe Jezus był synem cieśli53.
Z średniowiecznych chrześcijańskich tradycji religijno-filozoficznych na uwagę
zasługuje postawa świętych (Ojcowie pustyni, św. Antoni Pustelnik, św. Benedykt),
którzy zarówno w postępowaniu, jak i w swoich pismach (nauczaniu) ukazali
praktyczny wymiar biblijnej i teologicznej nauki o stworzeniu oraz - powiedzielibyśmy
dzisiaj - „ekologicznego” traktowania roślin czy zwierząt. Wybitną postacią w tym
zakresie był św. Franciszek z AsyŜu (ur. latem lub jesienią 1181 r. w AsyŜu, zm. 3 X
1226 r. w Porcjunkuli pod AsyŜem), który stworzył nie tylko swoistą etykę szacunku
dla stworzeń, ale w swojej mistyce i odniesieniu do Boga pokazał, jak bardzo waŜnym
elementem Ŝycia i ducha osoby ludzkiej są nawet najprostsze organizmy Ŝywe54.
Rośliny, zwłaszcza w swoim pięknie ubogacają otaczający świat i są odbiciem piękna i
mądrości Stwórcy. Św. Franciszek rozpoczął swoją medytację przyrody od krzyŜa w
zaniedbanym kościółku San Damiano. Doszedł do takiego mistycznego zrozumienia
stworzeń, Ŝe w słynnej „Pieśni Słonecznej” nie zawarł ani jednego słowa o
zmartwychwstaniu Chrystusa, a świat widział juŜ odkupionym, uduchowionym i
doskonałym: „(...) Pochwalony bądź, Panie mój, przez siostrę naszą matkę ziemię, która
nas Ŝywi i chowa, wydaje róŜne owoce z barwnymi kwiatami i trawami”.
Św. Franciszek z AsyŜu uznaje „wszelkie stworzenie” za „drabinę, po której
wstępował, aby spotkać Tego, który jest cały godny pragnienia (Pnp 5, 16)”. Cały świat
przyrody (a więc i rośliny) w ujęciu pism, prac teologicznych i tradycji św. Franciszka
zyskuje nie tylko znane w innych religiach oceny etyczne, ale poprzez mistykę
stworzenia i ducha BoŜego obecnego w roślinach, zwierzętach, ptakach i owadach,
franciszkanizm wchodzi głęboko w samą istotę Ŝycia i pozwala na „uduchowienie”
Ŝycia nawet na poziomie molekularnym, stawiając ingerencjom genetycznym jeszcze
51
KOBIELUS St.. Florarium christianum. Symbolika roślin. dz. cyt.: 10.
ostatnio wydanym zbiorze chrześcijańskich symbolów roślinnych, samych roślin jest opisanych około 120 gatunków, por. KOBIELUS St. Florarium christianum. Symbolika roślin. dz. cyt.
53
PASTOUREAU M. 2006. Średniowieczna gra symboli. Oficyna Naukowa, Warszawa: 93-95.
Dyskusyjna jest moim zdaniem argumentacja cytowanego autora, Ŝe „teksty kanoniczne nie
określały dokładnie zawodu Józefa” (s. 94). Powszechnie uŜywany tekst Biblii Tysiąclecia
wyraźnie wskazuje na Jezusa jako „syna cieśli” (Mt 13, 55) i bezpośrednio mówi o Jezusie „jest
to cieśla” (Mk 6, 3) [przyp. mój: J. B.].
54
„RozwaŜając początek wszystkich stworzeń [Franciszek] oŜywiał coraz bardziej swą poboŜność i wszystkie stworzenia, choćby najmniejsze, nazywał braćmi lub siostrami, poniewaŜ
wiedział, Ŝe razem z nim pochodzą z tego samego Źródła”. Św. Bonawentura, śyciorys Większy
św. Franciszka, rozdz. VIII 6: 1-11.
52
26
J. Brusiło
większe wymagania religijne i filozoficzne niŜ „zwykłe” etyczne zakazy czy warunki w
modyfikacjach roślin.
Zarówno św. Franciszek, jak i teologia średniowieczna głęboko afirmują rośliny i
całe stworzenie. BliŜsza naszym czasom, św. Teresa Benedykta od KrzyŜa - Edyta
Stein, badając filozofię i teologię św. Augustyna i św. Tomasza z Akwinu
przeprowadziła ciekawą refleksję nad duszą roślin. Według niej dusza rośliny istnieje
przede wszystkim w powiązaniu ze światem zewnętrznym, nie tylko w kształtowaniu
materii, ale takŜe istnieniem samym w sobie55. Współczesne kwestie dotyczące
hierarchii wartości w przyrodzie, znaczenia roślin w Ŝyciu człowieka i biosfery
(zawłaszcza na tle ostatnio nagłaśnianego problemu ocieplania klimatu i redukcji
dwutlenku węgla) przekładają się zazwyczaj na poszukiwania rozwiązań etycznych i
poprawnych eko-filozofii. Alternatywne do chrześcijańskiej, „nowoczesne” wizje
równości między człowiekiem a naturą (czyli np. zrównanie statusu osoby ludzkiej z
istnieniem roślin), nie pomogą w Ŝyciu na naszej planecie ani człowiekowi, ani
roślinom. Nawet tworzenie panteistycznych pseudoreligii (jak w koncepcji E.
Haeckla56, czy znane idee New Age) nie mogą zmienić wielowiekowych, bogatych
tradycji wielkich religii w kontekście świata przyrody dawnych i obecnych cywilizacji.
Współczesne nauczanie Kościoła katolickiego o roślinach
Najmłodszą częścią w chrześcijańskiej koncepcji Ŝycia roślin są wypowiedzi
Nauczycielskiego Urzędu Kościoła, które nie tylko uzupełnia, rozbudowuje biblijną i
tradycyjną myśl religijną o stworzeniu, ale - zwłaszcza w nauczaniu Jana Pawła II kreśli nowe, adekwatne do współczesnych problemów ekologicznych i cywilizacyjnych
koncepcje troski o zagroŜony świat przyrody, odpowiedzialności człowieka za
przyszłość środowiska oraz apeluje o zachowanie zasad i praw Stwórcy wszelkiego
Ŝycia.
Analizę całości bogatego nauczania Kościoła katolickiego na temat roślin,
przyrody i ekologii pewnie trzeba będzie odłoŜyć na inną okazję, objętościowo
wykraczałaby ona poza ramy tego artykułu, ale z punktu widzenia religijnego, warto w
tym miejscu odnotować przynajmniej jeden dokument: „Wspólna deklaracja PapieŜa
Jana Pawła II i Patriarchy Bartłomieja I, O obowiązku szanowania świata
stworzonego”57. W pełnych nadziei słowach, nie tylko z racji religijnych, ale teŜ
humanistycznych Deklaracja ta kreśli perspektywę odnowy ludzkiego spojrzenia na
przyrodę, rośliny i zwierzęta tak, by moŜna było wrócić do „przywrócenia pierwotnej
harmonii”. Dokument formułuje trzy postulaty:
„Po pierwsze, musimy na nowo przyjąć postawę pokory i uznać ograniczoność
naszej władzy, a co waŜniejsze — naszej wiedzy i zdolności wydawania sądów.
Podejmujemy decyzje, działamy i ustalamy wartości, które oddalają nas od takiego
świata, jakim powinien on być, od BoŜego planu stworzenia, od wszystkiego, co istotne
55
DYDUCH-FALNIOWSKA A., GRZEGORCZYK M. 2000. Dusze roślin i zwierząt, w: Między niebem a
ziemią. Ku etyce ekologicznej. Dyduch-Falniowska A., Grzegorczyk M., Kijas Z., Mirek Z.
(Red.), Instytut Ochrony Przyrody PAN, Kraków: 178.
56
ŁUKOMSKI J. 2000. Próba zbudowania chrześcijańskiej etyki środowiska naturalnego. Wydawn. Jedność, Kielce: 123.
57
W dniach 5-10 czerwca 2002 r. odbyło się w Wenecji pod patronatem Ekumenicznego
Patriarchy Konstantynopola Bartłomieja I sympozjum poświęcone «Religii, nauce, środowisku».
Podczas ostatniej sesji, 10 czerwca w weneckim Pałacu DoŜów, została podpisana przez Jana
Pawła II i Bartłomieja I wspólna deklaracja o ochronie dzieła stworzenia. ”L’Osservatore
Romano”, wyd. pol. n., 10-11/2002: 4-5.
WIELKIE RELIGIE ŚWIATA WOBEC ROŚLIN I ICH MODYFIKACJI
27
dla zdrowia naszej planety oraz całej wspólnoty ludzkiej. Potrzeba nowego podejścia i
nowej kultury, opartych na przekonaniu o centralnym miejscu osoby ludzkiej w dziele
stworzenia oraz na postępowaniu zgodnym z etyką środowiskową wywodzącą się z
trojakiej więzi: z Bogiem, samym sobą i ze stworzeniem. Taka etyka sprzyja wzajemnej
zaleŜności i kładzie nacisk na zasady powszechnej solidarności, sprawiedliwości
społecznej i odpowiedzialności, dzięki czemu moŜliwe staje się krzewienie prawdziwej
kultury Ŝycia.
Po drugie, musimy uczciwie przyznać, Ŝe ludzkość ma prawo do czegoś lepszego
niŜ to, co dostrzegamy wokół siebie. My sami, a tym bardziej nasze dzieci i przyszłe
pokolenia, mamy prawo do lepszego świata, świata wolnego od zniszczenia, przemocy i
rozlewu krwi, świata, w którym panują wspaniałomyślność i miłość.
Po trzecie, świadomi wartości modlitwy, musimy wytrwale prosić Boga Stwórcę,
by oświecił wszystkich ludzi i przekonał ich o obowiązku szanowania i strzeŜenia z
troską świata stworzonego”58.
Dzięki wspomnianemu papieŜowi, którego nauczanie proekologiczne stanowi
współcześnie nie tylko najnowszą wykładnię dokumentów Kościoła katolickiego o
człowieku i przyrodzie, ale którego etyka pozwala na zbudowanie w przyszłości jeszcze
lepszych rozwiązań ekoetycznych dla nauki, technologii i postępu cywilizacyjnego
świata. Wydaje się waŜniejszym, nie tylko to co ludzkość zrobi obecnie ze zniszczonym
środowiskiem i skutkami globalnego ocieplenia, ale to jak według ducha doskonałości
stworzenia (który wyraŜają wielkie religie) dla dobra człowieka potraktować przyszłość
inŜynierii genetycznej roślin, wykorzystać bezpiecznie Ŝywność zmodyfikowaną
genetycznie, zachować róŜnorodność genetyczną i ocalić moŜliwie wszystkie gatunki
roślin i zwierząt w skali globalnej dla wielu następnych pokoleń. Mimo wielu
nieznanych jeszcze konsekwencji tych głębokich ingerencji, Kościół katolicki wyraŜa
bardziej ostroŜne przyzwolenie, niŜ kategoryczny zakaz, pod warunkiem zachowania
odpowiedniej perspektywy antropologicznej i teologicznej.
W najnowszych interpretacjach ekoetyki Jana Pawła II, jako reprezentanta
chrześcijaństwa w temacie modyfikacji roślin i przyrody mówi się o umiarkowanym
antropocentryzmie aksjologicznym albo o teocentryzmie. W istocie, ostatecznie w
działaniu człowieka to Bóg powinien być ostateczną racją wszelkich zmian środowiska
i modyfikacji in vivo i in vitro roślin. Jan Paweł II słusznie uznaje, Ŝe przyszłość świata
stworzonego przez Boga wykracza poza to, co jest potrzebne ze środowiska
człowiekowi59. Człowiek posiadający potęŜne narzędzia budowania (i niszczenia...)
zawsze sobie poradzi, ale przyroda nie ma takich moŜliwości, dlatego teŜ nie tylko racje
nadprzyrodzone, religijne (jak w religiach Wschodu), lecz pogłębiona refleksja
teologiczna i antropologiczna (jak w chrześcijaństwie) jest w stanie ochronić świat
przyrody przed zniszczeniem. To jest zadanie dla szeroko pojętego duszpasterstwa,
teologii praktycznej chrześcijan zatroskanych o dziką i zmodyfikowaną przyrodę, oraz
dla nauki i wiary60.
58
TamŜe: 5.
SZEBESTA A. 2007. Ekoetyka w nauczaniu Jana Pawła II, w: Ks. Karol Wojtyła - Jan Paweł II
miłośnik gór i przyrody. Mat. z konf. nauk. zorganizowanej w Akademii Wychowania Fizycznego
w Krakowie, 13 października 2005 roku, Wójcik W.A. (Red.), AWF Kraków, Polskie
Towarzystwo Turystyczno-Krajoznawcze Centralny Ośrodek Turystyki Górskiej, Kraków: 126.
60
„W sferze badań przyrodniczych rozpowszechniła się stopniowo mentalność pozytywistyczna,
która nie tylko zerwała wszelkie powiązania z chrześcijańską wizją świata, ale - co waŜniejsze zrezygnowała teŜ z wszelkich odniesień do wizji metafizycznej i moralnej. W wyniku tego
zaistniało niebezpieczeństwo, Ŝe niektórzy ludzie nauki, rezygnując z jakichkolwiek odniesień
etycznych, nie stawiają juŜ w centrum swej uwagi osoby ludzkiej i całości jej Ŝycia. Co więcej,
część z nich, świadoma moŜliwości otwartych przez rozwój techniki, wydaje się ulegać nie tylko
59
28
J. Brusiło
Zakończenie
Z perspektywy wielkich duchowości świata, religie Wschodu i Zachodu
z szacunkiem odnoszą się do istnienia zarówno wieloletniego, potęŜnego dębu,
w którym wiele ludów widzi wieczne bóstwo, jak i do delikatnego, jednodniowego
źdźbła trawy, która stanowi pokarm dla zwierząt i stanowi dowód na potęgę Ŝycia, które
pochodzi od Stwórcy. Z biegiem historii, poszczególne systemy religijne w swoim
stosunku do przyrody przechodzą pewną ewolucję: od ubóstwienia roślin i zwierząt,
poprzez wkomponowanie przyrody w słuŜbę człowiekowi, ustalenie charakterystycznej
dla duchowości hierarchii przyrody i skierowanie całego Ŝycia ku Bogu, aŜ po
włączenie świata istot Ŝywych w BoŜe dzieło odkupienia człowieka i udoskonalenia
natury. Zawsze człowiek jest szczególną częścią tej ewolucji i dziś lekkomyślnie
zawłaszczając biosferą całej planety, musi bardziej sięgać do filozofii i religii, aby nie
zniszczyć siebie i przyrody. Ani ekocentryczne uduchowienie przyrody, ani
desakralizacja Ŝycia środowiska naturalnego nie jest duchową przyszłością dla
najmniejszej nawet roślinki. Są to jednak wartości nadprzyrodzone. Zachowanie
BoŜych zasad w wielkich religiach w perspektywie globalnych moŜliwości modyfikacji
świata przyrodniczego są szansą dla integralnego, adekwatnego i transcendentalnego
Ŝycia człowieka. Człowiek ten został umieszczony w świecie, który po całym dziele
stworzenia przez Boga był przecieŜ „bardzo dobry” (Rdz 1, 31).
Chrześcijaństwo, czerpiące swe źródła ze Starego i Nowego Testamentu (który
jest takŜe wielką księgą o stworzeniu przyrody), wraz ze współczesnym nauczaniem
Kościoła katolickiego o przyrodzie, jej przemianach i przyszłości wyraŜa dla całego
świata istotne przesłanie. Szacunek naleŜy się kaŜdemu Ŝywemu stworzeniu, kaŜdej
roślinie (jak np. w buddyzmie i hinduizmie), takŜe zachwyt nad pięknem przyrody (jak
np. w islamie), potrzebna jest jednak przede wszystkim troska o przyszłość (istnienie)
przyrody nietkniętej jeszcze przez cywilizację oraz praktyczne, odpowiedzialne i wręcz
mistyczne (jak u św. Franciszka z AsyŜu) podejście do jakichkolwiek modyfikacji
przyrodniczych61, aby Ziemia i jej zasoby nadal cieszyła ludzkość nie w duchu
uŜyteczności dla człowieka, ale w duchu stworzenia przez Boga.
Słowa kluczowe:
Bóg, buddyzm, etyka, hinduizm, ochrona śeodowiska, przyroda
Streszczenie
Człowiek od początku swojego istnienia rodził się, wzrastał i umierał wśród
roślin, stąd w religiach pierwotnych i współczesnych przyroda miała dla ludzkości
znaczenie teologiczne.
W buddyzmie, zwłaszcza w odmianie tybetańskiej (Tibetan Buddhism), wśród
wysokich gór i surowych warunkach klimatycznych, rośliny były leczniczym darem
bogów, źródłem energii, uosobieniem licznych tybetańskich demonów i bóstw. W
logice rynku, ale takŜe pokusie zdobycia demiurgicznej władzy nad przyrodą, a nawet nad samym
bytem ludzkim”. Jan Paweł II, Encyklika o relacjach między wiarą a rozumem Fides et ratio, 46.
61
Świadomie pomijam kwestię jak poprawnie interpretować nakaz dany dla człowieka w Księdze
Rodzaju „abyście zaludnili ziemię i uczynili ją sobie poddaną” (1, 28), poniewaŜ biblijne
znaczenie tego zapisu nie dotyczy wprost rozumienia „modyfikacji” w naszym temacie i znajduje
wyczerpujące przedstawienie w innych analizach. Por. SYNOWIEC J. St., Na początku. Pradzieje
biblijne: Rdz 1, 1-11, 9, wyd. II popr. i rozszerz., Bratni Zew, Kraków 1996: 74-75.
WIELKIE RELIGIE ŚWIATA WOBEC ROŚLIN I ICH MODYFIKACJI
29
hinduizmie (Hindoo) oprócz funkcji Ŝyciodajnej i leczniczej, rośliny stanowią część
porządku istnienia, posiadają funkcje duchowe i zmysłowe. Islam przynosi jeszcze
jedno znaczenie teologiczne roślin – są one dowodem na istnienie Boga i darem Boga
dla ludzi, stąd często pełnią funkcję estetyczną, słuŜą do ozdabiania świątyń i domów
mieszkalnych.
W świętych księgach judaizmu, rośliny i całą naturę uwaŜa się za czującą
i myślącą, dlatego teŜ w tej religii pojawiają się pierwsze przepisy religijno-etyczne
chroniące środowisko przyrodnicze – Bóg jest w Biblii dawcą przykazań i prawa
chroniącego całą przyrodę, która ma słuŜyć człowiekowi. Chrześcijaństwo, ściśle
związane ze światem zachodnim, rozwija judaistyczne wątki etyki środowiska naturalnego m.in. w formie mistyki św. Franciszka z AsyŜu oraz rozbudowanego w
naszych czasach nauczania Kościoła katolickiego na temat środowiska naturalnego.
Pismo Święte i tradycja chrześcijańska wykorzystywały przykłady roślin do
ukazywania prawd religijnych, włączały przyrodę w dzieło zbawienia i dały podstawę
do współczesnej chrześcijańskiej etyki środowiska naturalnego. Nauczanie Kościoła
katolickiego, szczególnie w dokumentach papieŜa Jana Pawła II, włącza się w globalną
debatę na temat problemów ekologicznych i cywilizacyjnych. Jednym z waŜnych apeli
o zachowanie zasad i praw zagroŜonej przyrody jest Deklaracja wspólna papieŜa Jana
Pawła II i patriarchy Bartłomieja I: „O obowiązku szanowania świata stworzonego”
(2002 r.), (Common Declaration of John Paul II and The Ecumenical Patriarch His
Holiness Bartholomew I on Environmental Ethics – 2002).
GREAT RELIGIONS OF THE WORLD IN RELATION
TO PLANTS AND THEIR MODIFICATIONS
Jerzy Brusiło
Order of the Conventual Minor Brother,
Interfaculty Department of Bioethic,
Papal Theological Academy, Kraków
Key words:
God, Buddhism, environmental protection, ethic,
Judaism, nature
Hinduism, Islam,
Summary
Since the beginning of his existence man was born, grew up, and died among
plants, thus both in primeval and contemporary religions nature has theological meaning
for human beings.
In Buddhism, especially in its Tibetan version (Tibetan Buddhism), among high
mountains and in serious environmental conditions plants were considered to be
medical gift from gods, energy source and personification of numerous Tibetan gods
and demons. In Hinduism (Hindoo) apart from life-giving and medical functions, plants
are a part of the order of universe playing spiritual and sensual functions. Islam brings
another theological meaning of plants – they are the proof for God existence and gift
from God to people, thus they often play an esthetic role as temple and house
decoration.
In the Judaic Holly Books plants and the entire nature are considered to be beings
that are able to feel and think, thus this religion presents us with the first religious-ethic
rules protecting the environment. God in the Bible is a donor of commandments and the
law protecting the entire environment that should serve human beings. Christianity, as
30
J. Brusiło
close connected with the western world develops the Judaic trends of environmental
ethic, e.g. in the form St. Francis of Assisi mysticism as well as the teaching of the
Church on the natural environment, greatly developed at the present time. Both the
Scriptures and Christian tradition used the examples of plants to demonstrate the
religious truth, including nature into the act redemption and giving the base for the
present Christian ethic of natural environment. The teachings of Catholic Church
especially in the documents by John Paul II joins the global discussion on ecological
and civilization problems. One of the very important appeal for the preservation of rules
and rights of endangered nature is „Common Declaration of John Paul II and The
Ecumenical Patriarch His Holiness Bartholomew I on Environmental Ethics” (2002).
Dr ks. Jerzy Brusiło
Międzywydziałowy Instytut Bioetyki
Papieska Akademia Teologiczna
ul. Franciszkańska 1
31-004 KRAKÓW
ZESZYTY PROBLEMOWE POSTĘPÓW NAUK ROLNICZYCH 2007 z. 523: 33-41
WPŁYW SUBSTANCJI WZROSTOWYCH
NA PLOIDALNOŚĆ TKANEK ŚNIEśYCZEK
ROZMNAśANYCH TECHNIKĄ in vitro 1
Anna Bach, BoŜena Pawłowska
Katedra Roślin Ozdobnych, Akademaia Rolnicza im. H. Kołłątaja w Krakowie
Wstęp
ŚnieŜyczki naleŜą do popularnych i cenionych cebulowych roślin wiosennych.
ŚnieŜyczka Elwesa (Galanthus elwesii HOOK) pochodząca z Azji Mniejszej jest masowo
pozyskiwana ze stanowisk naturalnych i stanowi jedną z najwaŜniejszych ozdobnych
roślin cebulowych eksportowanych z Turcji do Europy Zachodniej. ŚnieŜyczka
przebiśnieg (Galanthus nivalis L.) jest chronionym gatunkiem krajowym występującym
na Podkarpaciu i uprawianym w ogrodach od XVI wieku. Tradycyjny, wegetatywny
sposób rozmnaŜania śnieŜyczek z cebul przybyszowych jest powolny i mało wydajny, a
osobniki rozmnaŜane generatywnie nie powtarzają cech roślin matecznych. Jednym ze
sposobów zwiększenia wydajności tego procesu jest zastosowanie metody in vitro
[BACH i in. 2002, 2003; BACH, PAWŁOWSKA 2005; CANTLIFFE 2001; TIPIRDAMAZ i in. 2000].
Liczne przykłady w literaturze wskazują na istnienie genetycznej zmienności w
kulturach in vitro, która moŜe być związana ze zmianą wielkości genomu roślin oraz
poziomu ploidalności. Szczególnie komórki tworzące kalus nie stanowią jednolitej pod
względem genetycznym populacji i przynajmniej część z nich moŜe ulec daleko idącym
modyfikacjom [KONONOWICZ 1990; VAN HERMELEN i in. 1997]. Poziom ploidalności moŜna
określić na podstawie zawartości DNA w jądrach komórkowych. Znając stopień
ploidalności roślin kontrolnych, poprzez porównanie połoŜenia pików odpowiadających
tym samym fazom cyklu komórkowego, moŜna oznaczyć stopień ploidalności badanych
roślin [DOLEZEL 1991; DOLEZEL i in. 1998; ŚLIWIŃSKA 2002].
Materiał i metody
Badaniom cytometrycznym poddano łuski cebulowe pobrane z młodych cebul
śnieŜyczek (Galanthus elwesii HOOK i Galanthus nivalis L.). Cebule te uzyskano
wyniku rozmnaŜania techniką in vitro na drodze organogenezy i somatycznej
1
Badania realizowano w ramach projektu badawczego nr 3 P0 4G 11625 finansowanego przez
Komitet Badań Naukowych.
34
A. Bach, B. Pawłowska
embriogenezy, a materiałem wyjściowym do załoŜenia kultur były łuski cebulowe
pobierane z cebul roślin rosnących na kolekcji Katedry Roślin Ozdobnych Akademii
Rolniczej w Krakowie.
Przebadano rośliny z 3-6 letnich kultur in vitro, uprawiane na poŜywce według
-3
MURASHIGE, SKOOG [1962] zestalonej agarem (7 g⋅dm ) lub płynnej, z dodatkiem róŜnych
substancji wzrostowych (cytokinina BA, auksyny: NAA, IAA, Picloram).
Analizom poddano łącznie 9 grup cebul, w tym 7 grup Galanthus elwesii
(w kaŜdej przebadano 5 obiektów) pochodzących z następujących kultur:
Kultury załoŜone w roku 2000:
1.
inicjacja na poŜywce 25 µM BA i 0,1 µM NAA, dojrzewanie na poŜywce
zawierającej 1 µM BA i 0,1 µM NAA;
2.
inicjacja na poŜywce 10 µM Picloram i 1 µM BA, róŜnicowanie i dojrzewanie na
poŜywce zawierającej 10 µM BA i 1 µm NAA, a potem 1 µM BA i 0,1 µM
NAA;
3.
inicjacja na poŜywce 25 µM Picloram i 1 µM BA, róŜnicowanie i dojrzewanie na
poŜywce zawierającej 10 µM BA i 1 µm NAA, a potem 5 µM BA i 0,1 µM
NAA;
4.
inicjacja na poŜywce 10 µM Picloram i 1 µM BA, róŜnicowanie i dojrzewanie na
poŜywce zawierającej 10 µM BA i 1 µm NAA, a potem 5 µM BA i 0,1 µM
NAA;
5.
inicjacja kalusa na poŜywce 25 µM Picloram i 1 µM BA, namnaŜanie
w bioreaktorze na identycznej lecz płynnej poŜywce przez 40 dni (gęstość inokulum 5 g na 150 ml poŜywki), dojrzewanie na poŜywce stałej 10 µM BA i 1 µm
NAA, a potem 5 µM BA i 0,1 µM NAA.
Kultury załoŜonych w roku 2003:
1.
inicjacja i uprawa na poŜywce zestalonej agarem zawierającej 1 µM IAA i 0,1
µM BA;
2.
inicjacja i uprawa na poŜywce wzbogaconej w 1 µM BA i 0,1 µM IAA
Analizom poddano takŜe 2 grupy cebul Galanthus nivalis (w kaŜdej przebadano 5
obiektów), pochodzące z kultur załoŜonych w roku 2003:
1.
inicjacja i namnaŜania na poŜywce 5 µM BA i 0,5 µM NAA;
2.
inicjacja i namnaŜania na poŜywce 5 µM BA i 0,5 µM NAA, następnie uzyskane
cebule (łuski) uprawiano w bioreaktorze na identycznej lecz płynnej poŜywce
przez 40 dni (gęstość inokulum 5 g na 150 cm3 poŜywki), potem na poŜywce
zestalonej agarem bez regulatorów wzrostu.
Kontrolę w badaniach cytometrycznych stanowiły cebule obu gatunków śnieŜyczek,
które nie były uprawiane in vitro, pozyskano je z uprawy polowej, z Kolekcji Katedry
Roślin Ozdobnych AR w Krakowie.
Przeznaczone do badań łuski cebulowe rozdrabniano pojedynczo na płytce
Petriego, za pomocą Ŝyletki, w obecności 1 cm3 buforu lizującego i barwnika
fluorochromowego indolo-4’,6-dwuamidyno-2-fenylidyny (DAPI, DNA staining
solution, Partec, Munster, Niemcy). Następnie dodawano 2 cm3 wody destylowanej i
zawartość filtrowano przez filtr nylonowy o średnicy oczek 50 µm. Przefiltrowana
próba była analizowana za pomocą cytometru przepływowego Partec CA II (Munster,
Niemcy). Dla kaŜdej próby badano 1500-2000 komórek. W sumie dokonano analizy
łusek cebulowych z 55 roślin.
WPŁYW SUBSTANCJI WZROSTOWYCH NA PLOIDALNOŚĆ TKANEK ...
35
Wyniki i dyskusja
Zastosowana wydajna metoda rozmnaŜania śnieŜyczek (Galanthus elwesii
i Galanthus nivalis) na poŜywkach zawierających cytokininę pozwoliła na uzyskanie
pąków przybyszowych, z których rozwijały się cebule przybyszowe [BACH, PAWŁOWSKA
2005]. UŜycie poŜywki wzbogaconej w Picloram zwiększyło współczynnik namnaŜania,
a powstałe licznie zarodki somatyczne rozwijały się w rośliny [BACH i in. 2002, 2003].
Mechanizmy warunkujące zmienność genetyczną komórek w kulturach in vitro
wynikają z ukrytej zmienności komórek eksplantatu albo stanowią efekt samej hodowli
[JOACHIMIAK, ILNICKI 1997]. Cytometria przepływowa jest szybkim narzędziem
diagnostycznym, które moŜe być zastosowane do określenia wielkości genomu - ilości
DNA w komórkach roślin rosnących na stanowisku naturalnym, uzyskanych w wyniku
prac hodowlanych oraz uprawianych w warunkach in vitro [BARBA-GONZALEZ i in. 2005;
PALOMINO 2000; SILJAK-YAKOVLEV i in. 2003; ZONNEVELD i in. 2003]. Galanthus elwesii oraz
Galanthus nivalis są roślinami diploidalnymi 2 n = 2x = 24 [SVESHNIKOVA 1965, 1975].
Wykonane na cytometrze przepływowym badania stopnia ploidalności uzyskanych z zarodków somatycznych cebul śnieŜyczek Elwesa wykazały w testowanych
próbach obecność osobników o zwiększonej liczbie chromosomów (3 n). Wszystkie
poddane badaniom rośliny, pochodzące z kultur załoŜonych w roku 2000, gdy kalus
embriogeniczny był indukowany i namnaŜany na poŜywce zawierającej auksynę
Picloram (10-25 µM), (poŜywka stała lub płynna w bioreaktorze) były triploidalne.
Podobnie VAN HARMELEN i in. [1997] w regenerantach uzyskanych z 3-letniej kultury
kalusa L. longiflorum odm. Gelria stwierdzili zmiany w poziomie ploidalności.
Natomiast w testowanych próbach cebul śnieŜyczki Elwesa, pochodzących
z kultur pąków przybyszowych inicjowanych w 2000 roku lub w 2003 roku, na poŜywkach zawierających cytokininę BA, nie stwierdzono obecności haploidów ani
poliploidów (rys. 1A-C). TakŜe w badanych próbach śnieŜyczki przebiśniegu nie
znaleziono osobników o zmienionej ploidalności, gdy kultury inicjalne były wykładane
na poŜywkę stałą, zawierającą cytokininę BA (5 µM). Podobnie WICKREMESINHE i in.
[1994] oraz KĘDRA, BACH [2005] badając regeneranty lilii uzyskane z pąków
przybyszowych na poŜywkach stałych, stwierdzili tylko obecność osobników
diploidalnych, o poziomie ploidalności identycznym jak u roślin kontrolnych, nie
pochodzących z kultur in vitro. Wprowadzenie uzyskanych łusek cebulowych snieŜyczek do bioreaktora i namnaŜanie ich w płynnej poŜywce z cytokininą pozwoliło na
uzyskanie pąków przybyszowych i cebul. Jednak spośród badanych w tej grupie cebul,
20% nowopowstałych roślin, miało zwiększoną ploidalnośc (3 n), (rys. 1D-E).
A. Bach, B. Pawłowska
36
File: Sample_055 Date: 09-11-2006 Time: 00:34:35 Particles: 999 Acq.-Time: 17 s
partec PAS
File: Sample_020 Date: 08-11-2006 Time: 23:50:42 Particles: 689 Acq.-Time: 13 s
partec PAS
100
100
RN1
RN1
RN4
RN2
RN2
RN3
80
60
60
RN3
counts
counts
80
RN4
40
40
20
20
0
0
0
100
200
300
400
Gate
<None>
<None>
<None>
<None>
Ungated
0
0
0
0
Count
0
0
0
0
Count/ml
-
%Gated
0.00
0.00
0.00
0.00
Mean-x
-
CV-x%
-
Mean-y
-
1
500
FL4
Region
RN1
RN2
RN3
RN4
10
100
1000
FL4
Region
RN1
RN2
RN3
RN4
CV-y%
-
Gate
<None>
<None>
<None>
<None>
Ungated
0
1
0
0
Count
0
1
0
0
Count/ml
-
%Gated
0.00
0.15
0.00
0.00
Mean-x
3.86
-
CV-x%
0.00
-
Mean-y
-
CV-y%
-
D
A
File: Sample_055 Date: 09-11-2006 Time: 00:34:35 Particles: 999 Acq.-Time: 17 s
partec PAS
File: Sample_020 Date: 08-11-2006 Time: 23:50:42 Particles: 689 Acq.-Time: 13 s
partec PAS
100
100
RN1
RN1
RN4
RN2
RN2
RN3
80
60
60
RN4
RN3
counts
counts
80
40
40
20
20
0
0
0
100
200
300
400
Gate
<None>
<None>
<None>
<None>
Ungated
0
0
0
0
Count
0
0
0
0
Count/ml
-
%Gated
0.00
0.00
0.00
0.00
Mean-x
-
CV-x%
-
Mean-y
-
1
500
FL4
Region
RN1
RN2
RN3
RN4
10
100
1000
FL4
Region
RN1
RN2
RN3
RN4
CV-y%
-
Gate
<None>
<None>
<None>
<None>
Ungated
0
1
0
0
Count
0
1
0
0
Count/ml
-
%Gated
0.00
0.15
0.00
0.00
Mean-x
3.86
-
CV-x%
0.00
-
Mean-y
-
CV-y%
-
E
B
File: Sample_067 Date: 09-11-2006 Time: 00:57:10 Particles: 1031 Acq.-Time: 59 s
partec PAS
File: Sample_067 Date: 09-11-2006 Time: 00:57:10 Particles: 1031 Acq.-Time: 59 s
100
partec PAS
100
RN1
RN4
RN2
RN1
RN4
RN2
RN3
60
60
RN3
counts
80
counts
80
40
40
20
20
0
0
0
100
200
300
400
500
0
100
200
FL4
Region
RN1
RN2
RN3
RN4
Gate
<None>
<None>
<None>
<None>
C
Rys. 1.
Ungated
0
0
0
0
Count
0
0
0
0
Count/ml
-
%Gated
0.00
0.00
0.00
0.00
Mean-x
-
300
400
FL4
CV-x%
-
Mean-y
-
CV-y%
-
Region
RN1
RN2
RN3
RN4
Gate
<None>
<None>
<None>
<None>
Ungated
0
0
0
0
Count
0
0
0
0
Count/ml
-
%Gated
0.00
0.00
0.00
0.00
Mean-x
-
CV-x%
-
Mean-y
-
F
Zawartość DNA w jądrach komórkowych liści śnieŜyczek określona na cytometrze
przepływowym: Galanthus elwesii (A-C): A. rośliny diploidalne (2n) nie namnaŜane
w kulturach in vitro (kontrola), B. rośliny namnaŜane in vitro na drodze
organogenezy, w poŜywkach z dodatkiem cytokininy BA, C. rośliny (3n) uzyskane
drogą somatycznej embriogenezy na poŜywkach z dodatkiem Picloramu; Galanthus
nivalis (D-E): D. rośliny diploidalne nie namnaŜane w kulturach in vitro (kontrola),
E. rośliny namnaŜane in vitro na drodze organogenezy, w poŜywkach stałych z
dodatkiem cytokininy BA, F. rośliny triploidalne (20%) uzyskane z namnaŜania
CV-y%
-
500
WPŁYW SUBSTANCJI WZROSTOWYCH NA PLOIDALNOŚĆ TKANEK ...
37
łusek cebulowych w bioreaktorze drogą organogenezy
Fig. 1.
DNA content in nuclei of leaves of snowdrops determined by flow cytometry:
Galanthus elwesii (A-C): A. diploid plants (2n) not cultured in vitro (control), B.
plants after organogenesis (medium contained BA), C. plants after somatic
embryogenesis (medium contained Picloram); Galanthus nivalis (D-E): D. diploid
plant (2n) not cultured in vitro (control), E. plants after organogenesis (solid medium
contained BA), F. triploid plants (20%) after organogenesis (liquid medium
contained BA - bioreactor culture)
Wnioski
1.
Wydajna metoda rozmnaŜania śnieŜyczek Elwesa (Galanthus elwesii HOOK) w
kulturach in vitro, przez wzbudzanie pąków przybyszowych pod wpływem cytokininy BA nie wpłynęła na zmianę stopnia ploidalności uzyskanych roślin.
2.
Somatyczna embriogeneza śnieŜyczki Elwesa w kulturach in vitro, zainicjowana
Picloramem, skutkowała w przeprowadzonych badaniach powstawaniem roślin
triploidalnych; wszystkie analizowane rośliny miały zwiększoną ploidalność.
3.
20% roślin śnieŜyczki przebiśniegu (Galanthus nivalis L.) powstałych na łuskach
cebulowych pod wpływem cytokininy BA i namnaŜanych w bioreaktorze miało
zwiększoną ploidalność (triploidy) w porównaniu do roślin kontrolnych
(diploidy).
Literatura
BACH A., PAWŁOWSKA B. 2005. Regeneracja śnieŜyczki przebiśniegu (Galanthus nivalis
L.) w kulturach in vitro. Zmienność genetyczna i jej wykorzystanie w hodowli roślin
ogrodniczych. Monografia, ISiK Skierniewice: 389-393.
BACH A., WARCHOŁ M., SAVONA M. 2002. Wpływ substancji wzrostowych na organogenezę i somatyczną embriogenezę u śnieŜyczki Elwesa (Galanthus elwessi Hook). Zesz.
Probl. Post. Nauk Rol. 488: 565-569.
BACH A., WARCHOŁ M., PAWŁOWSKA B. 2003. RozmnaŜanie śnieŜyczki Elwesa (Galanthus
elwessi Hook) w poŜywkach płynnych. Folia Horticulturae, Suplement 2003/2: 19-21.
BARBA-GONZALEZ R., LIM K.B., RAMANNA M.S., VAN TUYL J.M. 2005. Use of 2n Gametes
for Induction intergenomic recombination in Lily Hybrids. IXth Inter. Symp. On Flower
Bulbs. Acta Hortic. 673: 161-166.
CANTLIFFE D.J. 2001. Bioreaktor technology in plant cloning. Acta Horticulturae 560:
345-351.
DOLEZEL J. 1991. Flow cytometric analysis of nuclear DNA content in higher plants.
Phytochem. Analysis 2: 143-154.
DOLEZEL J., GREILHUBERS J., LUCRETTI S., MEISTER A., LYSAK M.A., NARDI L., OBERMAYER
R. 1998. Plant genome size estimation by flow cytometry: inter-laboratory comparison.
Annals of Botany 82 (supl. A): 17-26.
JOACHIMIAK A., ILNICKI T. 1997. Wpływ róŜnych stęŜeń 2,4-D na zróŜnicowaną proliferację linii komórkowych obecnych w kalusie Allium fistulosum. Zesz. Nauk. AR Poznań
318: 339-33.
38
A. Bach, B. Pawłowska
KĘDRA M., BACH A. 2005. Morphogenesis of Lilium martagon L. explants in callus
culture. Acta Biologica Cracoviensia Series Botanica 47/1: 65-73.
KONONOWICZ H. 1990. Embriogeneza roślin in vitro. Biotechnologia 2-3: 52-59.
MURASHIGE T., SKOOG F. 1962. A revised medium on the growth and bioassays with
tabacco tissue culture. Physiol. Plant. 15: 473-497.
PALOMINO G. 2000. Genome analysis of Mexican flora. Genetics and Molecular Biology
23(4): 921-924.
SILJAK-YAKOVLEV S., PECCENINI S., MURATOVIC E., ZOLDOS V., ROBIN O., VALLES J. 2003.
Chromosomal differentiation and genome size in three European mountain Lilium
species. Plant Systematics and Evolution 236(3-4): 165-173.
SVESHNIKOVA L.I. 1965. Chromosome numbers of species of the genus Galanthus L.
(Amaryllidaceae). Bot. Zhurn. (Moscow and Leningrad) 50: 689-692.
SVESHNIKOVA L.I. 1975. On the origin of the karyotype of genus Galanthus L. Bot. Zhurn.
(Moscow and Leningrad) 60: 1760-1768.
ŚLIWIŃSKA E. 2002. Wykorzystanie cytometrii przepływowej w biotechnologii roślin.
Biotechnologia 1(56): 122-128.
TIPIRDAMAZ R., ELLIALTIOGLU S., CAKIRLAR H. 2000. The micropropagation of snowdrop
(Galanthus ikariae Baker.). Turkish Journal of Agriculture and Forestry 23: 823-839.
VAN HERMELEN M.J., LOEFFLER H.J.M., VAN TUYL J.M. 1997. Somaclonal variation in lily
after in vitro cultivation. Acta Horticulturae 430: 347-350.
WICKREMESINHE E.R.M., HOLCOM E.J., ARTECA R.N. 1994. A practical method for pro-
duction of flowering Easter lily from callus cultures. Scientia Horticulturae 60: 143-152.
ZONNEVELD B.J.M., GRIMSHAW J.M., DAVIS A.P. 2003. The systematic value of nuclear
DNA content in Galanthus. Plan Systematics and Evolution 241(1-2): 89-102.
Słowa kluczowe:
Galanthus elwesii HOOH, Galanthus nivalis L., cytometria przepływowa, ploidalność
Streszczenie
ŚnieŜyczka Elwesa (Galanthus elwesii HOOK) pochodząca z Azji Mniejszej jest
cenioną w ogrodnictwie ozdobnym wiosenną rośliną cebulową. Jest masowo
pozyskiwana ze stanowisk naturalnych i stanowi jedną z najwaŜniejszych ozdobnych
roślin cebulowych eksportowanych z Turcji do Europy Zachodniej. ŚnieŜyczka
przebiśnieg (Galanthus nivalis L.) jest chronionym gatunkiem krajowym występującym
na Podkarpaciu i uprawianym w ogrodach od XVI wieku. Tradycyjny wegetatywny
sposób rozmnaŜania śnieŜyczek z cebul przybyszowych jest powolny i mało wydajny, a
osobniki rozmnaŜane generatywnie nie powtarzają cech roślin matecznych. Jednym ze
sposobów zwiększenia wydajności tego procesu jest zastosowanie metody in vitro.
Inicjację kultur przeprowadzono w latach 2000-2003, a materiałem wyjściowym były
łuski cebulowe pochodzące z roślin rosnących na kolekcji Katedry Roślin Ozdobnych.
NamnaŜanie śnieŜyczek prowadzono drogą organogenezy na poŜywkach MS
wzbogaconych w cytokininę BA (0,1-25 µM) i zawierających dodatkowo auksynę IAA
lub NAA (0-1 µM). Somatyczną em-briogenezę indukowano na poŜywkach MS
WPŁYW SUBSTANCJI WZROSTOWYCH NA PLOIDALNOŚĆ TKANEK ...
39
zawierających Picloram (10-25 µM) i BA (1 µM), a uzyskany kalus embriogeniczny
namnaŜano na poŜywkach o identycznym składzie. Do produkcji kalusa i łusek
cebulowych zastosowano takŜe bioreaktor. Znany jest fakt istnienia genetycznej
zmienności w kulturach in vitro, dlatego uzyskane z pąków przybyszowych i z
zarodków somatycznych rośliny poddano analizie cytometrycznej. Wykonane na
cytometrze przepływowym badania stopnia ploidalności roślin powstałych na drodze
somatycznej embriogenezy pod wpływem Picloramu w poŜywce wykazały zwiększoną
liczbę chromosomów (3 n) u wszystkich testowanych osobników. Natomiast w
analizowanych próbach pochodzących z pąków przybyszowych śnieŜyczek nie
stwierdzono obecności haploidów ani osobników o zwiększonej liczbie chromosomów,
z wyjątkiem pochodzących z kultur bioreaktorowych. W tym przypadku 20% badanych
roślin było triploidami.
EFFECT OF PLANT GROWTH REGULATORS
ON PLOIDY OF SNOWDROP
TISSUES Galanthus elwesii HOOK
AND Galanthus nivalis L. PROPAGATED in vitro
Anna Bach, BoŜena Pawłowska
Department of Ornamentals,
Agricultural University, Kraków
Key words:
ploidy, flow cytometry, in vitro, Galanthus elwesii HOOK, Galanthus
nivalis L.
Summary
Giant snowdrop (Galanthus elwesii HOOK), native to Asia Minor, is a highly
valued spring bulbous ornamental plant. It is commonly gathered from natural sites and
is one of the most important bulbous ornamental plants exported form Turkey to
Western Europe. Common snowdrop (Galanthus nivalis L.) is a protected species
commonly occurring in Poland, in Carpathian Foothills, that is cultivated in gardens
from 16th century. Efficiency of this process can be augmented by the use of in vitro
methods. Cultures were initiated between 2000 and 2003 from plant bulb scales derived
from the collection of the Chair of Ornamental Plants. Snowdrops were propagated
using the method of organogenesis on MS media supplemented with a cytokinin (BA
0.1-25.0 µM) and auxin (IAA or NAA, 0-1 µM). Somatic embryogenesis was induced
on solid MS media containing Picloram (10-25 µM) and BA (1 µM). Embryogenic
callus obtained in this way was propagated on media of identical composition. Production of the callus and bulb scales was also carried out in a bioreactor. It is a well known
genetic variability of material from in vitro cultures. For this reason, plants obtained
from adventitious buds and somatic embryos were subjected to cytometric analysis.
Flow cytometric studies of ploidy of plants generated by somatic embryogenesis on
media containing Picloram showed a higher number of chromosomes (3n) in all tested
specimens. Contrary the examination of samples originating from adventitious buds of
snowdrop did not demonstrate haploids or specimens with a higher number of
chromosomes, except for those cultivated in a bioreactor. In the latter case, 20% of
plants under study were triploids.
40
A. Bach, B. Pawłowska
Prof. dr hab. Anna Bach
Katedra Roślin Ozdobnych
Akademia Rolnicza im. H. Kołłątaja
Al. 29 Listopada 54
31-425 KRAKÓW
e-mail: [email protected]
ZESZYTY PROBLEMOWE POSTĘPÓW NAUK ROLNICZYCH 2007 z. 523: 43-49
MICROPROPAGATION OF Physalis ixocarpa L.
Katarzyna Bergier, Marzena Wielanek, Ewa Gajewska, Maria Skłodowska
Department of Plant Physiology and Biochemistry, University of Łódź
Introduction
Genus Physalis was described for the first time by Linnaeus in 1753. It comprises
about 90 species, nearly 70 of which grow in Mexico, most of them are endemic [PEREZCASTORENA et al. 2004]. Physalis ixocarpa often called „tomatillo” or „husk tomate”
belongs to Solanaceae family and is an annual plant growing in Mexico and Guatemala.
Specialists call it Physalis philadelphica Lam. Recently it has been grown more and
more often in California due to the increasing popularity of Mexican food in the United
States of America [MORICONI et al. 1990]. Tomatillo is a very important diet component in
Mexico and Central America. This small tomato-like fruit contains about 10% sucrose,
mineral salts, carotens, vitamins B, E and C. In addition to its taste and decorative
values tomatillo is also a medicinal plant. It is a valuable source of biologically active
substances - withanolides which include: ixocarpalacton A and B, 18hydroxywithanolide D and withaphysacarpine [SU et al. 2002]. Withanolides extracted
from the leaves and apical parts of plants are used to purify blood and to cure stomach
disorder. In Mexico they are used as an antidote against one of the local poisons. In folk
medicine, extracts from this plant are used to treat sore throat and fever. Its antitumor
properties were also observed [GU et al. 2003]. Developing an effective method of in
vitro propagation of Ph. ixocarpa seems justified since this plant is not only an
important agricultural plant but it is also a source of potentially valuable secondary
metabolites used in medicine. The aim of the present research was to design a quick
method of Ph. ixocarpa in vitro propagation.
Materials and methods
Seed germination and shoot multiplication
Seeds of Ph. ixocarpa were obtained from the Botanical Garden of University of
Masarykiana (Czech Republic). The seeds were surface sterilized by shaking in 70%
(v/v) ethanol for 3 min and rinsed two times with sterile distilled water, than by dipping
in 35% commercial bleach for 5 min and again rinsed five times with sterile distilled
water. Finally, the sterilized seeds were used to initiate the culture. These cultures were
carried out in 100 ml Erlenmeyer flasks containing 25 ml of MS [MURASHIGE, SKOOG
1962] basal medium supplemented with 3% (w/v) sucrose and 0.7% agar (w/v). The
medium pH was adjusted to 5.8 prior to the addition of agar. The cultures were grown at
K. Bergier et al.
44
23 ± 2°C under 16 h/8 h photoperiod (40 µmol⋅m-2⋅s-1, cool fluorescent light, Philips
40W). Four-week-old seedlings of Ph. ixocarpa were the source of explants for multiple
shoot development. Shoot tips (0.5-1.0 cm long) were used as initial explants. These
cultures were carried out in 330 ml jam jars with vertilated polypropylene twist lids
containing 50 ml of MS medium with BAP (6-benzylaminopurine), KIN (6furfurylaminopurine) or 2iP 6-(γ,γ-dimethylallylamino)purine at different
concentrations (1-20 µmol⋅dm-3) and combinations. For subculturing, multiplied shoots
were transferred to the same fresh medium at 4-week intervals (growth conditions as
described above).
Rooting and acclimatization of regenerated shoots
For rooting, four-week-old shoots (5-6 cm long) were separated individually and
transferred to MS medium supplemented with different auxins: NAA, IBA and 2,4-D at
concentrations of 1 µmol⋅dm-3. For acclimatization to ex vitro conditions the rooted
plantlets (two-week-old) were washed in sterile distilled water to remove traces of MS
medium and than transferred to plastics pots containing perlit under the controlled
growth chamber condition (23±2°C, 16 h/8 h photoperiod, 70% relative humidity and
40 µmol m-2 s-1 light intensity) and covered for 6-7 days with glass. After two weeks the
plants were transferred to pots containing soil and grown in a greenhouse. Observations
were recorded on the multiplication rate (number of shoots per explant), shoot length,
frequency of roots and roots per shoot.
Each treatment consisted of four explants per flask in six replicates. Each
experiment was conducted twice. Sample variability is given as the standard deviation
of the mean. The significance of differences between treatment mean values was
determined by Student’s t-test. Differences at p < 0.05 were considered significant.
Results and discussion
Plant micropropagation is more and more widely used in breeding of agriculturally important plants. Each plant has specific needs concerning culture conditions
and nutrition that is why micropropagation methods should be designed individually. In
order to achieve optimal micropropagation conditions media varying in composition
and in combination of growth factors were used. Murashige and Skoog medium was
used for proliferation and rooting, as it is most commonly used in in vitro cultures. At
the preliminary stage of the experiment the medium was supplemented with various
concentrations of KIN, BAP or 2iP. The highest numbers of shoots were obtained for 5
µmol⋅dm-3 KIN and 2.5 µmol⋅dm-3 BAP, both resulting in about 5.9 shoots per explant
after 4 weeks of culture (Tab. 1).
Table 1; Tabela 1
Effect of different cytokinins on Ph. ixocarpa shoot multiplication (shoots/explant)
during the first 4 weeks of culture on MS medium. Values are mean ± SD, n = 48
Wpływ róŜnych cytokinin na namnaŜanie pędów Ph. ixocarpa (ilość pędów/eksplantat)
w czasie 4 tygodni hodowli na poŜywce MS. Wartość średnia ± SD, n = 48
Cytokinins
Cytokininy
(µmol⋅dm-3)
Culture time (weeks); Czas hodowli (tygodnie)
1
2
3
4
MICROPROPAGATION OF Physalis ixocarpa L.
BAP 1
BAP 2.5
BAP 5
KIN 1
KIN 2.5
KIN 5
2iP 1
2iP 2.5
2iP 5
KIN 5 + BAP 1
KIN 2.5+BAP 0.5
KIN 2.5 + BAP 1
KIN 1 + BAP 2.5
2.09 (±0.63)
1.33 (±0.35)
1.27 (±0.24)
1.47 (±0.42)
1.38 (±0.55)
1.37 (±0.30)
1.66 (±0.29)
1.37 (±0.22)
1.08 (±0.15)
1.86 (±0.54)
2.12 (±0.75)
1.33 (±0.34)
1.23 (±0.27)
3.61 (±0.70)
2.41 (±0.76)
1.80 (±0.63)
1.85 (±0.50)
3.14 (±0.91)
2.23 (±0.56)
2.55 (±0.65)
2.80 (±0.74)
1.53 (±0.61)
2.70 (±0.52)
3.21 (±0.83)
2.06 (±0.66)
1.46 (±0.35)
4.32 (±1.01)
4.57 (±0.66)
2.91 (±0.59)
2.18 (±0.57)
3.75 (±0.68)
4.09 (±0.71)
4.55 (±0.73)
4.37 (±0.65)
1.87 (±0.56)
5.03 (±0,97)
5.32 (±1.57)
4.09 (±0.81)
3.13 (±1.50)
45
5.04 (±0.78)
5.87 (±1.60)
5.38 (±1.33)
2.42 (±0.36)
4.52 (±0.98)
5.90 (±0.82)
5.16 (±1.16)
5.33 (±1.00)
3.70 (±1.27)
6.71 (±1.37)
6.20 (±1.44)
4.83 (±0.97)
3.26 (±1.03)
Similar effects of KIN and BAP were observed for Feronia limonia [HIREGOUDAR et al.
2003], Dionaea muscipula [JANG et al. 2003] and Centaurea paui [CUENCA et al. 1999].
Among 2iP concentrations used in our experiment 2.5 µmol⋅dm-3 of 2iP gave the best
multiplication rate, 5.33 shoots per explant within 4 weeks. At the next stage the
combination of KIN and BAP was used while 2iP was excluded as it caused
deformations and quick senescence of shoots at all concentrations. After 4-week culture
14% higher multiplication rate (p < 0.05), was observed in the medium supplemented
with 5 µmol⋅dm-3 KIN + 1 µmol⋅dm-3 BAP, in comparison with 5 µmol⋅dm-3 KIN. The
plants were morphologically correct, green and did not produce callus tissue. Other
studies reported that the combination of KIN with BAP in a medium resulted in a better
proliferation rate of Symonanthus bancroftii than the combination of KIN with other
growth regulators [PANAIA et al. 2000]. These results are also in agreement with those
presented by KOMALAVALLI and RAO [2000] who observed better effects of the KIN and
BAP combination than of each cytokinin alone. The micropropagated plants differed in
shoot length (Tab. 2). In contrast to multiplication rate the longest ones were produced
in the presence of the highest concentration of KIN alone (4.60 cm). The addition of 1
µmol dm-3 BAP caused the decrease in shoot length by 38% (p < 0.001). However, in
other Solanaceae like Scopolia parviflora shoot elongation was better on growth
regulator-free half-strength B5 medium [KANG et al. 2004]. Under the influence of BAP
and 2iP they were shorter (Tab. 2). In the presence of KIN (2.5 µmol⋅dm-3) with BAP
(0.5 µmol⋅dm-3), the shoots were also shorter - 3.49 cm due to BAP presence. NAA was
most effective among the three auxin supplements used to induce root formation in the
regenerated shoots (Tab. 3).
Table 2; Tabela 2
Effect of different cytokinins on Ph. ixocarpa shoot elongation (cm) during
the first 4 weeks of culture on MS medium (values are mean ± SD, n = 48)
Wpływ róŜnych cytokinin na długość pędów Ph. ixocarpa (cm)
w czasie 4 tygodni hodowli na poŜywce MS (wartość średnia ± SD, n = 48)
Culture time (weeks); Czas hodowli (tygodnie)
Cytokinins
Cytokoniny
(µmol⋅dm-3)
BAP 1
BAP 2.5
BAP 5
1
2
3
4
1.34 (±0.13)
1.41 (±0.32)
1.35 (±0.26)
1.97 (±0.32)
1.56 (±0.19)
1.52 (±0.20)
2.42 (±0.46)
1.85 (±0.06)
1.60 (±0.35)
2.57 (±0.53)
2.33 (±0.39)
1.67 (±0.79)
K. Bergier et al.
46
KIN 1
KIN 2.5
KIN 5
2iP 1
2iP 2.5
2iP 5
KIN 5 + BAP 1
KIN 2.5+BAP 0,5
KIN 2.5 + BAP 1
KIN 1 + BAP 2.5
1.47 (±0.26)
1.27 (±0.32)
1.75 (±0.30)
1.49 (±0.23)
1.36 (±0.23)
1.63 (±0.35)
1.54 (±0.24)
1.83 (±0.34)
1.30 (±0.27)
1.13 (±0.25)
1.99 (±0.29)
2.09 (±0.37)
2.14 (±0.25)
1.94 (±0.30)
1.51 (±0.12)
1.76 (±0.35)
2.13 (±0.32)
2.50 (±0.35)
1.50 (±0.17)
1.28 (±0.17)
2.90 (±0.53)
2.59 (±0.20)
2.76 (±0.44)
2.50 (±0.30)
1.95 (±0.07)
1.92 (±0.24)
2.47 (±0.23)
3.13 (±0.34)
2.13 (±0.44)
1.49 (±0.24)
3.16 (±0.55)
3.03 (±0.55)
4.60 (±0.52)
2.98 (±0.27)
2.22 (±0.35)
2.65 (±0.33)
2.86 (±0.59)
3.49 (±0.52)
2.19 (±0.22)
1.76 (±0.24)
Table 3; Tabela 3
-3
Effect of auxins (1 µmol⋅dm ) on the rooting of Ph. ixocarpa in vitro shoots (%)
Wpływ auksyn (1 µmol⋅dm-3) na ukorzenianie się pędów Ph. ixocarpa (%)
Auxins
Auksyny
IBA
NAA
2,4-D
One-week-old shoots
Jednotygodniowe pędy
Two-week-old shoots
Dwutygodniowe pędy
% of rooted
shoots
% ukorzenionych pędów
number of
roots/explant
ilość korzeni/
eksplantat
% of rooted shoots
% ukorzenionych
pędów
number of
roots/explant
ilość korzeni/
eksplantat
38
-
4 (±0.09)
0
0
62 (±0.42)
75 (±0.61)***
17 (±0.81)***
6 (±0.11)
5 (±0.20)***
2 (±0.16)***
mean values ± SD, n = 48; wartość średnia ± SD, n = 48
***
values that differ significantly at p < 0.001 (IBA versus NAA and 2,4-D treatment); wartości róŜniące
się istotnie przy p < 0,001 (wariant z IBA względem wariantów z NAA i 2,4-D)
In the NAA series of the 2-week cultures 75% of shoots were rooted, in the IBA series
the result was lower by 13% (p < 0.001) than in the case of NAA, but the roots appeared
already in the first week. The worst results (17%) were observed in the 2,4-D series.
Moreover, in the latter case the roots were deformed (short and thick) and callus was
produced at the basis of all explants. SHRIVASTAVA and ROJANI [1999] also observed the
callus formation in the presence of 2,4-D. What is more, the roots became dark during
culture. In Solanum species the hormon-free medium was more effective for rooting of
regenerated shoots [El-ASHAAL et al. 1999; KANG et al. 2004]. The rooted plants were
acclimatized to in vivo conditions first in pots with perlit and than with soil with 91%
efficiency (for plants rooted with NAA and IBA). The micropropagated plants exhibited
a phenotypic morphology similar to that of their wild parents within less than 2 months.
Conclusions
The method described in our study could be used for fast multiplication of Ph.
ixocarpa as an alternative source of bioactive secondary metabolites for commercial
exploitation. The highest number of shoots per explant of Ph. ixocarpa was obtained on
the medium supplemented with the combination of KIN (5 µmol⋅dm-3) and BAP (1
µmol⋅dm-3). The presence of KIN alone resulting the longest shoots of the
MICROPROPAGATION OF Physalis ixocarpa L.
47
micropropagated plants in comparision to BAP and 2iP. The best rooting with 75%
efficiency was observed in the presence of NAA.
References
CUENCA S., AMO-MARCO J.B., PARRA R. 1999. Micropropagation from inflorescence
stems of the Spanish endemic plant Centaurea paui Loscos Willk. (Composite). Plant
Cell Rep. 18: 674-679.
El-ASHAAL H.A., GHANEM S.A., MELEK F.R., KOHAIL M.A., HILAL S.H. 1999. Alkaloid
production from regenerated Solanum plants. Fitoterapia 70: 407-411.
GU J.Q., LI W., KANG Y.H., SU B.N., FONG H.H. 2003. Minor withanolides from Physalis
philadelphica: structures, quinone reductase induction activities, and liquid chromatography (LC)-MS-MS investigation as artifacts. Chem. Pharm. Bull. 51: 530-539.
HIREGOUDAR L.V., MURTHY H.N., HEMA B.P., HAHN E.J., PAEK K.Y. 2003. Multiple shoot
induction and plant regeneration of Feronia limonia (L.) Swingle. Sci. Hort. 98:
357-364.
JANG G.W., KIM K.S., PARK R.D. 2003. Micropropagation of Venus fly trap by shoot
culture. Plant Cell Tiss. Org. Cult. 72: 95-98.
KANG Y.M., MIN J.Y., MOON H.S., KARIGAR C.S., PRASAD D.T., LEE C.H., CHOI M.S. 2004.
Rapid in vitro adventitious shoot propagation of Scopolia parviflora through rhizome
cultures for enhanced production of tropane alkaloids. Plant Cell Rep. 23: 128-133.
KOMALAVALLI N., RAO M.V. 2000. In vitro micropropagation of Gymnema sylvestre - A
multipurpose medicinal plant. Plant Cell Tiss. Org. Cult. 61: 97-105.
MORICONI D., RUSH M.C., FLORES H. 1990. Tomatillo: A potential Vegetable Crop for
Louisiana in Advances in new crops. Janick J., Simon J.E. (Eds) Timber Press: 407-413.
MURASHIGE T., SKOOG F. 1962. A revised medium for rapid growth and bioassay with
tobacco tissue culture. Physiol. Plant. 15: 473-497.
PANAIA M., SENARATNA T., BUNN E., DIXON K.W., SIVASITHAMPARAM K. 2000. Micropropagation of the critically endangered Western Australian species, Symonanthus bancroftii (F. Muell.) L. Haegi (Solanaceae). Plant Cell Tiss. Org. Cult. 63: 23-29.
PEREZ-CASTORENA A.L., GARCIA M., MARTINEZ M., MALDONADO E. 2004. Physalins from
Physalis solanaceus. Biochem. System. Ecol. 32: 1231-1234.
SHRIVASTAVA N., RAJANI M. 1999. Multiple shoot regeneration and tissue culture studies
on Bacopa monnieri (L.) Pennell. Plant Cell Rep. 18: 919-923.
SU B.N., MISICO R., JUNG PARK E., SANTARSIERO B.D., MESECAR A.D., FONG H.H.S.,
PEZZUTO J.M., KINGHORN A.D. 2002. Isolation and characterization of bioactive prin-
ciples of the leaves and stems of Physalis philadelphica. Tetrahedron 58: 3453-3466.
Key words:
auxins, cytokinins, micropropagation, shoot tips, Solanaceae
Summary
A rapid micropropagation method was developed from the shoot tip explants of
Physalis ixocarpa L. (Solanaceae). The high frequency of shoot formation was achieved
K. Bergier et al.
48
on MURASHIGE and SKOOG [1962] medium containing the combination of KIN 5
µmol⋅dm-3 and BAP 1 µmol⋅dm-3, 6.71 shoots per explant, within 4 weeks. The
maximum elongation of shoots was obtained with KIN at 5 µmol⋅dm-3 (4.60 cm). The
best results with rooting of the micropropagated shoots of Ph. ixocarpa was observed
on the medium individually supplemented with 1 µmol⋅dm-3 NAA or IBA, 75% and
62%, respectively. After rooting period the plantlets were acclimatized in vivo with 91%
efficiency.
MIKROROZMNAśANIE Physalis ixocarpa L.
Katarzyna Bergier, Marzena Wielanek, Ewa Gajewska, Maria Skłodowska
Katedra Fizjologii i Biochemii Roślin,
Uniwersytet Łódzki, Łódź
Słowa kluczowe:
auksyny, cytokininy, mikrorozmnaŜanie, Solanaceae, wierzchołki
pędów
Streszczenie
Opracowano szybką metodę mikrorozmnaŜania Ph. ixocarpa (Solanaceae)
stosując jako eksplantaty wierzchołki pędów. Największą liczbę pędów uzyskano na
podłoŜu MURASHIGE i SKOOG [1962] zawierającym kombinację 5 µmol⋅dm-3 KIN z 1
µmol⋅dm-3 BAP, 6,71 pędów/eksplantat po 4 tygodniach hodowli. NajdłuŜsze pędy
(4,60 cm) osiągnęły rośliny hodowane na podłoŜu z dodatkiem KIN w stęŜeniu 5
µmol⋅dm-3. Najlepsze rezultaty w ukorzenianiu namnoŜonych pędów Ph. ixocarpa
obserwowano na podłoŜu zawierającym 1 µmol⋅dm-3 NAA lub IBA, odpowiednio 75 i
62%. Ukorzenione rośliny były aklimatyzowane do warunków in vivo z 91%
wydajnością.
Dr Katarzyna Bergier
Katedra Fizjologii i Biochemii Roślin
Uniwersytet Łódzki
ul. Banacha 12/16
90-237 ŁÓDŹ
e-mail: [email protected]
ZESZYTY PROBLEMOWE POSTĘPÓW NAUK ROLNICZYCH 2007 z. 523: 51-57
KWITNIENIE MIESZAŃCA Cattleya (Orchidaceae)
W KULTURACH in vitro
1
Teeresa Cybularz-Urban , Anna Bach
1
2
2
Katedra Botaniki, Akademia Rolnicza im. H. Kołłątaja w Krakowie
Katedra Roślin Ozdobnych, Akademia Rolnicza im. H. Kołłątaja w Krakowie
Wstęp
W literaturze moŜna spotkać liczne doniesienia o kwitnieniu odmian i gatunków
storczyków. Pojawiało się ono zarówno na siewkach, jak równieŜ u roślin
rozmnaŜanych na drodze organogenezy za pomocą kultur tkankowych w warunkach in
vitro. Kwiaty były formowane spontanicznie, bądź indukowane specyficznymi
czynnikami środowiskowymi. Wśród nich są wymieniane: pH i zasobność poŜywki,
obecność oligocukrów, fenoli, poliamin, sterydów, chelatów i innych suplementów.
Współdziała z nimi rodzaj, poziom egzo- i endogennych substancji wzrostowych, czas i
kolejność aplikacji, temperatura i fotoperiod [CHIA i in. 1999; CAMPOS, KERBAUY 2004; VAZ
i in. 2004]. Kluczowy dla przebiegu kolejnych etapów morfogenezy i wejścia rośliny w
stadium rozwoju generatywnego jest takŜe: genotyp, rodzaj, wiek oraz kondycja
zdrowotna pobieranych eksplantatów [TRAN THAN VAN 1999; YU, GOH 2000a, 2000b; YU i
in. 2000; HSU, YANG 2002; MUDALIGE, KUEHNLE 2004; VAZ i in. 2004; TSAI i in. 2005; WILSON i
in. 2005].
Celem pracy była analiza przyczyn spontanicznego kwitnienia mieszańca
storczyka z rodzaju Cattleya namnaŜanego techniką in vitro.
Materiał i metody
Materiał donorowy stanowił okazały, blado-fioletowo kwitnący, mieszaniec
Cattleya waltersiana × C. marone pochodzący z Ogrodu Botanicznego UJ, poraŜony
wirusem pierścieniowej plamistości Odontoglossum (ORSV), (fot. 1). Inicjacja kultur in
vitro nastąpiła przez izolację merystemów z wierzchołków wzrostu pędów. Merystemy
wielkości 2-4 mm3 umieszczano w płynnej poŜywce inicjalnej (fot. 2). Była to poŜywka
MS w modyfikacji KOZAK [1991] z dodatkiem 2,0 mg⋅dm-3 siarczanu adeniny, 9,7
mg⋅dm-3 kwasu askorbinowego, 0,5 mg⋅dm-3 zeatyny, 4,95 mg⋅dm-3 BA i 1,0 mg⋅dm-3
NAA; pH wynosiło 5,5; źródło węgla stanowiła 3% sacharoza. Pędy otrzymane z
eksplantatów pierwotnych mnoŜono na poŜywce zestalonej 0,8% agarem Difco (fot. 3).
Zawartość zeatyny w poŜywce namnoŜeniowej obniŜono do 0,2 mg⋅dm-3, pozostawiając
inne parametry niezmienione. Kulturę pędową prowadzono w naczyniach szklanych o
pojemności 350 cm3, zawierających 50 cm3 poŜywki, w stałej temperaturze 25°C±2°C,
przy wilgotności względnej wynoszącej ok. 70%, w warunkach fotoperiodu 16/8 godz.
(dzień/noc), pasaŜując ją w cyklach 8-tygodniowych. Źródłem światła były lampy
fluorescencyjne o białej barwie światła i natęŜeniu promieniowania 80 µmol⋅m-2⋅sek-1.
T. Cybularz-Urban, A. Bach
52
Do oznaczenia obecności wirusa w roślinach donorowych i namnaŜanych w kulturach
in vitro posłuŜono się testem biologicznym [WISLER 1989] i serologicznym DAS-ELISA
[CLARK, ADAMS 1977].
Fot. 1.
Roślina donorowa mieszańca Cattleya waltersiana × C. marone poraŜona wirusem
ORSV z wyraźnym rozbiciem barwy kwiatów (pomniejszenie 2,5 ×)
KWITNIENIE MIESZAŃCA Cattleya (Orchidaceae) ...
53
Photo 1.
Donor plant of the ORSV-infected hybrid Cattleya waltersiana × C. marone showing
notable color break of flowers (diminished 2.5 ×)
Fot. 2.
Photo 2.
Wielopędowa roślina storczyka - końcowy etap w płynnej poŜywce inicjalnej
Multistem orchid plant - final stage of culture on the initial liquid medium
Fot. 3.
Photo 3.
Meryklony mieszańca na poŜywce zastalonej (powiększenie 3 ×)
Mericlones of the hybrid on a solidified medium (magnification 3 ×)
Wyniki i dyskusja
54
T. Cybularz-Urban, A. Bach
W 14 miesiącu prowadzenia kultury pędowej badanego mieszańca (w trakcie
piątego cyklu), trzy spośród trzydziestu roślin rosnących w jednym ze szklanych naczyń
wykształciły spontanicznie kwiaty. Ich trwałość wynosiła około 3 tygodnie. Kwitnące
pędy wysokości około 17 mm, charakteryzowały się brakiem wyraźnych zmian u liści,
jednakŜe kwiaty nie były w pełni wykształcone morfologicznie. W obrębie okwiatu
zaobserwowano słabo wykształcone działki z wyjątkiem warŜki, o wymiarach 13 × 6
mm (po jej rozwinięciu). Osłaniała ona zdeformowany, niewielki prętosłup (fot. 4).
Barwa szczątkowego okwiatu była zbliŜona do barwy kwiatów roślin donorowych.
Obecność wirusa w kwitnących pędach potwierdzono testem serologicznym DASELISA i biologicznym z uŜyciem Nicotiana tabacum odm. Xsanthi nc.
Fot. 4.
Pęd z miniaturowym, zniekształconym, kwiatem wytworzonym w kulturze in vitro
(powiększenie 3 ×)
Photo 4.
Shoot with a tiny deformed flower developed in in vitro culture (magnification 3 ×)
Zastosowana przez autorki poŜywka była dobierana wyłącznie pod kątem
przydatności do regeneracji eksplantatów i namnaŜania kultur tkankowych w celu ich
odwirusowania [CYBULARZ-URBAN, HANUS-FAJERSKA 2006]. Charakteryzowała się
stosunkowo wysokim stęŜeniem cytokinin, które mogły wywołać zakwitanie 10%
pędów badanego mieszańca Cattleya.
Stymulujący wpływ cytokinin, (zwłaszcza BA) na zakwitanie w kulturach in vitro
był opisywany dla wielu gatunków storczyków z rodzajów: Aranda, Cymbidium,
Dendrobium, Oncidium, Phalaenopsis, Vanda, mieszańców Doriella i Doriteanopsis i
licznych roślin spoza rodziny Orchidaceae [SCORSA 1982; DUAN, YAZAWA 1994, 1995;
CHIA 1999; KOSTENYUK 1999; YU, GOH 2000a, 2000b; YU i in. 2000; CHANG, CHANG 2003;
TAYLOR i in. 2005].
Istotnym zdaje się być obecność wirusa w eksplantatach i zregenerowanych
pędach. Mogła ona, wywołując zaburzenia w poziomie endogennych substancji
wzrostowych [NOWAK 1999; TSAO i in. 1999], w wyniku akumulacji metabolitów stresu
KWITNIENIE MIESZAŃCA Cattleya (Orchidaceae) ...
55
[GRANT, MANSFIELD 1999] i wytwarzania substancji związanych z odpornością przeciw
patogenom (m.in. kwasu salicylowego - MARTINEZ i in. [2004]), wpłynąć modyfikująco na
rozwój wywołując kwitnienie mnoŜonego storczyka.
Analizując budowę morfologiczną kwiatów badanego mieszańca Cattleya
stwierdzono niedorozwój okwiatu i organów generatywnych. Podobne zjawisko nawet
u zdrowych storczyków obserwowali liczni autorzy [KERBAUY 1984; DUAN, YAZAWA 1995;
YON i in. 2003]. Zdecydowanie jednak przewaŜają doniesienia o wytwarzaniu w
kulturach in vitro typowych morfologicznie, płodnych kwiatów, czasem owoców.
Dotyczą one zwłaszcza kwitnienia sterowanego u storczyków.
Wnioski
1.
Spontaniczne zakwitanie mieszańca Cattleya w kulturach in vitro mogło być
wynikiem stosowania wysokich dawek cytokinin lub/obecności ORSV w kultywowanej tkance.
2.
Interesującym i godnym kontynuacji wydaje się zagadnienie sterowanego,
wczesnego, zakwitania w kulturach in vitro tego i innych mieszańców (zwłaszcza
uwolnionych od wirusów).
Literatura
CAMPOS K.O., KERBAUY G.B. 2004. Thermoperiodic effect of flowering endogenous
hormonal status in Dendrobium (Orchideaceae). Journal of Plant Physiol. 161:
1385-1387.
CHANG C., CHANG W.C. 2003. Cytokinins promotion of flowering in Cymbidium ensifolium var. misericors in vitro. Plant Growth Regul. 39: 217-221.
CHIA T.F., ARDITTI J., SEGREN M.J., HEW Ch.S. 1999. Review: in vitro flowering in
orchids. Lindleyana 14 (2): 60-76.
CLARK M.F., ADAMS S.M. 1977. Characteristics of the microplate method of enzyme linked immunosorbent assay for the detection of plant viruses. J. Gen. Virol. 34:
457-483.
CYBULARZ-URBAN T., HANUS-FAJERSKA E. 2006. Therapeutic effect of cytokinin sequence
application on virus-infected Cattleya tissue cultures. Acta Biol. Crac. Series Bot.48/2:
27-32.
DUAN J.X., YAZAWA S. 1994. In vitro floral development in x Doriella Tiny (Doritis
pulcherrima × Kingiella phillipinensis). Scientia Hort. 59: 253-264.
DUAN J.X., YAZAWA S. 1995. Floral induction and development in Phalaenopsis in vitro.
Plant Cell, Tissue and Organ Culture 43: 71-74.
GRANT M., MANSFIELD J. 1999. Early events in host - pathogen interactions. Curr. Opin.
Plant Biol. 2/4: 312-319.
HSU H.F., YANG CH.H. 2002. An orchid (Oncidium Grower Ramsey) A P3-like MADS gen
regulates floral formation and invitation. Plant Cell Physiol. 43(10): 1198-1209.
KERBAUY G.B. 1984. In vitro flowering of Oncidium varicosum mericlones (Orchidaceae). Plant Sci. Lett. 35: 73-75.
KOSTENYUK J., OH B.J., SO I.S. 1999. Induction of early flowering in Cymbidium niveomarginatum Mak in vitro. Plant Cell Rep. 19: 1-5.
KOZAK D. 1991. Shoot regeneration from various parts of Narcissus cv. Carlton through
tissue culture. Prace ISiK, Ser. B 16: 41-47.
56
T. Cybularz-Urban, A. Bach
MARTINEZ C., PONS E., PRATS G., LEON J. 2004. Salicylic acid regulates flowering time
and links defence responses and reproductive development. Plant J. 37: 209-217.
MUDALIGE G.R., KEUHNLE R.K. 2004. Orchid biotechnology in production and
improvement. Hort Science 39(1): 11-17.
NOWAK B. 1999. Regeneracja śliwy (Prunus domestica L.) odmiany Węgierka Zwykła z
eksplantatów poraŜonych wirusem ospowatości śliw. Zesz. Probl. Post. Nauk Roln. 469:
581-586.
SCORSA R. 1982. In vitro flowering. Hort. Rev. 4: 106-127.
TAYLOR N.J., LIGHT M.E., VAN STADEN J. 2005. In vitro flowering of Kniphofia leucocephala: influence of cytokinins. Plant Cell. Tissue and Organ Culture 83: 327-333.
TRAN THANH VAN K. 1999. Floral and vegetative defferentiation in vitro and in vivo, w:
Morfogenesis in Plant Tissue Cultures. Soh W.Y, Bhojwani Sat S. (Eds), Kluwer,
Dordrecht, The Netherlandes: 215-233.
TSAI W.C., LEE P.F., CHEN H.I., HSIAO Y.Y., WEI W.J., PAN Z.N., CHUANG M.H., KUOH
C.S., CHEN H.H. 2005. PeMADS6, a GLOBOSA/PISTILLATA-like gen in Phalaenopsis
questris involved in petaloid formation and correlated with flower longevity and ovary
development. Plant Cell Physiol. 46(7): 1125-1139.
TSAO C.V., POSTMAN I.D., REED B.M. 1999. Single and multiple virus infections reduce in
vitro multiplication of ‘Malling Landmark’ raspberry. In vitro Cell. Dev. Biol. Plant.
35/3, 41A: 1013.
VAZ A.P.A., FIGUEIREDO-RIBEIRO R.C.L., KERBAUY G.B. 2004. Photoperiod and temperature effect on growth and flowering of P. pussilla,an epiphyc orchid. Plant Physiology
and Biochemistry 42: 411-415.
WILSON W.J., KENNEDY G.C., PEACOCK W., DENNIS S.E. 2005. Microarray analysis reveals
vegetative molecular phenotypes of Arabidopsis flowering-time mutants. Plant Cell
Physiol. 46(8): 1190-1201.
WISLER G.C. 1989. How to control orchid viruses: The complete guidebook. Published
by Maupin Hause Publishers.
YON H.E., SUN Y.J., HWAN I.K., TAE Y., HEE CH.L., SU T.K., YOEOP P.K. 2003. Growth
flowering and variation of somaclones as affected by subcultures and natural materials
supplemented to media in Phalenopsis. Korean Journal of Horticultural Science and
Technology 21(4): 362-368.
YU H., GOH C.J. 2000a. Differential gene expression during floral transition in an orchid
hybrid Dendrobium Madame Thong-In. Plant Cell Rep. 19: 926-93.
YU H., GOH C.J. 2000b. Identification and characterization of three orchid MADS box
genes of the AP1/AGL9 subfamily during floral transition. Plant Physiol. 123:
1325-1336.
YU H., YANG S.H, GOH C.J. 2000. DOH 1, a class I knox gene, is required for maintenance of the basic plant architecture and floral transition in orchid. Plant Cell 12:
2143-2159.
Słowa kluczowe:
storczyki, Cattleya, kultury in vitro, kwitnienie, fitohormony,
meriklony, wirus pierścieniowej plamistości Odontoglossum
(ORSV)
Streszczenie
KWITNIENIE MIESZAŃCA Cattleya (Orchidaceae) ...
57
Materiałem doświadczalnym był blado-fioletowo kwitnący mieszaniec Cattleya
waltersiana × C. marone pochodzący z Ogrodu Botanicznego UJ, poraŜony wirusem
pierścieniowej plamistości Odontoglossum (ORSV). Materiał ten został wprowadzony
w warunki kultury in vitro przez izolację merystemów z wierzchołków wzrostu pędów
(wielkości około 2-4 mm), a następnie namnaŜany w formie kultury pędowej na
poŜywce MS w modyfikacji KOZAK [1991]. Kulturę prowadzono w stałej temperaturze
25°C±2°C, przy wilgotności względnej wynoszącej około 70%, w warunkach
fotoperiodu 16/8 godz. (dzień/noc) i natęŜeniu promieniowania światła białego
wynoszącego 80 µmol⋅m-2⋅s-1, pasaŜując w 8-tygodniowych cyklach. Po 14 miesiącach
kultury na niektórych eksplantatach pędowych wykształciły się spontanicznie drobne
zniekształcone kwiaty. Kwitnące w kulturach in vitro pędy charakteryzowały się
brakiem wyraźnych zmian u liści, jednakŜe kwiaty nie były w pełni wykształcone
morfologicznie. Najokazalsza część okwiatu odpowiadała warŜce osłaniającej
niedokształcony prętosłup. Wybarwienie kwiatów było zbliŜone do wybarwienia
okazałych kwiatów roślin donorowych prezentujących typowe dla obecności tego
wirusa rozbicie barwy. Ich zakwitanie mogło być wywołane wysokim poziomem
cytokinin lub/i obecnością ORSV.
FLOWERING OF Cattleya HYBRID (Orchidaceae) in vitro CULTURES
Teresa Cybularz-Urban 1, Anna Bach 2
Department of Botany, Agricultural University, Kraków
2
Department of Ornamental Plants, Agricultural University, Kraków
1
Key words:
orchid, Cattleya, in vitro cultures, flowering, phytohormones, mericlons, Odontoglossum ringspot virus (ORSV)
Summary
The study was conducted on a hybrid Cattleya waltersiana x C. marone having
light-violet flowers, derived from the Botanical Garden of Jagiellonian University. The
plant was infected with Odontoglossum ringspot tobamovirus (ORSV). Shoot apical
meristem (2-4 mm long) was isolated from this material, transferred into in vitro culture
and then, propagated as a shoot culture on the MS medium with KOZAK’s modification
[1991]. The culture was maintained at 25°C±2°C, relative humidity 70%, under 16 h
photoperiod from white light of 80 µmol⋅m-2⋅s-1 intensity, and with 8-week subcultures.
Some shoot explants spontaneously developed tiny deformed flowers after 14 months of
culture. The shoots flowering in in vitro cultures were characterized by unchanged
leaves but flowers were not fully developed morphologically. The most manifest part of
the perianth corresponded to the lip covering underdeveloped column. The color of flowers was similar to large flowers of the donor plants, showing color break typical for
the presence of the virus. The flowering might have been caused by a high level of
cytokines and/or ORSV infection.
Dr Teresa Cybularz-Urban
Katedra Botaniki
Akademia Rolnicza im. H. Kołłątaja
Al. 29 Listopada 54
31-425 KRAKÓW
e-mail: [email protected]
ZESZYTY PROBLEMOWE POSTĘPÓW NAUK ROLNICZYCH 2007 z. 523: 59-67
WSTĘPNA CHARAKTERYSTYKA MORFOLOGICZNA,
ANATOMICZNA I BIOCHEMICZNA
MIESZAŃCA Cattleya (Orchidaceae) W KULURACH in vitro
W ŚWIETLE UV-A
1
1
Teresa Cybularz-Urban , Ewa Hanus-Fajerska , Adam Świderski
1
2
2
Katedra Botaniki, Akademia Rolnicza im. H. Kołłątaja w Krakowie
Zakład Biochemii, Akademia Rolnicza im. H. Kołłątaja w Krakowie
Wstęp
Większość gatunków Cattleya to epifityczne storczyki, rosnące naturalnie
w międzyzwrotnikowej strefie Ameryki. śyją one w rozwidleniach konarów drzew do
wysokości 30-40 m. W dolnych partiach drzew lokują się storczyki lubiące cień lub
półcień, potrzebujące bardzo wilgotnego powietrza. Natomiast rośliny rosnące wysoko
na drzewach lub skałach będąc wystawione na silne oddziaływanie promieniowania
słonecznego, są równocześnie zraszane obficie przez deszcze i okresowo wysuszane
przez wiatr. W tym stale zmieniającym się środowisku bytują storczyki o budowie
kseromorficznej lub gruboszowate [OSZKINIS 2004].
Badany mieszaniec Cattleya intermedia × C. aurantiaca pochodził z kolekcji
storczyków szklarniowych Ogrodu Botanicznego UJ. W szklarniach i w kulturach in
vitro na ogół nie spotykamy nadmiaru ultrafioletu. Co więcej, dla roślin mnoŜonych in
vitro światło odgrywa rolę raczej w procesie morfogenezy, a nie fotosyntezy, gdyŜ
źródłem energii są dla nich polisacharydy zawarte w poŜywce. Równocześnie
promieniowanie ultrafioletowe, podobnie jak daleka czerwień, nie są roślinom
niezbędne do celów troficznych [MICHALCZUK 2000].
Celem prezentowanego doświadczenia było opracowanie charakterystyki
morfologicznej i anatomicznej roślin uzyskanych w wyniku mikrorozmnaŜania
mieszańca Cattleya. Badanie róŜnic pomiędzy mikroroślinkami poddanymi ekspozycji
na UV-A i kontrolnymi uzyskanymi w kulturach naświetlanych światłem białym,
dotyczyło zmian morfologiczno-anatomicznych, a takŜe zawartości chlorofili i
karotenoidów, co jest bezpośrednio związane z wydajnością fotosyntetyczną materiału
przeznaczanego do aklimatyzacji do warunków ex vitro.
Materiał i metody
Mieszaniec Cattleya intermedia × C. aurantiaca został przeniesiony do warunków kultury in vitro przez izolację merystemów z wierzchołków wzrostu pędów
poprzez fazę ciał protokormopodobnych (protocorm-like bodies, PLBs), a następnie
namnaŜany w formie kultur pędowych na zmodyfikowanej poŜywce MS KOZAK [1991] o
60
T. Cybularz-Urban, E. Hanus-Fajerska, A. Świderski
pH 5,5, zestalanej 0,8% agarem Difco, z dodatkiem 2,0 mg⋅dm-3 siarczanu adeniny, 9,7
mg⋅dm-3 kwasu askorbinowego, 0,2 mg⋅dm-3 zeatyny, 4,95 mg⋅dm-3 BA i 1,0 mg⋅dm-3
NAA. Jako źródło węgla stosowano 3% sacharozę.
Doświadczenie dotyczące wpływu UV-A na budowę i metabolizm mnoŜonego
materiału zakładano z wierzchołkowej części pędów wysokości 5 mm.
PasaŜe przeprowadzano cyklicznie, co osiem tygodni, przenosząc na świeŜą
poŜywkę o tym samym składzie, nie rozdzielając proliferujacych pąków przybyszowych
od eksplantatów. Kultrę prowadzono w stałej temperaturze 25°C±2°C, przy dniu
trwającym 16 godz. Jako źródło światła stosowano monochromatyczne lampy firmy
Philips TLD 36W o długości fal 360-450 nm, w przypadku kontroli, lampy firmy
Tungsram 40W F33 o białej barwie światła [BACH, ŚWIDERSKI 2000]. NatęŜenie
promieniowania światła białego na poziomie kultury roślin wynosiło 60 µmol⋅m-2⋅s-1.
Wilgotność względna kamery fitotronowej wynosiła 80%.
Przez sześć miesięcy prowadzono pomiary biometryczne. Oceniano następujące
cechy: liczba pędów uzyskana z pojedynczego eksplantatu, długość namnoŜonych
pędów oraz liczba i długość korzeni powietrznych o ile doszło do ich regeneracji na
poŜywce proliferacyjnej, świeŜa masa pędów, korzeni i kalusa, jeśli następowało
kalusowanie, sucha masa tkanek zregenerowanych z pojedynczego eksplantatu.
Reprezentatywne próby liści utrwalano w aldehydzie glutarowym, a następnie po
odwodnieniu i nasyceniu, zatapiano w Eponie 812. Tak przygotowane bloczki krojono
przy uŜyciu ultramikrotomu Tesla 490A na skrawki o grubości 1µm. Dokumentację
fotograficzną wykonywano przy uŜyciu mikroskopu świetlnego.
Zawartość barwników w liściach oznaczano zgodnie z metodyką uŜytą przez
BACH i ŚWIDERSKIEGO [2000]. Do oznaczania stęŜenia chlorofili i karotenoidów pobierano
próbki pędów o masie 200 mg. ZamroŜone próbki homogenizowano w moździerzu
porcelanowym w acetonie z dodatkiem węglanu wapnia i piasku kwarcowego. Ekstrakt
sączono do kolbki miarowej 10 ml, a następnie zmierzono absorbancję na
spektrofotometrze Jasco V-530 w kuwetach 0,5 cm przy wybranych długościach fali
662, 645 i 470 nm. StęŜenie barwników obliczono według wzorów LICHTENTHALER i
WELLBRUN [1983].
Doświadczenie prowadzono dwukrotnie w 23 powtórzeniach dla materiału
hodowanego w UV i w takiej samej liczbie powtórzeń dla kontroli naświetlanej
światłem białym. Uzyskane wyniki oceniano statystycznie z zastosowaniem programu
Statistica 6,1 oraz testu F.
Wyniki i dyskusja
Zielono zabarwione tkanki ciał protokormopodobnych hodowane na stałej
poŜywce regenerowały liczne pędy, które po osiągnięciu stadium 2-3 liści pobierano do
doświadczenia z UF-A. JuŜ w trakcie pierwszego pasaŜu kultur pędowych
zaobserwowano pojawianie się pąków przybyszowych. Naświetlanie kultur ultrafioletem wywołało ograniczenie liczby regenerowanych struktur. Liczba pędów
uzyskana w trakcie sześciomiesięcznego okresu trwania kultury na świetle UV-A była
statystycznie istotnie niŜsza aniŜeli liczba pędów namnoŜonych w kulturze kontrolnej
hodowanej na świetle białym i wynosiła średnio 5,13 dla UV oraz 11,61 dla światła
białego (tab. 1). ŚwieŜa masa pędów równieŜ okazała się istotnie zróŜnicowana w tym
układzie doświadczalnym. Większość uzyskanych w trakcie mikrorozmnaŜania pędów
regenerowała korzenie powietrzne, przeciętnie od 1 do 7, jednak statystycznie istotną
róŜnicę wykazano w przypadku pomiaru ich świeŜej masy (tab. 1).
WSTĘPNA CHARAKTERYSTYKA MORFOLOGICZNA, ANATOMICZNA ...
61
Tabela 1; Table 1
Proliferacja i potencjał morfogenetyczny kultur pędowych Cattleya hodowanych
w świetle UV oraz w świetle białym
(* oznacza statystycznie istotne róŜnice dla α = 0,05)
Proliferation and morphogenetic potential of Cattleya shoots cultured
under UV and white light (*are significantly different at α = 0.05)
Rodzaj
stosowanego światła
Light treatment
ó
Liczba
pędów
(szt.)
No. of
shoots
ŚwieŜa
ŚwieŜa
ŚwieŜa
Liczba
masa
masa
masa
korzeni
kalusa
korzeni
pędów
(szt.)
No. of roots Fresh matter Fresh matter Fresh matter
of callus
of roots
of shoots
(g)
(g)
(g)
Sucha
masa
Dry
matter
(g)
UV
5,13*
3,04
0,27*
0,029*
0,08
0,019*
Kontrola (białe)
Control (white)
11,61*
4,04
0,45*
0,078*
0,11
0,039*
σ (UV)
2,81
2,20
0,18
0,031
0,11
0,005
σ (kontrola; control)
4,22
4,32
0,19
0,058
0,09
0,014
odchylenie standardowe; standard deviation
Pod względem budowy morfologicznej organy zregenerowane w trakcie kultury
w świetle UV-A nie odbiegały od kontroli, lecz osiągały mniejsze rozmiary (fot. 1a i b).
Wyraziste róŜnice dotyczyły budowy anatomicznej liści regenerowanych w
zastosowanym zakresie światła. Ultrafiolet spowodował przerost komórek epidermy
liści, zaburzenia w procesie róŜnicowania mezofilu i zniekształcenie struktury
elementów waskularnych, przy jednoczesnym ograniczeniu liczby wiązek
przewodzących w liściu (fot. 2a i b).
StęŜenie barwników fotosyntetycznych czynnych u roślin naświetlanych promieniowaniem zakresu UV-A było znacząco niŜsze w porównaniu do analogicznego
stęŜenia w roślinach kontrolnych (rys. 1). W przeliczeniu na świeŜą masę stęŜenie sumy
chlorofili i karotenoidów było 1,7 razy niŜsze i wynosiło odpowiednio 21,24 i 4,15
mg⋅100 g-1 świeŜej masy. Odpowiadały im odpowiednio niŜsze stęŜenia chlorofili a i b
(rys. 1), jednak większy spadek stęŜenia zanotowano dla chlorofilu a - prawie
dwukrotny.
W badaniach dotychczas prowadzonych w warunkach in vitro, dotyczących
wpływu rozkładu spektralnego światła na wzrost i morfogenezę kultur, zwykle uŜywano
roślin dwuliściennych. JeŜeli chodzi o jednoliścienne, BACH i ŚWIDERSKI [2000]
opublikowali wyniki dotyczące kultur hiacynta, MENKE-MILCZAREK i in. [2001]
wykorzystali w tym celu rośliny zboŜowe, GABRYSZEWSKA i in. [2002] funkię,
Przedstawicieli Orchidaceae wprowadzili do badań TANAKA i in. [1998].
62
T. Cybularz-Urban, E. Hanus-Fajerska, A. Świderski
WSTĘPNA CHARAKTERYSTYKA MORFOLOGICZNA, ANATOMICZNA ...
63
Fot. 1.
Wpływ naświetlania kultur Cattleya intermedia × C. aurantiaca światłem białym
(1a) oraz ultrafioletem (1b) na proces organogenezy w eksplantatach pędowych
Photo 1.
The influence of white (W) (1a) and UV light (1b) on Cattleya intermedia × C.
aurantiaca organogenesis in shoot explants cultivated in vitro
me - mezofil; mesophyll
ep - epiderma; epidermis
v.b. - wiązka przewodząca; vascular bundle
Fot. 2.
Photo 2.
Szczegóły budowy anatomicznej liści zregenerowanych w świetle białym (W) i w
ultrafiolecie (UV)
Anatomical features of leaves regenerated under white (W) and ultraviolet (UV) light
45
40
Pigments concentration [mg/100g]
35
30
25
20
15
10
5
0
UV
Control
Chlorophyll a
UV
Control
Chlorophyll b
UV
Control
Carotenoids
UV
Control
Chlorophylls
Rys. 1.StęŜenie chlorofili i karotenoidów w pędach mieszańca Cattleya po 6 miesiącach kultury
in vitro
Fig. 1. Concentration of chlorophyls and carotenoids in hybryd Cattleya shoots cultivated in vitro
for 6 months
Klon uŜyty w prezentowanym doświadczeniu charakteryzuje się powolnym
wzrostem organów wegetatywnych. Optymalny wzrost roślin uzyskuje się w świetle
rozproszonym [OSZKINIS 2004], z tego względu ten właśnie materiał roślinny wydawał
się odpowiedni dla uzyskania wyrazistych wyników w odpowiedzi na naświetlanie UVA. Naświetlanie młodych roślin mieszańca w sposób ciągły w okresie półrocznym
wywołało wyraźne zmiany anatomiczne, morfologiczne i biochemiczne w porównaniu z
kontrolą. Ich niezbyt ostry przebieg tłumaczyć moŜe częściowy udział niebieskiej części
widma, co wynika z charakterystyki uŜytej lampy.
Rolę światła w morfogenezie łączy się z działaniem światła na substancje
wzrostowe. Światło moŜe wpływać na indukowanie lub hamowanie biosyntezy,
rozpadu i transportu regulatorów wzrostu, moŜe takŜe zmieniać wraŜliwość tkanek na
regulatory endogenne i egzogenne [BALARDI i in. 1988; KOPCEWICZ i in. 1992; DASILVA,
DEBERGH 1997].
JednakŜe informacje na temat wpływu barwy światła na róŜnicowanie, wzrost i
64
T. Cybularz-Urban, E. Hanus-Fajerska, A. Świderski
rozwój pędów oraz korzeni są w wielu przypadkach niejednoznaczne. Wynika to
zapewne z porównania róŜnego rodzaju materiału roślinnego, a takŜe stosowania do
badań roślin w róŜnych stadiach rozwoju i odmiennej metodyki oraz róŜnych źródeł
światła [MICHALCZUK 2000].
Wyniki przedstawione w niniejszej publikacji stanowią podstawę do kontynuacji
prac doświadczalnych nad wpływem promieniowania ultrafioletowego na kultury
Cattleya.
Planowane jako kolejne doświadczenie łagodniejsze traktowanie UV-A
(częściowy udział światła białego i skrócony czas ekspozycji) moŜe ujawnić spodziewane korzyści między innymi w postaci wytworzenia podwyŜszonego poziomu
fenoli. Substancje te jako antyoksydanty chronią rośliny nie tylko przed ujemnymi
skutkami stresu świetlnego, ale takŜe, wpływając na podniesienie ich odporności na
patogeny, mogą decydować o lepszym przygotowaniu roślin do przejścia w warunki ex
vitro [STREB i in. 1998; LAPLAZE i in. 1999; KRIZEK 2004; PFÜNDEL i in. 2006]. Zastosowanie
UV-A stwarza takŜe moŜliwość bardziej naturalnego kształtowania określonego pokroju
roślin, przykładowo zwiększenia ich zwartości przy równoczesnym ograniczeniu
udziału drogich fitohormonów.
Celowe wydaje się równieŜ przeprowadzenie eksperymentów z wykorzystaniem
krótszego zakresu widma, mianowicie UV-B (280-320 nm), które moŜe równieŜ
indukować szereg waŜnych procesów morfogenetycznych roślin.
Literatura
BACH A., ŚWIDERSKI A. 2000. The effect of light quality on organogenesis of hyacynthus
orientalis L. in vitro. Acta Biol. Cracow. Ser. Bot. 42/1: 115-120.
BALARDI R., ROSSI F., LECARI B. 1988. In vitro shoot development of Prunus GF655-2:
interaction between light and benzyladenine. Physiol. Plant. 74: 440-443.
DASILVA M.H.M., DEBERGH PC. 1997. The effect of light quality on the morphogenesis of
in vitro cultures of Azorina vidalii (Wets.) Feer. Plant Cell, Tiss.Org. Cult. 17: 133-142.
GABRYSZEWSKA E., WOJTANIA A., TUŁACZ L. 2002. Wpływ regulatorów wzrostu, paklobutrazolu oraz rodzaju światła na wzrost i rozwój pędów Hosta sieboldiana (Hook.) Engl.
in vitro. Zesz. Probl. Post. Nauk Rol. 448: 611-621.
KOPCEWICZ J., TRETYN A., CYMERSKI M. 1992. Fitochrom i morfogeneza roślin. PWN,
Warszawa: 252 ss.
KOZAK D. 1991. Shoot regeneration from various parts of Narcissus cv. Carlton through
tissue culture. Prace ISiK, Ser. B 16: 58-106.
KRIZEK D.T. 2004. Influence of PAR and UV-A in determining plant sensitivity and
photomorphogenic responses to UV-B radiation. Invited review. Photochemistry and
Photobiology 79(4): 307-315.
LAPLAZE L., GHERBI H., FRUTZ T., PAWLOWSKI K., FRANCHE C., MACHEIX J., AUGUY F.,
BOGUSZ D., DUHOUX E. 1999. Flawan-containg cells delimit Frankia-infected compar-
tments in Casuarina glauka nodules. Plant Physiol. 121: 113-122.
LICHTENTHALER H.K., WELLBRUN A.R. 1983. Determination of total carotenoids and
chlorophyll a and b of leaf extracts in different solvents. Biochem. Soc. Trans. 603:
591-592.
MENKE-MILCZAREK I., śEBROWSKI J., ZIMNY J. 2001. Wpływ jakości światła na somatyczną embriogenezę pszenicy. Biotechnologia 2/53: 99-103.
MICHALCZUK B. 2000. Wpływ jakości światła oraz eksplantatu na morfogenezę pędów
WSTĘPNA CHARAKTERYSTYKA MORFOLOGICZNA, ANATOMICZNA ...
65
petunii w kulturach in vitro. Zesz. Probl. Post. Nauk Rol. 473: 177-184.
OSZKINIS K. 2004. Storczyki. PWRiL Warszawa: 32-36.
PFÜNDEL E.E., AGATI G., CEROVIC Z.G. 2006. Optical properties of plant surface, w: Biology of the plant cuticule. Rieder M., Müller C. (Eds), Annual Plant Review. Blackwell
Publishing 23: 216-249.
STREB P., SHANG W., FEIERABEND J., BLIGNY R. 1998. Divergent strategies of photoprotection in high mountain plants. Planta 207: 313-324.
TANAKA M., TAKAMURA T., WATANABE H., ENDO M., YANAGI T., OKAMOTO K. 1998. In vitro
growth of Cymbidium platlets cultured under superbright red and blue light emmiting
diodes (LEDs). Journ. Hort. Science and Biotech. 73/1: 39-44.
Słowa kluczowe:
storczyki, mikrorozmnaŜanie, UV-A, światło białe
Streszczenie
Licznie występujące w naturalnych warunkach gatunki Cattleya rozwijają się
najlepiej w świetle rozproszonym. Mieszaniec C. intermedia × C. aurantiaca został
przeniesiony do warunków kultury in vitro przez izolację merystemów z wierzchołków
wzrostu pędów poprzez fazę ciał protokormopodobnych a następnie namnaŜany w
formie kultur pędowych na zmodyfikowanej poŜywce MS z dodatkiem 2,0 mg⋅dm-3
siarczanu adeniny, 9,7 mg⋅dm-3 kwasu askorbinowego, 0,2 mg⋅dm-3 zeatyny, 4,95
mg⋅dm-3 BA, i 1,0 mg⋅dm-3 NAA, 3,0 g⋅dm-3 sacharozy i 8,0 g⋅dm-3 agaru Difco.
Kulturę prowadzono w stałej temperaturze 25°C±2°C, w warunkach fotoperiodu
16/8 godz. Jako źródło światła stosowano monochromatyczne lampy firmy Philips TLD
36W o długości fal 360-450 nm oraz, w przypadku kontroli, lampy firmy Tungsram
40W F33 o białej barwie światła. NatęŜenie promieniowania światła białego na
poziomie kultury wynosiło 60 µmol⋅m-2⋅s-1. Naświetlanie kultur pędowych ultrafioletem
wywołało ograniczenie liczby oraz świeŜej masy regenerowanych pędów
przybyszowych. Na większości pędów uzyskanych w trakcie mikrorozmnaŜania
nastąpiła spontaniczna regeneracja korzeni powietrznych. W kulturach eksponowanych
na światło UV-A świeŜa masa zregenerowanych korzeni była istotnie niŜsza w
porównaniu z kontrolą. Organy wegetatywne zregenerowane w trakcie kultury w
ultrafiolecie nie odbiegały od kontroli pod względem budowy morfologicznej, pomimo
iŜ osiągały znacznie mniejsze rozmiary. Natomiast wyraziste róŜnice dotyczyły budowy
anatomicznej liści regenerowanych w trakcie naświetlania UV-A i liści roślin
kontrolnych. Ultrafiolet spowodował przerost komórek epidermy liści, zaburzenia w
procesie róŜnicowania mezofilu i zniekształcenie struktury elementów waskularnych,
przy jednoczesnym ograniczeniu liczby wiązek przewodzących w liściu. StęŜenie
barwników fotosyntetycznych czynnych u roślin naświetlanych promieniowaniem
zakresu UV-A było znacząco niŜsze względem roślin kontrolnych naświetlanych
światłem białym.
PRELIMINARY MORPHOLOGICAL, ANATOMICAL
AND BIOCHEMICAL CHARACTERISTIC
OF MICROPROPAGATED Cattleya HYBRID UNDER UV-A
AND WHITE LIGHT ILLUMINATION
T. Cybularz-Urban, E. Hanus-Fajerska, A. Świderski
66
Teresa Cybularz-Urban 1, Ewa Hanus-Fajerska 1, Adam Świderski 2
1
Department of Botany, Agricultural University, Kraków
2
Department of Biochemistry, Agricultural University, Kraków
Key words:
orchid, micropropagation, UV-A, white light
Summary
Numerous Cattleya species occuring in nature are developing in scattered light.
Tissue culture was obtained by isolation of meristems from Cattleya intermedia x C.
aurantiaca.
Protocorm-like bodies were regenerated in the liquid medium, and afterwards
shoot cultures was initiated on the modified MS medum supplemented with 2.0 mg⋅dm-3
adenine sulphate, 5.0 mg⋅dm-3 benzylaminopurine, 0.2 mg⋅dm-3 zeatin, 1.0 mg⋅dm-3
naphtaleneacetic acid, 3% (w/v) sucrose and solidified with 0.8% (w/v) agar Difco.
Cultures were kept at 25°C±2°C, with 16-h light and 8-h dark period per day, under
UV-A and white light respectively. The exposure of shoot culture to UV-A resulted in
reduction of the number and fresh weight of regenerated adventitious shoots. The aftereffect observed in the majority of regenerated shoots was spontaneous rhizogenesis. In
cultures exposed to UV-A fresh weight of regenerated aerial roots was significantly
lower as compared to the control. Vegetative organs regenerated during the submission
to ultraviolet illumination were of considerably smaller size, still their morphology was
undisturbed. Instead, the distinct dissimilarities were observed in the anatomy of leaves
regenerated in UV-A and in white light. UV-A induced excessive growth of epidermal
cells, disturbances in mesophyll differentiation, deformation of vascular elements and
reducing of vascular bundle number were observed. Concentration of photosynthetically
active pigments was lower in plants exposed to UV-A.
Dr Teresa Cybularz-Urban
Katedra Botaniki
Akademia Rolnicza im. H. Kołłątaja
Al. 29 Listopada 54
31-425 KRAKÓW
e-mail: [email protected]
ZESZYTY PROBLEMOWE POSTĘPÓW NAUK ROLNICZYCH 2007 z. 523: 69-82
WPŁYW DIOD ELEKTROLUMINESCENCYJNYCH (LED)
NA WZROST I MORFOLOGIĘ KALUSA BOBIKU
1
1
1
Ilona Czyczyło-Mysza , Franciszek Dubert , Izabela Marcińska ,
2
Iwona Kacińska
1
2
Instytut Fizjologii Roślin im. F. Górskiego, Polskiej Akademii Nauk w Krakowie
Katedra Fizjologii Roślin, Akademia Rolnicza im H. Kołłątaja w Krakowie
Wstęp
Zastosowanie diod elektroluminescencyjnych (LED ang. light emitting diodes)
jako źródła promieniowania dla roślin wywołuje w ostatnich latach duŜe
zainteresowanie. LED posiadają wiele zalet: są energooszczędne, bezpieczne dla
środowiska naturalnego i dla człowieka, gdyŜ nie zawierają niebezpiecznych związków
rtęci i łatwiej niŜ lampy fluorescencyjne ulegają utylizacji po ich zuŜyciu. Ponadto
charakteryzują się długą Ŝywotnością, są odporne na wibracje, działanie w szerokim
zakresie temperatur (-40°C - +70°C), nie promieniują w podczerwieni i w ultrafiolecie,
są bardziej niezawodne aniŜeli konwencjonalne źródła światła, są łatwe w sterowaniu,
zasilaniu, obsłudze oraz mają bardzo małe rozmiary [BROWN, SCHUERGER 1993; HEO i in.
2002; NHUT i in. 2003; ORZECHOWSKI 2004; PAWLIKOWSKI 2004; SCHUERGER i in. 1997;
WILANOWSKI 2004]. LED emitują promieniowanie monochromatyczne w bardzo wąskim
zakresie widmowym. Szacuje się, Ŝe dają nawet o 130% bardziej czystą barwę niŜ w
przypadku filtrowanego światła widzialnego. Ich wiązka światła moŜe być w dowolny
sposób ukierunkowana, co sprzyja idei tworzenia oświetlenia dostosowującego się do
aktualnej sytuacji. TakŜe tania produkcja masowa czyni prawdopodobnym dalsze
obniŜenie kosztów ich wytwarzania, ze względu na ostrą konkurencję. Z powyŜszych
powodów wydaje się wielce obiecującą moŜliwość zastosowania LED do uprawy roślin
w kontrolowanych warunkach, gdzie mogłyby stanowić elementarne źródła światła w
komorach wegetacyjnych, a nawet w szklarniach produkcyjnych.
W 2001 roku w NASA prowadzono badania, w których wysiłek naukowców był
skoncentrowany na znalezieniu odpowiedniego źródła światła do upraw roślin na
statkach kosmicznych. Panele LED, dające niebieskie i czerwone światło mogłyby
pomóc w uprawie tych roślin, przyczyniając się do poprawienia komfortu Ŝycia
kosmonautów oraz zmniejszenia ilości zapasów Ŝywności zabieranych w podróŜe
kosmiczne [http://news.astronet.pl]. LED dzięki moŜliwości uzyskania z nich
specyficznej długości fali i emisji światła, w bardzo wąskim zakresie widma
promieniowania, były uŜywane do badań fitobiologicznych, dotyczących m.in. syntezy
chlorofilu [TRIPATHY, BROWN 1995], przebiegu fotosyntezy oraz odporności na choroby
pewnych gatunków roślin przetrzymywanych w ich obecności [KNOTT, WHEELER 2005].
Były teŜ uŜywane w fotobioreaktorach glonów [LEE, PALSON 1994] i do badań
fotomorfogenezy [BARTA i in. 1992]. LED wpływają korzystnie na wzrost róŜnych
gatunków roślin, takich jak: sałata, papryka, ogórek, pszenica, rzodkiewka, szpinak,
I. Czyczyło-Mysza i inni
70
szałwia i nagietek [HEO i in. 2002; HYEON-HYE i in. 2005]. Pojawiło się teŜ kilka publikacji
dotyczących zastosowania LED w warunkach in vitro, dla takich gatunków jak:
ziemniak, Rehmannia glutinosa, Cymbidium, Allium, truskawka, Azorina Vidalii
[MOREIRA DA SILVA, DEBERGH 1997; NHUT i in. 2003]. Badania te były jednak realizowane
zwykle w skali mikro (niewielka liczba diod, niewielka oświetlana powierzchnia).
Pomimo, iŜ technologia LED jest stosunkowo nową i mało zbadaną dziedziną, to moŜe
jednak w przyszłości stać się alternatywnym źródłem światła w uprawie roślin.
Rośliny motylkowe, w tym strączkowe, są oporne w hodowli in vitro. Do chwili
obecnej opracowano indukcję i regenerację kalusa bobiku, lecz dla tej grupy roślin słabą
stroną jest ukorzenianie regenerantów i ich aklimacja w warunkach ex vitro [SKRZYPEK
2002].
Celem badań była ocena wpływu światła czerwonego, dalekiej czerwieni,
niebieskiego i białego, pochodzącego od LED na wzrost i róŜnicowanie kalusa bobiku.
Materiał i metody
System świetlny
Zastosowano pleksiglasowe płytki (o wymiarach 15 cm × 15 cm) paneli LED,
emitujące światło niebieskie - 470 nm, czerwone - 660 nm, dalekiej czerwieni - 730 nm,
a takŜe światło białe (rys. 1). Na kaŜdej płytce umieszczono po 25 diod o określonej
barwie. Płytki zostały wykonane w porozumieniu z Centrum Wysokich Ciśnień PAN w
Warszawie, które zajmuje się doświadczalną produkcją LED o zróŜnicowanych
parametrach emitowanego promieniowania (prof. Michał Leszczyński, mgr Robert
Jachymek).
niebieskie/blue
czerwone/red
daleka czerwień/far red
białe/white
300
400
500
600
700
800
900
1000
długość fali; wave length (mm)
Rys. 1.
Fig. 1.
Charakterystyka spektralna zastosowanych LED w doświadczeniu
Spectral characteristics LED used in experiment
Materiał roślinny
Materiał do badań stanowiły rośliny bobiku, odmiany Sonet. Z roślin, wyhodowanych w warunkach polowych, do kultur in vitro pobierano strąki. Poddawano je
dezynfekcji: inkubacji przez 1 min w 70% etanolu, 20 min w 10% domestosie (w/v)
oraz 4-krotnym płukaniu dejonizowaną wodą sterylną. Następnie ze strąków izolowano
WPŁYW DIOD ELEKTROLUMINESCENCYJNYCH (LED) ...
71
zarodki. Do indukcji kalusa, po odcięciu wierzchołka wzrostu pędu, korzenia oraz
liścieni, pobierano z kaŜdego zarodka środek osi o długości 2-3 mm. Takie eksplantaty
wykładano na sterylne płytki, z 25 kratkami, wypełnionymi poŜywką wg MURASHIGE i
3
SKOOG (MS) [1962], którą modyfikowano dodając do 1 dm regulatory wzrostu: 0,5 mg
NAA, 1,0 mg BAP, 0,25 mg GA3, 1000 mg hydrolizatu kazeiny oraz 750 mg inozytolu.
pH poŜywki ustalano na poziomie 5,8. Płytki te umieszczano pod panelami diodowymi
emitującymi światło: niebieskie, czerwone, białe lub daleką czerwień LED (1 eksplantat
na 1 kratkę). Kontrolę prowadzono w płytkach Petriego o średnicy 90 mm,
wypełnionych poŜywką MS o tym samym składzie, w warunkach świetlnych
panujących w komorach wegetacyjnych in vitro (białe światło widzialne, pochodzące ze
świetlówek Philips TL MF 140Wat/33RS), przy 16-godz. fotoperiodzie, w temperaturze
20°C. Na kaŜdy obiekt przypadało po 15 eksplantatów jako powtórzenia. Eksplantaty
poddawano 3-tygodniowemu naświetlaniu w/w wymienionych rodzajów LED. Po 3
tygodniach kultury, tworzące się na eksplantatach kalusy, w obecności LED
i w warunkach kontrolnych (świetlówki), pasaŜowano na świeŜą poŜywkę o tym samym
składzie i umieszczano w komorach wegetacyjnych in vitro (jw.) na okres 7 tygodni.
Pomiary i obserwacje
W jednotygodniowych odstępach czasu określano świeŜą masę i barwę (stopień
brązowienia) poszczególnych kalusów. Stopień brązowienia kalusów określano wg
arbitralnie przyjętej skali, której szczegółowy opis znajduje się w tabeli 1. Bezpośrednio
po 3-tygodniowym naświetleniu (tydzień 0) i po 7-tygodniowej kulturze w komorze
wegetacyjnej pobierano tkanki takŜe do oznaczania zawartość chlorofilu a, b oraz
karotenoidów. Pomiary zawartości tych barwników fotosyntetycznych zostały
wykonane spektrometrycznie (spektrofotometr UV/VIS, prod. LKB, Szwecja) poprzez
pomiar absorbancji przy długości fali: 470, 645 i 662 nm, zmodyfikowaną metodą wg
LICHTENTHALERA i WELLBURNA [1983].
Wyniki
Masa kalusa
Naświetlanie eksplantatów bobiku przez okres 3 tygodni róŜnymi rodzajami LED
wywołało zróŜnicowany następczy wpływ na przyrost świeŜej masy kalusów bobiku
podczas dalszych 7 tygodni kultury w obecności jedynie białych świetlówek typu
Philips (rys. 2). Obserwowano równomierny, sukcesywny przyrost masy wszystkich
kalusów i równocześnie wykazano, Ŝe w ostatnich tygodniach 7-tygodniowej kultury
przyrost ten był statystycznie istotnie większy dla kaŜdego rodzaju LED, w odniesieniu
do kontroli.
Największy przyrost masy kalusów wystąpił po naświetlaniu LED o barwie
białej, szczególnie począwszy od 3 tygodnia kultury po naświetlaniu. Jedynie w dwóch
początkowych tygodniach kultury, przyrost masy kalusów naświetlanych tym rodzajem
światła był porównywalny z kontrolą. Po 3, 4, 5, 6 i 7 tygodniach kultury masa kalusów
była większa odpowiednio o 19,1; 48,3; 71,8; 92 i 120,2% niŜ w tym samym czasie u
kontroli. Były to znacznie wyŜsze wartości w odniesieniu do pierwszego tygodnia
kultury po naświetlaniu.
I. Czyczyło-Mysza i inni
72
240
220
masa kalusa (% kontroli)
mass calus (% of control)
200
180
160
140
120
100
80
60
40
20
0
0
1
2
3
4
5
6
7
tygodnie; weeks
niebieskie; blue
biale; white
czerwone; red
daleka czerwień; far red
Rys. 2.
Następczy wpływ 3-tygodniowego naświetlania LED (światłem białym, czerwonym,
dalekiej czerwieni i niebieskim) na przyrost masy tworzącego się kalusa bobiku
odmiany Sonet, po: 0, 1, 2, 3, 4, 5, 6 i 7 tygodniach oraz światłem pochodzącym ze
świetlówek (kontrola). Wartości średnie z 9 powtórzeń wyraŜone w procentach
kontroli ± SD
Fig. 2.
Consequent influence of 3-weeks LED irradiation (white, red, far red and blue light)
on the increase of produced faba bean cv. Sonet mass callus, after: 0, 1, 2, 3, 4, 5, 6 i
7 week and light derived from fluorescent lamp (control). Means values from 9
replicates in percentage of control ± SD
Kalusy wytworzone na eksplantatach naświetlanych LED o barwie czerwonej
oraz dalekiej czerwieni początkowo miały najmniejszą masę, ale począwszy od 2
tygodnia obserwowano intensywny jej przyrost. W 7 tygodniu kultury po naświetlaniu
tym rodzajem LED odnotowano o 39,0%, natomiast po LED dalekiej czerwieni o
36,7% większą masę kalusów, niŜ w tym samym czasie u kontroli.
TakŜe LED o barwie niebieskiej stymulowały przyrost masy kalusów, jednak w
mniejszym zakresie. Po pierwszym tygodniu kultury w obecności świetlówek Philipsa,
miały masę porównywalną z kalusami wytworzonymi w obecności LED o barwie
białej, po 7 tygodniach nastąpił o 26,3% większy przyrost masy w odniesieniu do
kontroli. Była to jednak najniŜsza masa spośród wszystkich kalusów naświetlanych
róŜnymi rodzajami LED.
Barwa kalusa
Kalusy bobiku zazwyczaj brunatnieją w warunkach in vitro ze względu na
utlenianie się zawartych w nich związków fenolowych. Stopień brunatnienia (brązowienia) kalusów był zaleŜny zarówno od rodzaju LED jak i czasu trwania kultury po
naświetlaniu. Obserwacje morfologii kalusów dokonywano począwszy od 2 tygodnia
kultury w obecności świetlówek Philipsa. Wykazano, Ŝe wszystkie rodzaje LED
wpływały korzystnie morfologię kalusa. W większym stopniu kalusy były barwy
zielonej i w mniejszym stopniu brunatne (tab. 1). NaleŜy zaznaczyć, Ŝe najbardziej
przydatne do regeneracji bobiku są kalusy o barwie zielonej.
Tabela 1; Table 1
Następczy wpływ 3-tygodniowego naświetlania LED
WPŁYW DIOD ELEKTROLUMINESCENCYJNYCH (LED) ...
73
(światłem białym, monochromatycznym: czerwonym, dalekiej czerwieni i niebieskim)
na barwę tworzącego się kalusa bobiku odmiany Sonet po: 2, 3, 4, 5, 6 i 7 tygodniach
oraz światłem pochodzącym z świetlówek (kontrola), (wartości średnie z 6-9 powtórzeń)
Consequent influence of 3 weeks LED irradiance (white, monochromatic: red, far red
and blue light) on the colour of produced faba bean cv. Sonet callus
after: 2, 3, 4, 5, 6 and 7 weeks and light derived from fluorescent lamp (control),
(means values from 6-9 replicates)
Światło; Light
Kalus; Callus
Liczba kalusów; Number of callus
(%)
tygodnie kultury po naświetlaniu LED
weeks culture after LED irradiation
2
3
4
5
6
7
1
2
3
4
5
6
7
8
Niebieskie
Blue
zielony; green
0
14,3
14,3
28,6
42,9
14,3
zielony lekko brązowiejący
green slightly brown
zielony z > 80% brązowiejący
green with > 80% brown
kremowy lekko brązowiejący
cream slightly brown
kremowy z > 80% brązowiejący
cream with > 80% brown
71,5
57,2
57,2
57,2
42,9
71,5
14,3
14,3
14,3
14,3
14,3
0
14,3
0
0
0
0
0
0
14,3
14,3
14,3
14,3
14,3
zielony; green
0
0
16,7
16,7
16,7
33,3
zielony lekko brązowiejący
green slightly brown
zielony z > 80% brązowiejący
green with > 80% brown
kremowy lekko brązowiejący
cream slightly brown
kremowy z > 80% brązowiejący
cream with > 80% brown
50,0
83,4
83,4
88,3
88,3
66,7
50,0
16,7
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
zielony; green
11,1
11,1
11,1
11,1
22,2
22,2
zielony lekko brązowiejący
green slightly brown
zielony z > 80% brązowiejący
green with > 80% brown
kremowy lekko brązowiejący
cream slightly brown
kremowy z > 80% brązowiejący
cream with > 80% brown
11,1
11,1
77,7
88,9
77,7
77,8
0
0
0
0
0
0
22,2
22,2
11,1
0
0
0
55,6
55,6
0
0
0
0
1
2
3
4
5
6
7
8
Białe
White
zielony; green
0
14,3
14,3
14,3
28,6
28,6
zielony lekko brązowiejący
green slightly brown
28,6
57,2
57,2
57,2
57,2
57,2
zielony z > 80% brązowiejący
green with > 80% brown
0
0
0
0
0
0
kremowy lekko brązowiejący
cream slightly brown
57,2
28,6
28,6
28,6
14,3
14,3
Czerwone
Red
Daleka czerwień
Far red
I. Czyczyło-Mysza i inni
74
Kontrola
Control
kremowy z > 80% brązowiejący
cream with > 80% brown
14,3
0
0
0
0
0
zielony; green
0
0
0
0
0
0
zielony lekko brązowiejący
green slightly brown
85,7
85,7
71,5
85,7
100,0
67,2
zielony z > 80% brązowiejący
green with > 80% brown
14,3
14,3
28,6
14,3
0
28,6
kremowy lekko brązowiejący
cream slightly brown
0
0
0
0
0
14,3
kremowy z > 80% brązowiejący
cream with > 80% brown
0
0
0
0
0
0
W drugim tygodniu kultury po uprzednim, 3-tygodniowym naświetlaniu LED
(tydzień 2), jak równieŜ w kontroli, podczas dalszego wzrostu kultury w ciągu
kolejnych tygodni (2, 3, 4, 5, 6 i 7) w komorze wegetacyjnej (świetlówki typu Philips),
nie tworzyły się kalusy o barwie czysto zielonej. Zaś po naświetlaniu wszystkimi
rodzajami LED obserwowano stopniowe pojawianie się fragmentów kalusów o barwie
zielonej (11,1-22,2%), ale dopiero począwszy od 2 tygodnia kultury w komorze
wegetacyjnej.
Po 6 tygodniach kultury następowało zwiększenie zazieleniania kalusów.
Najwięcej fragmentów kalusów koloru zielonego obserwowano na eksplantatach
naświetlanych LED o barwie niebieskiej (42,9%) i białej (28,6%). Po naświetlaniu LED
o barwie czerwonej, wzrost procentowej zawartości zielonych fragmentów kalusów
obserwowano dopiero w 7 tygodniu kultury (w obecności świetlówek). Kalusy
pochodzące z naświetlanych eksplantatów nie traciły zielonej barwy, bowiem ich
zawartość utrzymywała się, w 7 tygodniu było ich 57,2-77,8%. Pozostała część kalusów
ulegała lekkiemu brązowieniu (w tab. 1 zielony lekko brązowiejący). LED o barwie
dalekiej czerwieni najdłuŜej zapobiegało brązowieniu kalusów, pojawiało się ono o dwa
tygodnie później, w porównaniu z pozostałymi LED i kontrolą. Było ich wówczas
niewiele powyŜej 10%. Tak więc naświetlanie wszystkimi rodzajami LED zapobiegało
drastycznemu ciemnieniu kalusów, w porównaniu z kontrolą. W 7 tygodniu kultury nie
obserwowano juŜ w ogóle silnego brązowienia (w tab. zielony z > 80% brązowiejący).
U kontroli zaś prawie całkowitemu brązowieniu uległo ok. 30% kalusów zielonych.
W kulturze po naświetlaniu LED pojawiały się takŜe kalusy o barwie kremowej.
Ulegały one równieŜ częściowemu brązowieniu w trakcie dalszej kultury. W kolejnych
tygodniach, w porównaniu z kontrolą, naświetlanie LED powstrzymywało i hamowało
ich brązowienie. Najbardziej efektywne okazało się naświetlanie LED o barwie
czerwonej i niebieskiej. Wówczas zanikało brązowienie kalusów, ściemniałych
fragmentów było niewiele powyŜej 14%. Po naświetlaniu LED o barwie dalekiej
czerwieni do 3 tygodnia kultury występowało więcej niŜ 50% silnie zbrązowiałych
kremowych kalusów, ale juŜ po dwóch tygodniach ich zawartość zmniejszyła się do 0.
Zatem następczy wpływ tego rodzaju LED był długotrwały.
Podsumowując, większemu przyrostowi świeŜej masy, towarzyszyło zmniejszenie stopnia brunatnienia kalusów bobiku oraz wzrost zawartości fragmentów
kalusów o barwie zielonej i kremowej. W 7 tygodniu kultury, największą procentową
zawartość kalusa koloru zielonego, oraz najmniej brunatnych i ciemniejących tkanek
obserwowano po naświetlaniu kolejno: LED o barwie czerwonej, następnie białej oraz
dalekiej czerwieni. Najmniej zielonego kalusa, bez nekroz, obserwowano po
naświetlaniu LED o barwie niebieskiej. NaleŜy podkreślić, Ŝe w kontroli nie
obserwowano tworzenia się czysto zielonego kalusa.
WPŁYW DIOD ELEKTROLUMINESCENCYJNYCH (LED) ...
75
Zawartość chlorofilu a, b i karotenoidów w kalusie
Zmiany zawartości barwników fotosyntetycznych, w kalusach bobiku, pod
wpływem uprzedniego naświetlania LED, określonych bezpośrednio (tydzień 0) oraz po
7 tygodniach kultury po naświetlaniu przedstawiono na rys. 3a i 3b. W „tygodniu 0”
(rys. 3a) najniŜszą zawartość chlorofilu a, b oraz karotenoidów w kalusach, w stosunku
do kontroli, odnotowano po naświetlaniu LED o barwie dalekiej czerwieni. W
przypadku chlorofilu a, największą jego zawartość obserwowano w kalusach
tworzących się podczas naświetlania LED o barwie białej oraz niebieskiej. Było go
odpowiednio ok. 2,6 i 2,3-krotnie więcej w stosunku do kontroli. RównieŜ kalusy
naświetlane LED o barwie białej i niebieskiej wykazywały odpowiednio 3,0 i 2,5krotnie większą niŜ u kontroli, zawartość chlorofilu b. Naświetlanie LED o barwie
czerwonej nie wykazało istotnego wpływu na zawartość tych barwników. Najmniejszy
wpływ uprzedniego naświetlania LED wykazano na zawartość karotenoidów, niemniej
jednak równieŜ światło białe i niebieskie stymulowało kilkuprocentowy wzrost ich
zawartości.
Po 7 tygodniach kultury kalusów bobiku w komorze wegetacyjnej, obserwowano
znaczący spadek zawartości wszystkich barwników (chlorofilu a, b i karotenoidów) w
porównaniu z „tygodniem 0” (rys. 3b). Nastąpił wówczas kilkukrotny spadek
zawartości zarówno chlorofilu a jak i b oraz nieco mniejszy spadek równieŜ zawartości
karotenoidów po naświetlaniu LED o barwie białej i niebieskiej. Obserwowano
zbliŜone do kontroli pewne wyrównanie zawartości barwników w kalusach, brak było
zawartości skrajnie odbiegających. W przypadku LED o barwie dalekiej czerwieni
obserwowano niewielkie zwiększenie, zaś LED o barwie czerwonej obniŜenie
zawartości chlorofilu a i b, w porównaniu z „tygodniem 0”.
Dyskusja
Długość fali świetlnej, czyli barwa światła ma istotny wpływ na zmiany fizjologiczne, szczególnie dla roślin rozmnaŜanych metodą kultur in vitro, gdyŜ komórki w
początkowym stadium róŜnicowania i regeneracji są szczególnie wraŜliwe na działanie
zewnętrznych czynników fizycznych. Podczas wzrostu i rozwoju roślin w warunkach in
vitro, światło działa głównie jako czynnik morfogenetyczny [GABARKIEWICZ i in. 1995].
Podstawowym czynnikiem regulującym morfogenezę in vitro są egzogenne regulatory
wzrostu. Niezwykle istotnym problemem byłoby zbadanie współdziałania pomiędzy
tymi czynnikami. Wydaje się, Ŝe dzięki zastosowaniu światła o odpowiedniej jakości i
intensywności, moŜna będzie sterować przebiegiem morfogenezy w warunkach in vitro.
I. Czyczyło-Mysza i inni
76
a
50
a
45
40
35
a
30
a
25
bc b
20
a
15
10
b
c
b
a
b
b b
c
5
0
chlorofil a; chlorophyll a
chlorofil b; chlorophyll b
karotenoidy; karotenoids
niebieskie; blue
białe-kontrol; white-control
daleka czerwień; far red
czerwone; red
białe; white
50
45
40
35
30
25
20
15
a
10
b
b
ab ab
a
ab b
ab ab
a
5
a
a
a
a
0
chlorofil a; chlorophyll a
chlorofil b; chlorophyll b
niebieskie; blue
białe-kontrola; white-control
daleka czerwień; far red
karotenoidy; karotenoids
czerwone; red
białe; white
Rys. 3.Zawartość chlorofilu a, b i karotenoidów w kalusie po 3-tygodniowym naświetlaniu
eksplantatów bobiku światłem LED (białym, czerwonym, dalekiej czerwieni i
niebieskim) oraz światłem pochodzącym z świetlówek (kontrola) określanych:
bezpośrednio po naświetlaniu (0 tygodni kultury) (A) oraz po 7 tygodniach kultury w
komorze wegetacyjnej, pod wpływem światła pochodzącego z świetlówek (B).
Wartości oznaczone tą samą literą nie są istotnie, róŜne przy (α < 0,05) wg
wielokrotnego testu Duncana (n = 3)
Fig. 3. Chlorophyll a, b and carotenoids content in callus after 3 weeks irradiation of faba bean
explants by LED light (white, red, far red and blue) and light derived from
fluorescent lamp (control) determined: just after irradiation (0 weeks of culture) (A)
and after 7 weeks of culture in vegetative chamber under light derived from
fluorescent lamp (B). Values signed with the same letters do not differ significantly
according to multiplate Duncana test (α < 0.05); (n = 3)
Światło czerwone i niebieskie wykazuje szczególnie istotny wpływ na wzrost
świeŜej masy kalusa. Kultury kalusa Pelargonium zonale HORT. rosły najintensywniej w
warunkach 3-tygodniowego ciągłego naświetlania światłem niebieskim (450 nm) o
WPŁYW DIOD ELEKTROLUMINESCENCYJNYCH (LED) ...
77
intensywności 15000 µW⋅cm-2, w porównaniu ze światłem zielonym, czerwonym i
ciemnością. Jednak wzrost kalusa Haplopappus gracilis, podanego ciągłemu działaniu
światła niebieskiego przez okres 33 dni, został zahamowany po przeniesieniu do
ciemności. RównieŜ ciągłe działanie światła czerwonego (1000 µW⋅cm-2) hamowało
wzrost kalusa, w przeciwieństwie do dalekiej czerwieni o tej samej intensywności,
wzmagającej jego wzrost. Ciągłe naświetlanie kultury kalusa Daucus carota L.
światłem czerwonym powodowało wzrost masy kalusa w porównaniu z kulturą kalusa
tej rośliny na świetle niebieskim, zielonym czy białym [cyt. za GABARKIEWICZ i in. 1995].
Światło niebieskie i czerwone pozytywnie wpływało na rozwój pędów w kulturach
kalusa kapusty pekińskiej [LEE i in. 1985]. Rodzaj światła, zastosowany podczas kultury
in vitro, takŜe wpływał na indukcję i ustępowanie spoczynku. Światło czerwone
zapobiegało indukcji spoczynku u roślin hiacynta w kulturach in vitro, natomiast
światło niebieskie pogłębiało spoczynek [VAN DER LINDE i in. 1990]. Ponadto światło
niebieskie wywierało zróŜnicowany wpływ na rozwój i wytwarzanie barwników u
róŜnych gatunków roślin [SZWEYKOWSKA, SZWEYKOWSKI 1974; ZENKTELER 1995]. Światło
ultrafioletowe w większości przypadków miało negatywny wpływ. Przykładowo,
światło ultrafioletowe nie stymulowało tworzenia się pędów przybyszowych w
kulturach kalusa z zarodków sosny oraz hamowało wzrost samego kalusa [KADKADE i in.
1978]. Zielone i Ŝółte światło jedynie w niewielkim stopniu stymulowało tworzenie
pąków przybyszowych z fragmentów hypokotyli tego gatunku.
Przytoczone dane literaturowe wyraźnie wskazują na istotny wpływ róŜnych
rodzajów światła na wzrost i rozwój roślin w kulturach in vitro. Brakuje nadal
informacji dotyczących mechanizmu działania światła w morfogenezie organów
u większości gatunków roślin. Badania współdziałania między jakością światła, fotoreceptorami i regulatorami wzrostu są od kilku lat intensywnie rozwijane w wielu
laboratoriach na świecie. Stąd teŜ poszerzają się coraz bardziej moŜliwości wykorzystania światła o róŜnym charakterze spektralnym w rozmnaŜaniu róŜnych gatunków
za pomocą kultur tkankowych [GABARKIEWICZ i in. 1995].
W prezentowanym doświadczeniu wykazano, Ŝe LED o barwie niebieskiej
i białej najbardziej efektywnie powodowały zwiększenie zazieleniania kalusów. Potwierdzeniem tego jest fakt, iŜ równieŜ dla tych LED obserwowano największy wzrost
zawartości wszystkich barwników fotosyntetycznych. Nie ma to jednoznacznego
potwierdzenia w literaturze. Wykazano bowiem, Ŝe fizjologiczna odpowiedź na zmiany
spektrum światła dochodzącego do roślin moŜe być róŜna u róŜnych gatunków roślin.
Jednym z głównych wymagań w hodowli roślin jest dostarczenie dostatecznej ilości i
jakości światła. Potencjalne, elektryczne lekkie źródła światła powinny mieć wysoką
elektryczną wydajność, małą masę i pojemność. Diody świecące, szczególnie w
czerwonym spektrum, mogą spełniać te wymogi [KNOTT, WHEELER 2005].
W prezentowanej pracy opisano wyniki badań wstępnych związanych
z wpływem światła monochromatycznego w postaci diod elektroluminescencyjnych na
wzrost i morfologię (barwę) kalusa bobiku. Autorzy mają nadzieję, Ŝe w niedalekiej
przyszłości pojawi się więcej doniesień z zastosowaniem LED do badań roślin.
Działanie LED na kalusy bobiku moŜna jedynie wiązać z zawartością endogennych
związków fenolowych, gdyŜ roślina ta zawiera bardzo duŜe ilości tych substancji,
głównie tanin. Konsekwencją tego jest gromadzenie się w tkankach bardzo duŜej ilości
produktów utleniania związków fenolowych - chinonów, które wpływają na
brunatnienie tkanek i powstawanie nekroz. Ponadto fenole ze względu na moŜliwość
blokowania działania auksyn i tworzenia połączeń z innymi zwiazkami mogą pełnić
rolę inhibitorów wzrostu. Jednak ich rola w procesie regeneracji bobiku do tej pory nie
została jednoznacznie określona [SKRZYPEK 2002].
W oparciu o wielkość masy i rodzaj barwy kalusów, nie moŜna jednoznacznie
78
I. Czyczyło-Mysza i inni
wskazać, który z eksplantatów ma większy potencjał morfogenetyczny, jednak na
podstawie uzyskanych wyników, wydaje się, Ŝe w przypadku bobiku, potencjalnie
najlepsze pod tym względem będą kalusy o barwie zielonej i zawierające najwięcej
barwników fotosyntetycznych.
Często zdarza się, Ŝe wzrost masy nie idzie w parze z większymi zdolnościami do
róŜnicowania kalusa, poniewaŜ cała energia zostaje włoŜona w produkcję masy, a nie w
regenerację nowego organizmu. śUR i KOŚCIELNIAK [1997] stwierdzili, Ŝe poziom
aktywności metabolicznej kalusa jest silnie uzaleŜniony od stopnia zaawansowania jego
morfogenezy. NieróŜnicujące się tkanki kalusowe charakteryzują się niŜszymi
wartościami emisji ciepła w początkowych etapach kultury. Natomiast tkanki
róŜnicujące się cechuje szybszy metabolizm komórkowy, ujawniający się juŜ we
wczesnych etapach morfogenezy.
Na zakończenie naleŜy podkreślić jeszcze jedną zaletę LED, związaną z niskimi
kosztami ich uŜycia. Przy zastosowaniu konwencjonalnych źródeł światła otrzymujemy
zwykle szerokopasmową emisję światła, z której dopiero przy pomocy róŜnych filtrów,
monochromatorów, siatek dyfrakcyjnych czy pryzmatów wycina się potrzebny zakres
widma. Oznacza to, Ŝe zbędne promieniowanie zostaje zatrzymane w
monochromatorze, a energia potrzebna na jego wytworzenie jest marnowana. W LED
natomiast światło monochromatyczne produkowane jest od razu i nie wymaga
odcinania zbędnych barw. Z tego powodu moŜe zostać w całości wykorzystane przez
rośliny, obniŜając koszty energii potrzebnej na jego wytworzenie. LED są więc wielce
obiecującym źródłem światła dla wzrostu i rozwoju roślin. Autorzy sądzą, Ŝe w
przyszłości moŜna oczekiwać ulepszenia warunków w kulturach tkankowych stosując
diody LED jako główne źródło światła.
Wnioski
1.
Okresowe naświetlanie kalusa bobiku przy pomocy LED stymuluje wzrost masy
kalusa i jego morfologię.
2.
Następczy efekt okresowego naświetlania LED w postaci zwiększenia dynamiki
wzrostu masy kalusa bobiku utrzymuje się przez wiele tygodni dalszej kultury.
3.
LED, szczególnie o barwie niebieskiej i białej, zmniejszają stopień brunatnienia
oraz zwiększają tworzenie się kalusów zawierających fragmenty koloru zielonego
bobiku, bez nekroz.
4.
LED o barwie białej i niebieskiej powodują zwiększenie, natomiast o barwie
czerwonej i dalekiej czerwieni zmniejszenie zawartości chlorofilu a i b oraz
karotenoidów w kalusie bobiku, jednak efekt ten zanika podczas długotrwałej
kultury.
Literatura
BARTA D.J., TIBBITIS T.W., BULA R.J., MORROW R.C. 1992. Evalution of light emitting
diode characteristics for a space-based plant irradiation source. Adv. Spa. Res.
(Abstr.) 12(5): 141-149.
BROWN C.S., SCHUERGER A.C. 1993. Growth of pepper, lettuce and cucumber under light
emitting diodes. Plant Physiol (Abstr.) 102: 88.
GABARKIEWICZ B., GABRYSZEWSKA E., RUDNICKI R.M. 1995. Wpływ jakości światła na
wzrost i rozwój roślin in vitro. Post. Nauk Roln. 4/95: 57-69.
HEO J., LEE CH., CHARKRABARTY D., PEAK K. 2002. Growth responses of marigold and
WPŁYW DIOD ELEKTROLUMINESCENCYJNYCH (LED) ...
79
salvia bedding plants as affected by monochromic or mixture radiation by a lightemitting diode (LED). Plant Growth Regulation 38: 225-230.
HYEON-HYE K.I.M., WHEELER R.M., SAGER J.C., YORIO N.C., GOINS G.D. 2005. Lightemitting diodes as an illumination source for plants: a review of research at Kennedy
Space Center. Habitation 10: 71-78.
KADKADE P.G., WETHERBEE P., JOPSON H., BOTTICELLI C. 1978. Photoregulation of
organogenesis in pine embryo and seedling tissue culture. IV Intl. Congr. Plant Tissue
Cell Cult: 29 (Abstracts).
KNOTT W.M. WHEELER R.M. 2005. Light-Emitting Diodes for Plant Growth. The Bionetics Corporation MD - RES 407: 853-5142.
LEE C.G., PALSON B. 1994. High-density algal photobioreactors using light emitting
diodes. Biotech. Bioeng. (Abstr.) 44: 1161-1167.
LEE S.S., YOON J.Y., OH D.G., WOO J.G. 1985. Effect of phytohormone, temperature,
nitrogen concentration vs. potassium and light quality on formation of callus and
organs in tissue culture of Chinese cabbage, Brassica camestris ssp. Pekinensis. J. Kor.
Soc. Hort. Sci. 26(1): 34-38.
LICHTENTHALER H.K., WELLBURN A.R. 1983. Determination of total carotenoids and
chlorophyll a and b of leaf extracts in different solvents. Biochem. Soc. Transitions 603:
590-592.
MOREIRA DA SILVA M.H., DEBERGH P.C. 1997. The effect of light quality on the morphogenesis of in vitro cultures Azorina vidalii (Wats.) Feer. Plant Cell Tiss. Org. Cult.
51: 187-193.
MURASHIGE T., SKOOG F. 1962. A revised medium for rapid growth and bioassays with
tobacco tissue cultures. Physiol. Plant. 15: 473-497.
NHUT D.T, TAKAMURA T., WATANABE H., OKAMOTO K., TANAKA M. 2003. Responsem of
strawberry plantlets cultured in vitro under superbright red and blue light-emitting
diode (LEDs). Plant Cell Tiss. Org Cult. 73: 43-52.
ORZECHOWSKI M. 2004. Diody LED w oświetleniu - teraźniejszość i przyszłość.
http:ise.pl
PAWLIKOWSKI W. 2004. Diody LED wychodzą z „cienia”. http://dzis.dziennik.krakow.
pl/2004/11.08/13html.
SCHUERGER A.C., BROWN CH., STRYJEWSKI E.C., 1997. Anatomical features of pepper
plants grown under red light-emitting diodes supplemented with blue of far-red light.
Ann. Bot. 79: 273-282.
SKRZYPEK E. 2002. Wzrost, róŜnicowanie i regeneracja w kulturach in vitro bobiku
(Vicia faba ssp. minor). Rozprawa doktorska, Instytut Fizjologii Roślin im F. Górskiego
PAN, Kraków: 88-91; 104-105.
TRIPATHY B.C., BROWN C.S. 1995. Root-shoot interaction in the greening of wheat
seedlings grown under red light. Plant Physiol. 107: 407-411.
VAN DER LINDE P.C.G., DE WAAL H.R.A., GUDE H., TE BOEKHORST A.H.T. 1990. Effects of
light quality on dormancy in Hyacinthus produced in liquid medium. Abstracts VIIth
International Congress on Plant Tissue and Cell Culture, June 24-29, Amsterdam: 235.
WILANOWSKI A. 2004. Obecny stan technologii diod LED i prognozy rozwoju. LED
2 Konf., Zakład Technik i Systemów Oświetlenia Instytut Elektrotechniki, 12 III 2004,
Warszawa 51: 187-193.
śUR I., KOŚCIELNIAK J. 1997. Czy aktywność metaboliczna moŜe stanowić wskaźnik
zdolności do róŜnicowania tkanki kalusowej rzepaku (Brasica napus) w kulturach in
I. Czyczyło-Mysza i inni
80
vitro? II Ogóln. Konf. „Zastosowanie kultur in vitro w fizjologii roślin”, 21-23 XI 1996,
Kraków: 255-262.
Słowa kluczowe:
bobik, LED, kalus, chlorofil a i b, karotenoidy, morgfologię
Streszczenie
Półprzewodnikowe diody elektroluminescencyjne, tzw. LED (light emitting
diodes) mogą stać się alternatywnym źródłem promieniowania dla wzrostu roślin,
poniewaŜ emitują promieniowanie w wąskim zakresie widmowym, mają bardzo małe
rozmiary, niskie zuŜycie energii, długą Ŝywotność, minimalną emisję ciepła, są
bezpieczne dla środowiska naturalnego i dla człowieka, wytrzymałe na wstrząsy i
oddziaływanie otoczenia. Celem badań była ocena wpływu światła czerwonego,
dalekiej czerwieni, niebieskiego i białego pochodzącego od LED na indukcję
i róŜnicowanie kalusów bobiku. Materiał doświadczalny stanowiły niedojrzałe zarodki,
z których indukowano kalusy bobiku. Pojedyncze zarodki, w trakcie tworzenia się na
ich powierzchni kalusów na poŜywce indukcyjnej wg MURASHIGE i SKOOG [1962]
poddawano 3-tygodniowemu naświetlaniu LED o barwie czerwonej, dalekiej czerwieni,
niebieskiej i białej. Kontrolę stanowiły kultury prowadzone w komorze wegetacyjnej in
vitro, gdzie źródło światła stanowiły białe świetlówki Philips’a TL MF 140Wat/33RS.
Wytworzone kalusy przenoszono do warunków kontrolnych w komorze wegetacyjnej
na okres dalszych 7 tygodni kultury. W jednotygodniowych odstępach czasu określono
ich świeŜą masę oraz barwę. Dwukrotnie, po 0 i 7 tygodniach kultury po zakończeniu
naświetlania i dalszej kulturze w warunkach kontrolnych dokonano takŜe pomiaru
zawartości barwników fotosyntetycznych (chlorofilu a, b oraz karotenoidów). W
przypadku wszystkich rodzajów LED obserwowano stymulację wzrostu masy kalusa
bobiku w stosunku do kontroli, przy czym najbardziej dynamiczny jej wzrost
obserwowano w obecności LED o barwie białej. Panele diodowe powodowały równieŜ
zmniejszenie stopnia brunatnienia tkanek kalusowych oraz stymulowały tworzenie się
kalusów zielonych, bez nekroz. Powstrzymywały takŜe brunatnienie kalusów koloru
kremowego. Zawartość chlorofilu a, b oraz karotenoidów w kalusie, po bezpośrednim
działaniu paneli diodowych, intensywnie wzrastała w obecności LED o barwie białej i
niebieskiej, zaś LED o barwie czerwonej i dalekiej czerwieni istotnie obniŜała się. W
czasie dalszej kultury następczy efekt 3-tygodniowego naświetlania LED zanikał
powodując po kolejnych 7 tygodniach zmniejszenie się zawartości chlorofilu a i b w
kalusie bobiku, za wyjątkiem dalekiej czerwieni, kiedy następował niewielki, choć
istotny wzrost ich zawartości. W tym czasie nie obserwowano zwiększenia się
zawartości karotenoidów w stosunku do kontroli. Wydaje się więc, Ŝe uzyskano
potwierdzenie, Ŝe LED mogłyby stanowić dobre źródło światła w kulturach roślin
prowadzonych w warunkach in vitro.
INFLUENCE OF LIGHT EMITTING DIODES (LED)
ON Vicia faba CALLUS GROWTH
AND DIFFERENTIATION
Ilona Czyczyło-Mysza 1, Franciszek Dubert 1, Izabela Marcińska 1, Iwona Kacińska 2
1
Institute of Plant Physiology, Polish Academy of Sciences, Kraków
WPŁYW DIOD ELEKTROLUMINESCENCYJNYCH (LED) ...
2
Key words:
81
Department of Plant Physiology, Agricultural University, Kraków
faba bean, LED, callus, chlorophyll a i b, carotenoids, morphology
Summary
Light emitting diodes (LEDs) can to be an alternative light source for the plant
growth. They have been developed as for plants because of their wavelength specificity
and narrow bandwidth, small mass, low energy, long life, minimum heating emission,
shock- and surrounding environment influence-proof and finally for being safe for both
humans and the natural environment.
The objective of this study was to examine the influence of red, far red, blue, and
white radiation derived from LED on the induction and differentiation of faba bean
callus. Faba bean immature embryos and formed on their surface callus were used as
plant material explants. Single explants were maintained for 3 weeks on the inductive
acc. MURASHIGE and SKOOG [1962] medium under red, far red, blue and white LEDs. As a
control, the culture maintained in in vitro vegetation chamber under the White Philips’a
TL MF 140Wat/33RS fluorescent lamps was used. Next, calli which have been formed
during the irradiation time, were placed under the control conditions in in vitro
vegetation chamber for 7 further weeks. In one week intervals the fresh mass and their
color of each callus was determined. Also, the content of photosynthetic pigments
(chlorophyll a and b, carotenoids) was measured twice, in 0 and 7th week of culture
(after the irradiation with LEDs had been completed). In the case of all LEDs, the
stimulation of callus mass production in faba bean, in comparison with the control was
observed. The most dynamic growth of mass was observed under the white LED. LEDs
caused also a decrease in calli browning and stimulated the formation of green and
cream callus, without necrosis. After direct LEDs irradiation, the content of chlorophyll
a, b and carotenoids in faba bean calli was changed. It was increased after white and
blue light irradiation, whereas after red and distant red light it was indeed decreased.
During further 7 weeks of culture, the consequent effect of LED 3-week-long treatment
diminished. After that time, the content of chlorophyll a and b in faba bean calli was
strongly decreased, except of the far red light treatment, where a slight, however,
significant increase in these pigments content was observed. At that time an increase in
the carotenoids content was not observed, in comparison with the control. It seems that
the application of LED light could be a good source of light conditions for in vitro plant
tissue culture.
Dr inŜ. Ilona Czyczyło-Mysza
Instytut Fizjologii Roślin im. F. Górskiego
Polska Akademia Nauk
ul. Niezapominajek 21
30-239 KRAKÓW
e-mail: [email protected]
ZESZYTY PROBLEMOWE POSTĘPÓW NAUK ROLNICZYCH 2007 z. 523: 83-92
KLONOWANIE cDNA I EKSPRESJA GENU KODUJĄCEGO
MANGANOWĄ DYSMUTAZĘ PONADTLENKOWĄ
Vicia faba ssp. minor W KALUSIE REGENERUJĄCYM
I NIEREGENERUJĄCYM1
1
1
2
GraŜyna Dąbrowska , Karina Kaczmarek , Edyta Skrzypek ,
2
Magdalena Szechyńska-Hebda
1
2
Zakład Genetyki, Uniwersytet Mikołaja Kopernika w Toruniu
Instytut Fizjologii Roślin im. F. Górskiego Polskiej Akademii Nauk w Krakowie
Wstęp
Liczne czynniki biotyczne i abiotyczne powodują wzmoŜoną generację reaktywnych form tlenu, które w normalnych warunkach powstają jako nieuchronny
produkt metabolizmu tlenowego. Do stresu oksydacyjnego dochodzi wówczas, gdy
zaburzona zostaje fizjologiczna równowaga pomiędzy produkcją reaktywnych form
tlenu a działaniem mechanizmów je usuwających. W bezpośrednią regulację
komórkowego stęŜenia anionorodnika ponadtlenkowego O2⋅_ i H2O2 zaangaŜowane są
dysmutazy ponadtlenkowe (E.C.1.15.1.1; SOD - ang. superoxide dismutase),
metaloproteiny katalizujące reakcję dysproporcjonowania (dysmutacji) dwóch
anionorodników ponadtlenkowych do nadtlenku wodoru i tlenu cząsteczkowego [DAT i
in. 2001]. Dysmutazy ponadtlenkowe eliminują zatem pierwszy produkt
jednoelektronowej redukcji tlenu przekształcając go w nadtlenek wodoru, który
usuwany jest następnie przez katalazy i/lub peroksydazy [SCANDALIOS 2005]. Roślinne
dysmutazy ponadtlenkowe tworzą złoŜony i bardzo skuteczny system pierwszej linii
obrony przed stresem oksydacyjnym [ALSCHER i in. 2002]. ChociaŜ rodzina SOD
obejmuje kilka izozymów, to udowodniono, Ŝe jedynie MnSOD (ang. manganese
superoxide dismutase) jest niezbędna do przetrwania organizmów w środowisku
tlenowym [BAEK, SKINNER 2005].
Regulacja ekspresji genu MnSod w stanie stresu oksydacyjnego pozwala komórce
na precyzyjną, zróŜnicowaną w sile i czasie trwania odpowiedź na czynniki wywołujące
stres [SKRZYCKI, CZECZOT 2004]. Stres jest powszechnie postrzegany jako niekorzystny
czynnik środowiskowy, prowadzący do miejscowego uszkodzenia lub nawet zamierania
tkanek oraz efektów metabolicznych, głównie podwyŜszonego poziomu oddychania i
nagromadzenia się substancji szkodliwych, takich jak reaktywne formy tlenu i fenole
[DUBERT 2003].
Metoda kultur in vitro jest niewątpliwie jedną z cenniejszych technik wspomagających postęp w biologii molekularnej roślin. Kultury tkankowe stanowią ponadto
1
Badania realizowano w ramach projektu badawczego nr 3 P06A 009 25 finansowanego przez
Ministerstwo Nauki i Szkolnictwa WyŜszego.
84
G. Dąbrowska i inni
dogodny system modelowy do badania mechanizmów róŜnicowania się tkanek i
regeneracji roślin.
Vicia faba ssp. minor jest gatunkiem o znaczeniu gospodarczym. Opracowano
wydajny sposób regeneracji bobiku, gdzie oś niedojrzałych zarodków (bez merystemów
wierzchołkowych pędu i korzenia) tworzy kalus regenerujący, a oś dojrzałych zarodków
(bez merystemów wierzchołkowych pędu i korzenia) - kalus nieregenerujący [SKRZYPEK
2001].
Wstępne badania przeprowadzono w celu uzyskania sondy molekularnej dla
Vicia faba ssp. minor, umoŜliwiającej sprawdzenie czy gen kodujący manganową
dysmutazę ponadtlenkową ulega róŜnicowej ekspresji u bobiku rosnącego w kulturach
in vitro.
Materiał i metody
Materiał doświadczalny stanowił kalus bobiku odmiany Nadwiślański (Vicia faba
ssp. minor). Po około 10 tygodniach od wysiania nasion bobiku na poletkach
doświadczalnych, z roślin pobrano 4-5 cm strąki. Strąki i nasiona dezynfekowano 1
min. w 70% etanolu, 30 min w 10% Domestosie i płukano 5 razy wodą sterylną. Z
niedojrzałych zarodków izolowano osie zarodków, tworzące kalus regenerujący (R).
Osie dojrzałych zarodków, z których otrzymano kalus nieregenerujący (NR), pobierano
ze sterylnie skiełkowanych nasion bobiku rosnących na agarze w temperaturze 20°C w
warunkach 18/6 godz. - dzień/noc. Kalus regenerujący i nieregenerujący indukowano na
poŜywce MS [MURASHIGE, SKOOG 1962] z dodatkiem 3% sacharozy, 600 mg⋅dm-3 myoinozytolu, 1000 mg⋅dm-3 hydrolizatu kazeiny, 1 mg⋅dm-3 NAA, 0,5 mg⋅dm-3 BAP i 0,25
mg⋅dm-3 GA3, w 16 godz. fotoperiodzie i w temperaturze 20°C. Uzyskany w ten sposób
materiał przechowywano w temperaturze -80°C.
Materiał do izolacji całkowitego RNA uŜytego jako matryca w reakcji RT-PCR
stanowiły siewki bobiku odmiany Nadwiślański. Nasiona moczono przez około 24
godziny w wodzie destylowanej w 30°C, po czym wysiewano do doniczek
wypełnionych mieszaniną wilgotnego piasku i wernikulitu (2 : 1). Doniczki z roślinami
przenoszono do komory klimatyzacyjnej, gdzie rosły na świetle ciągłym w temperaturze
26°C.
Izolacja i oznaczanie stęŜenia kwasów nukleinowych
Izolację RNA ze 100 mg tkanki roślinnej (zarówno z siewek jak i z kalusa)
przeprowadzano zgodnie z protokołem odczynnika TRI-Reagent firmy MRC,
Cincinnati [CHOMCZYŃSKI, SACCHI 1987]. Wyizolowane RNA przechowywano
w temperaturze -80°C.
DNA plazmidowe otrzymywano metodą lizy alkalicznej przeprowadzonej
zgodnie z protokołem [SAMBROOK i in. 1989]. Podczas badań do analizy restrykcyjnej
DNA uŜywano enzymów EcoRI i XhoI w buforze 2×Y+/Tango (Fermentas).
Ilość i jakość kwasów nukleinowych (stosunek A260/A280) mierzono spektrofotometrycznie przy pomocy urządzenia GeneQuant (Pharmacia).
Reakcje odwrotnej transkrypcji, PCR i ligacja
Reakcję odwrotnej transkrypcji przeprowadzono według protokołu opisanego
przez SZYP i in. [2001]. W celu namnoŜenia fragmentu cDNA kodującego MnSod Vicia
KLONOWANIE cDNA I EKSPRESJA GENU KODUJĄCEGO ...
85
faba ssp. minor przeprowadzono reakcje amplifikacji ze starterami MnSOD1 (5’ATTCAACGGCGGAGGTCAT3-’)
i
MnSOD2
(5’-GTAGTAGGCATGTTCCCAAAC-3’) zaprojektowanymi przy pomocy programu OligoAnalyzer 3.0
dla sekwencji konsensusowej, powstałej w wyniku zestawienia sekwencji MnSod Pisum
sativum z homologiczną sekwencją Arabidopsis thaliana (MSD1), obie sekwencje
zdeponowane są w banku genów NCBI, pod numerami odpowiednio: X60170 i
NP_187703. Do projektowania starterów dla cDNA kodującego MnSod bobiku
wykorzystano sekwencję o najwyŜszej homologii pomiędzy MnSod grochu i
rzodkiewnika, obejmującą fragment długości 318 pz. Mieszaninę reakcyjną stanowiły: 2
µg cDNA, 0,6 U polimerazy Taq (EurX), startery MnSOD1 i MnSOD2 i 5 mM dNTP
(Promega). Reakcja przebiegała w następujących warunkach: 94°C - 10 min, 33 cykle
(94°C- 45 s, 51°C - 45 s, 72°C - 45 s).
Produkt RT-PCR, fragment sekwencji genu kodującego MnSod V. faba,
izolowano z Ŝelu agarozowego za pomocą zestawu QIAquick® Gel Extraction Kit
(Qiagen). Produkt PCR ligowano z wektorem pCR®II-TOPO (Invitrogen) według
dołączonego protokołu.
Transformacja komórek bakteryjnych i izolacja DNA plazmidowego
Kompetentne komórki E. coli szczepu DH5α transformowano mieszaniną
ligacyjną poprzez zastosowanie szoku cieplnego. Z wybranych kolonii bakteryjnych
(transformantów) wyizolowano DNA plazmidowego potrzebnego do reakcji
sekwencjonowania wykonanej z uŜyciem uniwersalnego startera M13_rev (5’CAGGAAACAGCTATGAC-3’) w Pracowni Sekwencjonowania i Syntezy Oligonukleotydów Instytutu Biochemii i Biofizyki Polskiej Akademii Nauk w Warszawie.
Hybrydyzacja RNA (technika northern)
Rozdziału cząsteczek całkowitego RNA dokonywano w 1,2% denaturującym
Ŝelu agarozowym z zawartością formaldehydu w temperaturze 4°C. RNA po
elektroforezie przenoszono na membranę nylonową (SIGMA) według protokołu
[SAMBROOK i in. 1989]. Następnie membranę naświetlano UV w celu związania RNA (GS
Gene Linker, BioRad). Sondami molekularnymi do hybrydyzacji było wyznakowane
jednoniciowe RNA bobiku i pszenicy uzyskane z cDNA kodującego manganową
dysmutazę ponadtlenkową w reakcji transkrypcji in vitro z uŜyciem zestawu T7
Transcription Kit (Fermentas). Hybrydyzację prowadzono w buforze Denhardta (1%
w/v Ficoll (typ 400), 1% w/v poliwinylopirolidon, 1% w/v BSA) w temperaturze 65°C
przez noc. Niezwiązaną sondę molekularną usuwano poprzez 3-krotne odpłukiwanie
błony (10 minut w temperaturze 50°C) w roztworze 0,2 x SSC i 0,5% SDS.
Wizualizację przeprowadzano przy pomocy zestawu Phosphoimager FLA3000 (Fuji).
Wyniki i dyskusja
Kultury tkankowe są szczególnie naraŜone na wpływ czynników stresogennych,
gdyŜ juŜ sama hodowla in vitro jest w znacznym stopniu stresująca. W warunkach in
vitro dochodzi do zmiany stęŜenia i kierunku transportu substancji troficznych
obecnych w poŜywce. RównieŜ stęŜenia regulatorów wzrostu oraz skład atmosfery
otaczającej hodowane kultury, w tym warunki tlenowe i stęŜenie etylenu zmieniają się
w trakcie prowadzenia kultur. Ponadto, uwaŜa się, Ŝe same kultury tkankowe, zwłaszcza
izolacja eksplantatów, moŜe generować stres oksydacyjny, chociaŜby na skutek
ekspozycji tkanek, leŜących in vivo w głębi, na bezpośrednie działanie tlenu
atmosferycznego. JednakŜe, pomimo tak wielu negatywnych skutków, stres moŜe mieć
G. Dąbrowska i inni
86
równieŜ charakter pozytywny - indukujący procesy rozwojowe. W kulturach in vitro,
warunki odbiegające od optymalnych wydają się odgrywać waŜną rolę czynnika
sprawczego, stymulującego procesy róŜnicowania komórek. Bodźce stresowe mogą
przyczyniać się do przywrócenia komórkom zdolności mitotycznej, a następnie do
ponownego róŜnicowania, kończącego się często regeneracją nowej, kompletnej rośliny
[DUBERT 2003].
Szerokie zastosowanie w badaniach procesów róŜnicowania oraz zmian genetycznych zachodzących w kulturach in vitro znalazły markery biochemiczne
i molekularne. W wyniku analizy tkanki uzyskanej w kulturze, stwierdzono zróŜnicowane wzory izoenzymatyczne dla hodowli embriogennej i nieembriogennej
[KUCHARSKA 1994]. Od kilkunastu lat podejmowane są próby identyfikacji enzymów
antyoksydacyjnych jako markerów róŜnicowania. Wydaje się, Ŝe aktywności
peroksydazy, dysmutazy ponadtlenkowej i katalazy mogą słuŜyć do oceny kompetencji
kultur tkankowych do regeneracji.
W celu określenia wzorca ekspresji genu MnSod w eksplantatach, z których
otrzymano kalus regenerujący i nieregenerujący przeprowadzono analizę typu northern
dla bobiku odmiany Nadwiślański. W tym celu wyizolowano całkowite RNA z
eksplantatów oraz siewek bobiku, a jego jakość sprawdzano spektrofotometrycznie oraz
wizualnie poprzez elektroforezę w Ŝelu agarozowym. Obrazy rozdziału
elektroforetycznego charakteryzowała obecność róŜnego rodzaju rybosomowego RNA
(rys. 1). Mimo duŜej zawartości związków fenolowych w tkankach bobiku [SKRZYPEK,
DUBERT 2002] pomiary spektrofotometryczne równieŜ potwierdziły wysoką jakość
wyizolowanego RNA. Początkowo jako sondę molekularną wykorzystano MnSod3.1
pszenicy wielkości 702 pz [WU i in. 1999]. JednakŜe, nie uzyskano specyficznej
hybrydyzacji do mRNA bobiku (rys. 1). Jakość sondy molekularnej z pszenicy
MnSod3.1 była wcześniej sprawdzona poprzez wykorzystanie jej do przeszukania
biblioteki cDNA P. nil [DĄBROWSKA i in. 2005]. Brak hybrydyzacji cDNA MnSod3.1 do
mRNA manganowej dysmutazy ponadtlenkowej bobiku, świadczy raczej o
niewystarczającej homologii między tymi sekwencjami, która moŜe wynikać z niskiego
stopnia pokrewieństwa obu gatunków oraz ze zmienności somaklonalnej kultur in vitro,
aniŜeli o zastosowaniu zbyt restrykcyjnych warunków hybrydyzacji czy odpłukiwania
membran. Słuszność powyŜszego załoŜenia wydaje się potwierdzać niespecyficzna
hybrydyzacja sondy MnSod3.1 do rRNA. Dlatego sondę molekularną MnSod dla kultur
V. faba przygotowano poprzez reakcję RT-PCR wykonaną na matrycach cDNA
otrzymanych na drodze odwrotnej transkrypcji całkowitego RNA, pochodzącego z
dwóch niezaleŜnych izolacji. W wyniku obu reakcji PCR otrzymano spodziewany
produkt wielkości około 318 pz (rys. 2).
NR R
NR R
KLONOWANIE cDNA I EKSPRESJA GENU KODUJĄCEGO ...
A
87
B
Rys. 1.
A - Całkowite RNA z eksplantatów nieregenerujących (NR) i regenerujących (R)
bobiku rozdzielone w 1,2% agarozowym Ŝelu denaturującym. B - Autoradiogram
uzyskany po hybrydyzacji z sondą molekularną MnSod3.1 pszenicy wyznakowaną
radioizotopowo (32P)
Fig. 1.
A - Total RNAs from nonregenerating and regenerating explants of V. faba separated
on 1.2% denaturing agarose gel. B - Autoradiograph obtained after hybridisation with
the 32P-labeled probe MnSod of wheat
M
K
1
2
3
4
300 pz
Rys. 2.
Produkty reakcji PCR przeprowadzonej na cDNA bobiku ze starterami MnSOD1 i
MnSOD2. Poszczególne ścieŜki Ŝelu zawierają: M - markerowe DNA PerfectTM 100
bp, K - kontrola negatywna reakcji PCR, 1-2 - produkty reakcji PCR
przeprowadzonej na matrycach cDNA z siewki I bobiku, 3-4 - produkty reakcji PCR
przeprowadzonej na matrycach cDNA z siewki II bobiku
Fig. 2.
The PCR products of reaction carried out with MnSOD1 and MnSOD2 primers using
cDNA of faba bean. The pathways of gel contained: M -DNA PerfectTM 100 bp
marker, K - negative control of PCR reaction, 1-2 - PCR products obtained using
cDNA from first seedling of faba bean, 3-4 - PCR products obtained using cDNA
from second seedling of faba bean
Produkt reakcji RT-PCR oczyszczono z Ŝelu, a efektywność przeprowadzonej izolacji
88
G. Dąbrowska i inni
sprawdzono elektroforetycznie w Ŝelu agarozowym, a następnie wklonowano do
wektora pCR®II-TOPO i przeprowadzono transformowację bakterii E. coli.
Z uzyskanych kolonii bakteryjnych wyizolowano DNA plazmidowe, które poddano
analizie restrykcyjnej enzymem EcoRI w celu kontroli wektora na obecność poŜądanej
wstawki cDNA (dane niepokazane). W ten sposób uzyskano klon cDNA wielkości 318
pz, który następnie zsekwencjonowano (rys. 3). Otrzymaną sekwencję nukleotydową
MnSod V. faba zestawiono w programie ClustalW z sekwencją cDNA genu MnSod3.1
Triticum aestivum (GenBank numer dostępu U72212). Analiza porównawcza wykazała
72,3% podobieństwo między tymi sekwencjami na odcinku długości 318 pz.
Prawdopodobnie zbyt niska homologia między sekwencjami bobiku i pszenicy była
przyczyna niepowodzeń we wstępnych etapach badań. Natomiast homologia cDNA
bobiku z sekwencją cDNA MnSod P. sativum wynosi 95% (rys. 3).
V. faba minor
ATTCAACGGCGGAGGTCATATCAACCATTCTATTTTCTGGAAAAATCTGGCTCCTGTTCG
P. sativum
ATTCAACGGCGGAGGTCATATCAACCATTCCATTTTCTGGAAAAATCTGGCTCCTGTTAG
****************************** *************************** *
V. faba minor
TGAAGGAGGTGGTGAACCACCAAAGGAATCCTTGGGCTGGGCCATTGACACAAATTTTGG
P. sativum
TGAAGGAGGTGGTGAACCACCAAAGGAATCCCTGGGCTGGGCCATTGACACCAATTTTGG
******************************* ******************* ********
V. faba minor
ATCTCTTGAAGCATTGATACAAAAGATTAATGCTGAAGGTGCAGCTCTTCAGGGGTCTGG
P. sativum
ATCTTTGGAAGCATTGATACAAAAGATTAATGCCGAAGGTGCAGCTCTTCAGGCGTCTGG
*** * ************************** ******************* ******
V. faba minor
ATGGGTGTGGCTTGGTCTCGACAAAGAGTTGAAGAGGCTTGTGGTTGAAACCACTGCAAA
P. sativum
ATGGGTGTGGCTTGGTCTCGACAAAGACTTGAAGAGGCTTGTGGTTGAAACCACTGCAAA
*************************** ********************************
V. faba minor
CCAGGACCCACTGGTCACTAAAGGAGCAAGTTTGGTTCCATTGCTTGGAATAGATGGTTT
P. sativum
CCAGGACCCACTGGTGACTAAAGGAGCAAGTTTGGTTCCATTGCTTTGGATAGAT-GTTT
60
422
120
482
180
542
240
602
300
661
*************** ****************************** * ****** ****
V. faba minor
GGGAACCATGCCTACTAC 318
P. sativum
GGGAA-CATGCCTACTAC 678
***** ************
Rys. 3.
Porównanie sekwencji nukleotydowej cDNA V. faba z cDNA genu MnSod
P. sativum wykonane w programie ClustalW. Podkreślono sekwencje przyłączania
starterów MnSOD1 i MnSOD2. Gwiazdkami zaznaczono pozycje identycznych
nukleotydów
Fig. 3.
The comparison of nucleotide cDNA V. faba sequence with cDNA sequence of the
P. sativum MnSod gene performed by ClustalW. Sequences of MnSOD1 and
MnSOD2 primers are underlined. Asterisks indicate identical nucleotides
Sklonowane cDNA bobiku uŜyto do kolejnej hybrydyzacji z całkowitym RNA V. faba
(rys. 4). Wykazano, Ŝe gen MnSod bobiku ulega wyŜszej ekspresji w kalusie zdolnym
regeneracji niŜ kalusie nieregenerującym. Sonda molekularna specyficznie
hybrydyzowała z transkryptem wielkości około tysiąca par zasad. Zademonstrowane
eksperymenty pokazały, Ŝe sklonowany fragment cDNA genu MnSod V. faba moŜe być
KLONOWANIE cDNA I EKSPRESJA GENU KODUJĄCEGO ...
89
z powodzeniem wykorzystany jako sonda molekularna do badania poziomu ekspresji
genu manganowej dysmutazy ponadtlenkowej w tkankach bobiku uzyskanych z kultur
in vitro. W związku z tym zaplanowano szereg kolejnych eksperymentów takich jak
badanie poziomu ekspresji w warunkach stresu termicznego i osmotycznego, które
pozwolą na określenie stopnia zaangaŜowania badanego genu w odpowiedź na warunki
stresu oksydacyjnego w kulturach in vitro.
NR R
NR
R
Rys. 4.
A - Całkowite RNA z eksplantatów nieregenerujących (NR) i regenerujących (R) V.
faba rozdzielone w 1,2% agarozowym Ŝelu denaturującym. B - Autoradiogram
uzyskany po hybrydyzacji z sondą molekularną MnSod bobiku wyznakowaną
radioizotopowo (32P)
Fig. 4.
A - A total RNAs from nonregenerating and regenerating explants of V. faba
separated on the 1.2% denaturing agarose gel. B - Autoradiograph obtained after the
hybridisation with the 32P-labeled probe MnSod of faba bean
Wnioski
1.
Kalus bobiku zdolny do regeneracji wykazuje wyŜszą ekspresję genu kodującego
manganową dysmutazę ponadtlenkową w porównaniu z kalusem
nieregenerującym.
2.
Ekspresja genu kodującego MnSOD moŜe być jednym z markerów róŜnicowania
tkanek w warunkach in vitro.
Literatura
ALSCHER R.G., ERTURK N., HEATH L.S. 2002. Role of superoxide dismutases (SODs) in
controlling oxidative stress in plants. J. Exp. Bot. 53: 1331-1341.
BAEK K-H., SKINNER D.Z. 2005. Differential expression of manganese superoxide dismutase sequence variants in near isogenic lines of wheat during cold acclimation. Plant
Cell Rep. 25: 223-230.
90
G. Dąbrowska i inni
CHOMCZYŃSKI P., SACCHI N. 1987. Single-step method of RNA isolation by acid gua-
nidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156-159.
DAT J.F., INZÉ D., VAN BREUSEGEM F. 2001. Catalase-deficient tabacco plants: tools for in
planta studies on the role of hydrogen peroxide. Redox Rep. 6: 37-42.
DĄBROWSKA G., PRUSIŃSKA J., GOC A. 2005. Identyfikacja cDNA genu RSH (RelA/SpoT
homolog) zaangaŜowanego w odpowiedź Pharbitis nil na warunki stresowe. Zesz.
Probl. Post. Nauk Rol. 509: 333-341.
DUBERT F. 2003. Reakcje tkanek roślinnych in vitro na stres temperaturowy. X Ogólnopolska konferencja kultur in vitro i biotechnologii roślin. Biotechnologia roślinna w
biologii, farmacji i rolnictwie. Wydawnictwa Uczelniane Akademii TechnicznoRolniczej, Bydgoszcz, 18.
KUCHARSKA M. 1994. Markery biochemiczne i molekularne w badaniach kultur in vitro.
Prace Ogrodu Botanicznego PAN, Warszawa - Powsin, 5/6: 9-18.
MURASHIGE T., SKOOG F. 1962. A revised medium for rapid growth and bioassays with
tobacco tissue cultures. Physiol. Plant. 15: 473-497.
SAMBROOK J., FRITSCH E.F., MANIATIS T. 1989. Molecular cloning. A Laboratory Manual.
Cold Spring Harbor Laboratory Press, New York, 10.38-10.40.
SCANDALIOS J.G. 2005. Oxidative stress: molecular perception and transduction of signals triggering antioxidant gene defenses. Braz. J. Med. Biol. Res. 38: 995-1014.
SKRZYCKI M., CZECZOT H. 2004. Ekspresja genów dysmutazy ponadtlenkowej w stanie
stresu oksydacyjnego. Post. Biol. Kom. 31: 81-92.
SKRZYPEK E. 2001. Optimization of the regeneration abilities of field bean (Vicia faba L.
minor) in in vitro culture. Biol. Bull. Poznań 38(1): 87-95.
SKRZYPEK E., DUBERT F. 2002. Wzrost, róŜnicowanie i regeneracja bobiku (Vicia faba L.
minor) w kulturach in vitro. Zesz. Probl. Post. Nauk Rol. 488: 555-564.
SZYP I., DĄBROWSKA G., TRETYN A. 2001. Wykorzystanie tkanki kalusowej w badaniach
nad molekularnymi podstawami fotoperiodycznej indukcji kwitnienia. Biotechnologia
2(53): 165-169.
WU G., WILEN R.W., ROBERTSON A.J., GUSTA L.V. 1999. Isolation, chromosomal loca-
lization, and differential expression of mitochondrial manganese superoxide dismutase
and chloroplastic copper/zinc superoxide dismutase genes in wheat. Plant Physiol. 120:
513-520.
Słowa kluczowe:
Vicia faba ssp. minor, kultury in vitro, manganowa dysmutaza
ponadtlenkowa
Skróty:
RT-PCR - reakcja łańcuchowa polimerazy na matrycy cDNA (ang. reverse
transcription-PCR), dNTP - trifosforany deoksyrybonukleotydów, SDS - dodecylosiarczan sodu (ang. sodium dodecyl sulfate), BSA - albumina z surowicy bydlęcej
(ang. bovine serum albumin), 20 × SSC - (3 mol NaCl⋅dm-3, 0,3 mol⋅dm-3 cytrynian
sodu).
Streszczenie
KLONOWANIE cDNA I EKSPRESJA GENU KODUJĄCEGO ...
91
Dysmutazy ponadtlenkowe pełnią kluczową rolę w systemie antyoksydacyjnym,
a ich obecność stwierdzono zarówno u bakterii tlenowych i droŜdŜy, jak i u roślin
wyŜszych i zwierząt. Badania dotyczące wpływu warunków stymulujących bądź
hamujących dyferencjację kalusa na wzorzec ekspresji genu manganowej dysmutazy
ponadtlenkowej przeprowadzono na bobiku odmiany Nadwiślański (Vicia faba ssp.
minor). W oparciu o sekwencje dostępne w banku genów NCBI (National Center for
Biotechnology Information), zaprojektowano startery i wykonano reakcję PCR w celu
uzyskania fragmentu 318 pz, który wklonowano do wektora pCR®TOPII,
zsekwencjonowano i uŜyto jako sondę do hybrydyzacji typu northern. Sondę
wyznakowano radioizotopowo metodą transkrypcji in vitro, a po hybrydyzacji
otrzymano sygnał dla transkryptu wielkości około tysiąca nukleotydów. Badania
wykazały, Ŝe gen MnSod ulega wyŜszej ekspresji w kalusie regenerującym niŜ
nieregenerującym bobiku.
cDNA CLONING AND EXPRESSION OF GENE ENCODING
MANGANESE SUPEROXIDE DISMUTASE OF Vicia faba ssp. minor
IN REGENERATING AND NON-REGENERATING EXPLANTS
GraŜyna Dąbrowska 1, Karina Kaczmarek 1, Edyta Skrzypek 2,
Magdalena Szechyńska-Hebda 2
1
Nicolas Copernicus University, Department of Genetic, Toruń
2
Institute of Plant Physiology, Polish Academy of Sciences, Kraków
Key words:
faba bean, in vitro cultures, manganese superoxide dismutase
Summary
Superoxide dismutases play a key role in the antioxidant system that explains
their presence not only in aerobic bacteria and yeast, but also in higher plants and
animals. The study concerning the effect of various conditions that stimulate or inhibit
the differentiation of callus on manganese superoxide dismutase gene expression pattern
was carried out on material derived from Vicia faba ssp. minor cv. Nadwiślański. On
the basis of sequences contained in the GenBank National Center for Biotechnology,
primers were designed and used in PCR reaction aiming at the amplification of 318 bp
product, which was cloned into a vector pCR®TOPOII, sequenced and used as a probe
in northern hybridization. The probe was radiolabelled by in vitro transcription, and
after the hybridization, signals were obtained for about 1000 bp transcript. The study
showed a higher expression of MnSod gene in regenerating and non-regenerating faba
bean callus.
Dr GraŜyna Dąbrowska
Instytut Biologii Ogólnej i Molekularnej
Zakład Genetyki
Uniwersytet Mikołaja Kopernika
ul. Gagarina 9
87-100 TORUŃ
e-mail: [email protected]
92
G. Dąbrowska i inni
ZESZYTY PROBLEMOWE POSTĘPÓW NAUK ROLNICZYCH 2007 z. 523: 93-103
KULTURY in vitro JAKO MODEL
W BADANIACH PROCESÓW FIZJOLOGICZNYCH U ROŚLIN
Franciszek Dubert
1
2
1, 2
, Agnieszka PłaŜek 1
Katedra Fizjologii Roślin, Akademia Rolnicza im. H. Kołłątaja w Krakowie
Instytut Fizjologii Roślin im. F. Górskiego Polskiej Akademii Nauk w Krakowie
Definicja modelu, jego zalety i wady
Model uŜyty w miejsce faktycznego obiektu jest to obiekt zastępczy, ułatwiający
wykonanie badań lub wnioskowanie. Aspekt pierwszy ma zastosowanie wówczas, gdy
cecha, którą badamy, jest w obiekcie modelowym szczególnie wyraźna, np. przyjmuje
wyjątkowo wysokie wartości lub zmienia się silnie pod wpływem warunków otoczenia.
W tym bowiem przypadku analizy są łatwiejsze do wykonania, moŜna zastosować
prostsze techniki pomiarowe lub wykonać mniej pomiarów dla uzyskania statystycznie
istotnych róŜnic między obiektami. Do najbardziej znanych roślin uŜywanych jako
modele zaliczyć moŜna Pharbitis nil, Xanthium strumarium czy Hyoscyamus niger w
badaniach fotoperiodyzmu, Mesembryanthemum crystallinum w badaniach stresu
oksydacyjnego, a do badania przebiegu całej ontogenezy roślin stosuje się rzodkiewnik
(Arabidopsis thaliana) lub rzepak o szczególnie krótkim cyklu rozwojowym. Modelem
dla kultur in vitro były przez wiele lat kultury roślin psiankowatych (Solanaceae).
Cenną cechą modelu moŜe być jego uproszczona struktura i sieć zaleŜności, w wyniku
czego przy interpretacji wyników wystarczy uwzględnić mniej czynników, których
zmienność mogłaby zakłócić pomiary lub utrudnić uzyskanie wiarygodnych wyników,
w porównaniu z badaniami wykonanymi na rzeczywistym obiekcie.
Przy wyborze rośliny modelowej bierze się pod uwagę róŜne aspekty:
•
•
•
•
•
•
•
łatwiejszy dostęp lub tańszy w utrzymaniu niŜ obiekt właściwy,
mniejsza niŜ właściwy obiekt (np. Arabidopsis), przez co moŜna uzyskać do
badań znacznie więcej osobników,
mniejszy genom (takŜe Arabidopsis) co upraszcza wiele badań genetycznych czy
molekularnych, lub genom rośliny modelowej jest juŜ zmapowany,
podwojony haploid i stąd znakomicie ułatwia badanie zaleŜności pomiędzy
genotypem i fenotypem,
prostsza struktura, np. kultury in vitro jako model rzeczywistej rośliny.
Modelowaniem są takŜe zabiegi upraszczające lub ułatwiające badania takie jak:
wyrównanie populacji przez usunięcie osobników najbardziej odbiegających od
przeciętnych,
wykonanie eksperymentu w ustabilizowanych i kontrolowanych warunkach
wegetacji, nie czekając, aŜ warunki takie nastąpią podczas wegetacji roślin w
polu,
94
•
•
•
•
•
•
•
F. Dubert, A. PłaŜek
ujednolicenie warunków troficznych u roślin, np. poprzez ustalenie liczby liści i
strąków,
znormalizowanie warunków świetlnych wzrostu roślin (zastosowanie lamp
emitujących światło o określonym natęŜeniu i składzie spektralnym, takŜe
zastosowanie określonego fotoperiodu),
poddanie roślin znormalizowanemu stresowi (określone natęŜenie i czas
działania),
uŜycie genotypów o skrajnych wartościach badanej cechy, co ułatwia badanie jej
wpływu na inne cechy roślin, np. do badań wpływu mrozoodporności na plon,
najlepiej uŜyć odmian skrajnie odpornych i wraŜliwych na mróz,
zastosowanie takich izotopów radioaktywnych, jak 14C, 3H, 35S, 32P, które
umoŜliwiają śledzenie szlaków transportu metabolitów zawierających „znakowane” atomy; naleŜy jednak pamiętać, Ŝe izotopy te róŜnią się masą atomową
od atomów nieradioaktywnych, a zatem róŜnią się takŜe szybkością dyfuzji i
transportu,
zastąpienie rzeczywistego obiektu jego matematycznym modelem i badanie
wpływu modelowanych matematycznie czynników zewnętrznych na przebieg
wirtualnych procesów wewnętrznych,
wykonanie tzw. „doświadczenia myślowego” (termin zaproponowany przez
Einsteina), czyli eksperymentu prowadzonego w wyobraźni badacza, przy
„uŜyciu” wszelkich potrzebnych urządzeń pomiarowych, pracujących bezbłędnie
i w pełnym zakresie moŜliwości fizycznych; doświadczenia takie pozwalają
określić nieprzekraczalne granice poznania świata, wyznaczone przez
podstawowe prawa fizyki.
UŜycie modelu ułatwia wykonanie pomiarów, analizę statystyczną wyników i
wnioskowanie. Zdarza się jednak, Ŝe eksperymentatorzy zapominają po wykonaniu
eksperymentu, Ŝe posłuŜyli się modelem i sformułowane przez nich wnioski mogą być
zastosowane jedynie do opisu tego modelu. Nie moŜna zatem przenosić ich i uogólniać
na inne obiekty roślinne i inne warunki doświadczenia. Doświadczenie modelowe
wymaga więc weryfikacji na rzeczywistym obiekcie, a w szczególności badania
wykonane na roślinach uprawnych wymagają weryfi-kacji w warunkach polowych.
Podział procesów zachodzących w roślinach
na podstawie poziomu organizacji obiektu, w którym zachodzą
Dokonany tu podział moŜe wydać się zbyt kategoryczny, bowiem rzeczywiste
procesy fizjologiczne mają często charakter mieszany, nie ograniczony do jednego
poziomu organizacji strukturalnej rośliny. W takim przypadku przyjęto, Ŝe jeden z tych
poziomów dominuje i dany proces został zakwalifikowany do tego właśnie poziomu
organizacji albo, przypisano mu mieszany komórkowo-systemiczny charakter.
Do procesów zachodzących głównie w strukturach subkomórkowych naleŜą faza
jasna i ciemna fotosyntezy roślin C-3 (struktury lamellarne chloroplastów), fosforyzacja
oksydacyjna (wewnętrzna błona mitochondriów), transport do i z komórki
(plazmolema), wewnątrzkomórkowa transmisja sygnałów (plazmolema i błony
organelli), synteza białek (rybosomy), kwasów nukleinowych (jądro komórkowe),
tłuszczów (wieloenzymowe kompleksy cytoplazmatyczne), węglowodanów (np.
struktury plazmolemy syntetyzujące włókienka celulozowe), transport jonów i
asymilatów (kanały jonowe i inne), a takŜe równowaga pomiędzy procesami hydrolizy i
syntezy skrobi (amylazy). Do tej grupy moŜna teŜ zaliczyć przepływ wody przez
KULTURY in vitro JAKO MODEL W BADANIACH ...
95
plazmolemę (akwaporyny), który przy suboptymalnym uwodnieniu komórki prowadzi
do stresu osmotycznego. Powstają wówczas pod wpływem kwasu abscysynowego lub
kwasu jasmonowego specyficzne białka dehydryny. Zatrzymują one jony w komórce
podwyŜszając stęŜenie soku komórkowego i zapobiegając jej odwodnieniu. Wykazują
teŜ właściwości ochronne wobec białek cytoplazmy. Dzięki domenom hydrofilowym i
hydrofobowym przywracają właściwą konformację częściowo rozwiniętym łańcuchom
białkowym [KACPERSKA 2002].
Do procesów rozgrywanych głównie na poziomie całych komórek naleŜą takie,
jak transmisja sygnałów (egzogenne substancje sygnałowe), komórkowe aspekty
gospodarki wodnej (transport wody między komórkami), czy komórkowe aspekty
odporności roślin na stresy (mróz, chłód, suszę i metale cięŜkie).
Procesy o charakterze mieszanym, komórkowym i systemicznym rozgrywają się
w komórkach i poza nimi. Typowym przykładem jest odporność roślin na mróz. Znane
są wprawdzie komórkowe mechanizmy hartowania na mróz (gromadzenie cukrów,
proliny i białek ochronnych), ale dla wypadkowej mrozoodporności rośliny kluczowa
moŜe okazać się podwyŜszona wraŜliwość szyjki korzeniowej na przemarzanie w
wyniku czego roślina usycha.
Procesem o charakterze mieszanym jest odporność roślin na metale cięŜkie. Są
one wprawdzie wiązane w komórkach w nierozpuszczalne połączenia (procesy
komórkowe), jednak na granicy korzeń/łodyga pojawia się bariera dla cięŜkich metali.
W wyniku jej obecności stęŜenie cięŜkich jonów w częściach nadziemnych jest
wielokrotnie mniejsze niŜ korzeniach, chociaŜ właśnie w organach transpirujących
metale te powinny się akumulować. Specyficznymi białkami biorącymi udział w reakcji
odpornościowej na jony metali cięŜkich są fitochelatyny, których składnikiem jest
glutation, zawierający reszty tiolowe. Wychwytują one jony metali cięŜkich, a
powstające kompleksy deponowane są w wakuoli [KACPERSKA 2002].
Procesy obronne uruchamiane w czasie patogenezy przebiegają głównie na
poziomie komórkowym. Po rozpoznaniu patogena przez receptory błonowe uruchamia
się kaskada sygnałów, co prowadzi do ekspresji genów kodujących enzymy szlaków
metabolicznych, na których znajdują się związki waŜne dla odporności. Kluczowym
enzymem jest amoniakoliaza fenyloalaniny, która umoŜliwia syntezę takich związków
fenolowych, jak kwas salicylowy, lignina, czy fitoaleksyny. Powstają teŜ białka typu PR
(ang: pathogenesis-related proteins) takie jak glukanaza, chitynaza, tioniny, osmotyny
czy taumatyny [Mauch i in. 1988; HAMMOND-KOSACK, JONES 1996; MAUCH-MANI, MÉTRAUX
1998]. Wymienione komórkowe procesy składają się jednak na proces obrony
systemicznej, określany jako SAR (ang: systemie acquired resistance), w którym kwas
salicylowy jako cząsteczka sygnałowa przekazywany jest wiązkami przewodzącymi z
organów poraŜonych do zdrowych, gdzie indukuje syntezę białek PR, fitoaleksyn i RFT
(reaktywne formy tlenu). Innym mechanizmem systemicznym jest reakcja nadwraŜliwości (ang: HR - hypersensitive response). Dochodzi wówczas do zaprogramowanej śmierci komórek zaatakowanych przez patogen oraz komórek otaczających
miejsce infekcji. W tym drugim przypadku śmierć zdrowych komórek następuje w
wyniku otrzymania przez nie zewnętrznego (systemicznego) sygnału.
Najbardziej typowym procesem komórkowo-systemicznym jest jednak zdolność
roślin do wzrostu i rozwoju przy ograniczonym zuŜyciu wody. Maksymalizacja
współczynnika efektywności uŜytkowania wody WUE (water use efficiency) następuje
w wyniku współdziałania procesów zachodzących na róŜnych poziomach struktury
rośliny. Na poziomie komórek moŜe to być mechanizm utrzymujący metabolizm przy
wyŜszym stęŜeniu soku komórkowego. Na poziomie liści moŜe to być okresowe
przymykanie aparatów szparkowych i większy stopień zatrzymywania i reasymilacji
dwutlenku węgla pochodzącego z oddychania. Na poziomie systemicznym natomiast,
96
F. Dubert, A. PłaŜek
oszczędne uŜytkowanie wody moŜe wynikać z ograniczonego pobierania wody przez
korzenie lub ich ograniczonego wzrostu. Z procesem tym wiąŜe się odporność roślin na
suszę. Uczestniczy tu szereg zjawisk komórkowych. Powstają specyficzne białka
wiązane początkowo z szokiem cieplnym i stąd nazwane HSP (ang. heat shock proteins)
o zróŜnicowanej lokalizacji w komórce (grupa I i II - cytozol, III -chloroplasty, IV mitochondria, V - retikulum endoplazmatyczne i VI - nieznana lokalizacja). Stabilizują
one białka błonowe i inne, pełnią funkcje opiekuńcze jako czaperony (ang. chaperons) i
stymulują mechanizmy naprawcze. Powstają teŜ w wyniku wzrostu stęŜenia ABA,
zranienia czy zasolenia. Białko opiekuńcze kontroluje pofałdowanie innych białek. Brak
białek opiekuńczych groziłby powstaniem przypadkowych konformacji, a nawet
splątaniem łańcucha polipeptydowego powstającego białka [KACPERSKA 2002].
Procesami systemicznymi lub organizmalnymi są te, w których dominuje
strategia celu całego organizmu, realizowana takŜe przez cały organizm. MoŜna tu
zaliczyć apoptozę, termo- i fotoindukcję kwitnienia, obfitość kwitnienia, plonowanie,
architekturę rośliny, strukturę plonu, spoczynek nasion oraz długość cyklu
wegetacyjnego.
W przypadku roślin uprawnych najwyŜszy stopień organizacji wykazują procesy
rozgrywane na poziomie populacji lub łanu, a więc odnoszone do relacji pomiędzy
roślinami w ich zbiorowisku. NaleŜą do nich plonowanie łanu, gospodarka wodna,
mineralna i energetyczna łanu, kształtowanie architektury roślin decydujące o
pionowym rozkładzie natęŜenia i składu spektralnego światła oraz powierzchni
asymilacyjnej w łanie, czy teŜ konkurencja pomiędzy roślinami w powietrzu i w glebie
(allelopatia).
Kultury in vitro jako model o unikalnych właściwościach
Model ten jest często stosowany dla opisu róŜnych procesów w roślinach. Dzieje
się tak poniewaŜ kultury in vitro:
•
pozwalają obniŜyć koszty eksperymentu poprzez ograniczenie powierzchni
hodowli, ograniczenie potrzeby klimatyzacji tylko do naczyń hodowlanych,
zmniejszenie intensywności światła, itp. walory te mogą zrekompensować
większy koszt podłoŜa dla hodowli in vitro w porównaniu z substratem glebowym,
•
pozwalają eliminować wpływ mikroorganizmów na wartości mierzonych
parametrów fizjologicznych w roślinach; udział masy mikroorganizmów w masie
rośliny jest wprawdzie znikomy, jednak ze względu na wielką intensywność ich
metabolizmu, mogą mieć znaczący udział w obserwowanej sumarycznej
intensywności procesów metabolicznych w roślinie,
•
w kulturach in vitro moŜliwa jest selekcja komórek i tkanek o ujednoliconych i
ulepszonych właściwościach,
•
w naczyniach hodowlanych wegetacja kultur odbywa się w lepiej regulowanych i
stabilizowanych warunkach w porównaniu z warunkami zewnętrznymi,
•
w ustabilizowanych kulturach in vitro moŜna przez długi czas utrzymywać na
stałym poziomie stan fizjologiczny (wiek?) komórek, pozwala to powtarzać
eksperyment, co jest trudne przy uŜyciu kompletnych roślin, gdyŜ naleŜy
uwzględnić zachodzące w nich procesy wzrostu, rozwoju i starzenia komórek,
organów i całych roślin.
KULTURY in vitro JAKO MODEL W BADANIACH ...
97
Kultury in vitro jako model rośliny - głosy za i przeciw
Przeciwnicy zgłaszają obawy płynące z przeświadczenia, Ŝe kultury in vitro są
„sztucznymi tworami” rosnącymi w warunkach, nie pozostającymi w Ŝadnej relacji do
rzeczywistych warunków wegetacji roślin. Przyjrzyjmy się bowiem krytycznie
„zewnętrznym warunkom wegetacji” tak, jak są one odbierane przez komórki
mieszczące się we wnętrzu rośliny. Czy jeŜeli będziemy utrzymywać w komorze
wegetacyjnej określone i stabilne natęŜenie i skład spektralny światła, temperaturę,
skład i wilgotność powietrza, a takŜe wilgotność i skład mineralny gleby, to czy z tego
wynika, Ŝe wszystkie komórki w roślinie będą tak samo odbierać te warunki? OtóŜ,
absolutnie nie. KaŜda roślina wytwarza bowiem wewnętrzne środowisko, którego
parametry bardzo odbiegają od tych na zewnątrz. Przykładowo, w komorach
powietrznych w owocu papryki, czy w łodygach niektórych roślin stęŜenia dwutlenku
węgla sięgają wartości 2-3%, są więc niemal stukrotnie wyŜsze od stęŜenia tego gazu w
atmosferze. Z zawartością tlenu jest przeciwnie - komórki leŜące w głębi tkanek
sąsiadują z przestworami powietrznymi o obniŜonej jego zawartości. StęŜenia innych
gazowych składników wewnętrznej atmosfery takich jak etylen, tlenek azotu, czy
izopren, takŜe są róŜne w róŜnych organach rośliny. Skład wewnętrznej atmosfery w
liściach zaleŜy od ruchów aparatów szparkowych, a nie od działania aparatury
klimatyzacyjnej w komorze wegetacyjnej. Nawet tak oczywisty parametr jak
temperatura ma inne znaczenie dla komórek w liściach nasłonecznionych i
zacienionych, a wewnątrz łanu natęŜenie światła spada do ok. 1% wartości mierzonej w
szczytowych partiach łanu. Wreszcie, w roślinach występują gradienty stęŜeń substancji
pokarmowych, hormonów i jonów nieorganicznych, silnie róŜnicujące warunki Ŝycia
komórek w róŜnych częściach rośliny.
Nastawione parametry wegetacji roślin są zatem istotne jedynie dla powtarzalności eksperymentu. Natomiast parametry te w bardzo małym stopniu określają
wartości parametrów wewnętrznego środowiska rośliny, odbierane przez komórki
zlokalizowane w róŜnych miejscach organizmu rośliny. Reakcja rośliny na określone
warunki klimatyczne jest więc jedynie średnią z jednostkowych reakcji poszczególnych
komórek, przy czym nie mamy pojęcia jak bardzo rozrzucone są wartości składające się
na tę średnią. Ponadto trzeba wziąć pod uwagę, Ŝe rośliny zbudowane są z organów w
róŜnym wieku, a poszczególne organy takŜe składają się z komórek starszych i
młodszych, pozostających w róŜnych etapach rozwoju. Wypadkowa reakcja rośliny jest
więc takŜe uśrednieniem reakcji komórek w róŜnym wieku, a udział poszczególnych
klas wiekowych jest poza kontrolą eksperymentatora.
W kulturach in vitro parametry ekofizjologiczne takŜe przyjmują inne wartości
aniŜeli te charakteryzujące rośliny. W warunkach in vitro wszystkie parametry wzrostu
są inne, niŜ w tzw. warunkach naturalnych: natęŜenie i spektrum światła, skład i
wilgotność atmosfery, kompozycja poŜywki, w tym stosunki hormonalne, i wreszcie
gradienty składników pokarmowych. Nie musi to jednak deprecjonować kultur in vitro
jako modelu roślin, poniewaŜ z poprzednich rozwaŜań wynikało, Ŝe warunki w róŜnych
miejscach in planta takŜe odbiegają od warunków zewnętrznych zapewnionych przez
aparaturę klimatyczną. Kultury in vitro wnoszą jednak wiele korzyści do badań roślin.
Oprócz powtarzalności eksperymentalnej porównywalnej z kulturami ex vitro, kultury
sterylne pozwalają uzyskać nieporównywalnie większą jednolitość badanego materiału.
Komórki w warunkach in vitro są bowiem wystawione bezpośrednio na wpływ
zastosowanych parametrów wegetacji, które dzięki temu oddziałują jednakowo na
wszystkie komórki w kulturze. W kulturach in vitro moŜemy ponadto kontrolować
udział komórek w róŜnym wieku, a jeśli ich róŜnorodność jest mimo wszystko za
98
F. Dubert, A. PłaŜek
wysoka, moŜemy ją zawęzić poprzez segregację komórek określonego typu. Kultury in
vitro pozwalają więc daleko lepiej zdefiniować przedmiot badań, nawet jeśli nie
wiadomo, jak dalece model ten odbiega od rzeczywistej rośliny. Nie powinno się jednak
stosować ich bezkrytycznie w modelowaniu wszelkich procesów roślinnych, choć dla
niektórych z nich mogą stanowić cenny model.
Podział kultur in vitro w zaleŜności od poziomu organizacyjnego
Jako kultury subkomórkowe moŜna wymienić izolowane organella komórkowe:
jądra, chloroplasty, mitochondria, rybosomy czy błony komórkowe. Uzyskuje się je
zwykle z protoplastów, choć moŜliwa jest takŜe izolacja z tkanek czy organów roślin.
W tym drugim przypadku wydajność uzyskiwania organelli jest jednak duŜo niŜsza z
uwagi na uszkodzenia mechaniczne występujące w trakcie homogenizacji tkanek.
Ponadto, izolowanie organelli z protoplastów następujące w płynnej poŜywce jest dla
nich mniejszym stresem, niŜ w przypadku izolacji z organów roślinnych, zwłaszcza,
gdy wydobycie organelli wymaga mechanicznego zniszczenia ściany komórkowej.
Do kultur komórkowych naleŜą głównie kultury protoplastów i zawiesin
komórkowych. Czasami kultura komórek w ustabilizowanych zawiesinach moŜe
stanowić lepszy model aniŜeli protoplasty, poniewaŜ komórki w zawiesinie nie zostały
uprzednio poddane stresowi izolacji. W badaniach przepuszczalności plazmolemy
jednak najwaŜniejszą zaletą protoplastów jest właśnie brak ściany komórkowej, która
bardzo utrudnia prowadzenie tych badań na innych obiektach. Do modeli komórkowych
moŜna zaliczyć takŜe kultury niezróŜnicowanego kalusa. Jest to wprawdzie system
ponadkomórkowy, jednak w kalusie niezróŜnicowanym dominują właściwości
pojedynczych komórek. NaleŜy jednak podkreślić, Ŝe właściwości komórek kalusa
określone są nie tylko przez warunki hodowli, ale takŜe przez rodzaj uŜytego
eksplantatu. To zróŜnicowanie właśnie, zaleŜnie od źródła pochodzenia, moŜe się
utrzymywać przez długi okres hodowli in vitro.
Kulturę ponadkomórkową, ale nie systemiczną, stanowi kalus róŜnicujący. W
zaleŜności od genotypu, rodzaju eksplantatu i warunków hodowli róŜnicowanie moŜe
dotyczyć elementów wiązek przewodzących, fragmentów quasi skórki jako zaczątków
tkanki okrywającej, organogenezy (róŜnicowanie korzeni, liści i pędów) i w
najdoskonalszej formie embriogenezy. Do tego poziomu organizacyjnego naleŜą teŜ
kultury fragmentów liści, korzeni wierzchołków wzrostu, czy organów generatywnych.
Zaletą ich jest moŜliwość standaryzacji poprzez stosowane powtarzalnych warunków
kultury.
NajwyŜszą formę organizacyjną kultur in vitro stanowią kultury systemiczne, a
więc kultury regeneratów i np. zarodków somatycznych.
Specyficzne problemy z zastosowaniem protoplastów jako modelu
Wraz z opanowaniem techniki masowej izolacji protoplastów pojawiło się duŜo
prac, w których obiekty te zostały zastosowane. Pamiętać trzeba, Ŝe o ile protoplasty
uŜywane w pracach hodowlanych, czy w inŜynierii genetycznej lub biotechnologii, są
rzeczywistymi obiektami, w fizjologii i biochemii roślin stanowią one wprawdzie
unikalny, ale jednak tylko model, którego zadaniem jest ułatwienie poznania natury
procesów zachodzących w roślinach.
Protoplasty mogą z natury swojej stanowić dogodny model błony komórkowej.
Preparacja fragmentów błon z organów roślin jest trudna, gdyŜ mechaniczna
KULTURY in vitro JAKO MODEL W BADANIACH ...
99
dezintegracja ścian komórkowych, uszkadza delikatne struktury błon lipidowobiałkowych. W wyniku osmotycznego pękania protoplastów uzyskuje się znacznie
większe fragmenty błon, a nawet nie niszcząc tych komórek moŜna odrywać z nich
małe fragmenty plazmolemy (tzw. łatki) zawierające pojedyncze kanały jonowe lub
receptory. Stwarza to unikalną moŜliwość badania subtelnej struktury błony
komórkowej i jej składników, nawet oddzielnie na obydwu stronach plazmolemy, tj.
zewnętrznej i wewnętrznej.
Protoplasty zmieniają w pewnym zakresie swoje wymiary w zaleŜności od
potencjału wody w poŜywce. UmoŜliwia to zastosowanie tego modelu do badań nad
biosyntezą i degradacją plazmolemy, oraz określenie bezpośredniego wpływu składu
poŜywki na skład nowopowstałych fragmentów plazmolemy. W badaniach tych
przydatne mogą być teŜ zawiesiny komórkowe, które takŜe zapewniają jednolitość
warunków stwarzanych wszystkim komórkom zawiesiny, aczkolwiek obecność ściany
komórkowej stanowi znaczne utrudnienie. Pamiętać jednak naleŜy, Ŝe proces izolacji
protoplastów jest dla tych komórek silnym stresem. Dotyczy to zwłaszcza wstępnej
plazmolizy i zbyt długiego czasu trawienia. Poza fizycznymi skutkami usunięcia ściany
komórkowej, naleŜy zwrócić uwagę takŜe i na to, Ŝe enzymy trawiące składniki ściany
komórkowej wykazują teŜ niewielką aktywność proteazową. Mogą więc uszkodzić
białka plazmolemy. Przeciwdziała się temu dodając albuminę do mieszaniny
uwalniającej protoplasty, nie ma jednak pewności, czy albumina zabezpiecza w pełni
białka błonowe przed uszkodzeniem.
Warto równieŜ wspomnieć, Ŝe protoplasty powstają w wyniku strawienia ściany
komórkowej oraz przerwania plazmodesm łączących komórki. Są to więc obiekty inne
od komórek w tkankach, a do tego same poddane wcześniej działaniu stresu. Budzi to
wątpliwość, czy np. moŜna badać stres na obiektach poddanych wcześniej stresowi
izolacji. W zamian jednak protoplasty stanowią unikalny model komórek roślinnych o
ujednoliconych właściwościach, co uzyskuje się rozdzielając populację protoplastów w
gradiencie gęstości na frakcje moŜliwie zbliŜone do modelowanych komórek. I
wreszcie ostatnia ich zaleta - protoplasty traktowane jako oddzielne obiekty stanowią
zwykle wielomilionowe populacje, na których duŜo łatwiej, taniej i efektywniej moŜna
prowadzić ostrą selekcję komórek o poŜądanych właściwościach, w szczególności o
podwyŜszonej odporności na stresy.
Zasada koniecznej zgodności stopnia organizacji modelu
i procesu fizjologicznego do badania którego model ten został uŜyty
Zasada ta, sformułowana przez autorów, stwierdza, Ŝe określony proces moŜna
modelować jedynie przy pomocy modelu o poziomie organizacji nie niŜszym od tego,
jaki jest wymagany dla zajścia tego procesu w roślinie. Badacze często o tym
zapominają i, stosując nieadekwatny do sytuacji model, uzyskują wyniki nie poddające
się interpretacji, albo prowadzące do błędnych wniosków. W szczególności procesy
zachodzące głównie w komórkach mogą być modelowane przez obiekt o strukturze
komórkowej, np. protoplasty, zawiesiny komórkowe czy niezróŜnicowany kalus.
Natomiast te same obiekty stają się nieprzydatne jako model w badaniach procesów
zachodzących w całej roślinie (np. indukcja kwitnienia).
Przykłady udanego zastosowania kultur in vitro jako modelu
dla procesów fizjologicznych zachodzących w roślinach
100
F. Dubert, A. PłaŜek
Do procesów, które badane są standardowo przy wykorzystaniu kultur in vitro
naleŜą takie jak badanie w celach porównawczych rozwoju zarodka somatycznego i
gametycznego, zapłodnienie in vitro (które czasem umoŜliwia obejście barier
niekrzyŜowalności) oraz ograniczone tylko do wewnątrzkomórkowych aspektów
badanie odporności roślin na metale cięŜkie, herbicydy i inne stresy w kulturach
kalusowych, protoplastów i zawiesiny komórkowej.
Przykłady ograniczonej przydatności kultur in vitro jako modelu
dla procesów fizjologicznych
Do procesów, w badaniu których naleŜy ostroŜnie rozwaŜać zastosowanie kultur
in vitro naleŜy zaliczyć procesy o charakterze mieszanym komórkowo-systemicznym,
niezaleŜnie od tego czy w procesach tych dominują aspekty komórkowe czy
ponadkomórkowe. Charakterystycznym przykładem jest odpowiedź na stres, w której
współdziałają ze sobą procesy komórkowe i tkankowo/organowe. W tym przypadku
kultury in vitro umoŜliwiają badanie i ingerencję w badany proces jedynie na poziomie
komórkowych reakcji na stres (zmiana płynności i przepuszczalności membran,
aktywacja enzymów antyoksydacyjnych, indukcja szlaku fenolowego. Stwierdzenie
zmian wartości tych parametrów w związku z działającym stresem nie upowaŜnia
bowiem do uogólnień przenoszących związki pomiędzy wartościami tych parametrów a
odpornością na stres komórek takŜe na odporność całych roślin. Parametry takie mogą
jednak być swego rodzaju wstępnymi markerami ale wymagają weryfikacji odpowiedzi
całych roślin na stres [RAPACZ, DAWID 1999]. Te same uwagi dotyczą badań nad wymianą
sygnałów pomiędzy bakteriami brodawkowymi rodzaju Rhizobium lub Bradyrhizobium,
a komórką roślinną, jako wstępem do nawiązania symbiozy, która w dalszych etapach
jest procesem o charakterze systemicznym.
Przykłady procesów, których nie moŜna modelować
przy pomocy kultur in vitro
Do procesów tych naleŜy plonowanie, które jest procesem systemicznym
zachodzącym w całej roślinie, a w rozwaŜaniach agronomicznych staje się procesem
kolektywnym określanym przez związki i wzajemne oddziaływania wielu roślin w
łanie. Do tej grupy procesów moŜna teŜ zaliczyć zaawansowany etap symbiozy roślin
motylkowych z bakteriami Rhizobium, a więc wymianę metabolitów pomiędzy
brodawkami korzeniowymi a systemem korzeniowym rośliny, a takŜe obfitość
kwitnienia, plonowanie rośliny i łanu oraz procesy dojrzewania i starzenia organów
roślinnych i całych roślin.
Podsumowanie
Modele są nieodłącznym elementem pracy badawczej. Uświadomienie sobie
przez badaczy, Ŝe moŜliwe jest zastąpienie rzeczywistego obiektu przez jego uproszczony model, przyspieszyło z pewnością rozwój wielu eksperymentalnych dyscyplin
nauki.
W przypadku kultur in vitro zwykle nie ma wątpliwości, Ŝe pełnią one funkcję
KULTURY in vitro JAKO MODEL W BADANIACH ...
101
modelu. Natomiast często jest tak, Ŝe róŜnica pomiędzy rzeczywistym a modelowym
obiektem zaciera się powodując, Ŝe badacz interpretuje uzyskane wyniki jako
obiektywne, nie uświadamiając sobie, Ŝe na pewnym etapie eksperymentu zastosował
działanie modelujące.
Modelowanie jest więc cenną zdobyczą nauk eksperymentalnych pod warunkiem
jednak, Ŝe po wykonaniu eksperymentu określi się granice stosowalności uzyskanych
wyników. W przeciwnym razie nawet tak oczywiste stwierdzenie zamieszczone w
metodyce publikacji „Rośliny do badań zostały starannie wyselekcjonowane” moŜe
zostać zinterpretowane inaczej jako „Na odrzuconych roślinach uzyskuje się wyniki
zupełnie inne”.
Literatura
HAMMOND-KOSACK K.E., JONES J. 1996. Resistance gene-dependent plant defense
response. Plant Cell 8: 1773-1791.
KACPERSKA A. 2002. Reakcje roślin na abiotyczne czynniki stresowe, w: Fizjologia roś-
lin. Praca zbiorowa S. Lewak, J. Kopcewicz (Red.): 613-678.
MAUCH F., MAUCH-MANI B., BOLLER T. 1988. Antifungal hydrolases in pea tissue. II.
Inhibition of fungal growth by combinations of chitinase and β-1,3-glucanase. Plant
Physiol. 88: 936-942.
MAUCH-MANI B., MÉTRAUX J.P. 1998. Salicylic acid and systemic acquired resistance to
pathogen attack. Ann. Bot. 82: 535-540.
RAPACZ M., DAWID HURA K. 1999. An opportunity for Fast and reliable evaluation of
winter oilseed rape frost resistance using in vitro cultures. J. Agron. Crop Sci. 182:
193-198.
Słowa kluczowe:
kalus, protoplasty, stres, poziom subkomórkowy, komórkowy,
mieszany, systemiczny; reakcje odpornościowe; zawiesina
komórkowa
Streszczenie
Podjęto próbę określenia, które procesy fizjologiczne mogą być badane przy
uŜyciu kultur in vitro jako modelu. Zdefiniowano pojęcie „modelu” oraz określono jaki
jego cechy powodują, Ŝe eksperymentatorzy podejmują na nim swoje badania.
Przeprowadzono podział procesów ze względu na poziom struktury rośliny w której
przebiegają. WyróŜniono poziom subkomórkowy, komórkowy, mieszany (komórkowy i
systemiczny), systemiczny oraz poziom populacji lub łanu. Do poziomu
subkomórkowego zaliczono procesy przebiegające w organellach komórkowych (w
błonach cytoplazmatycznych, jądrze, plastydach) oraz w cytoplazmie. Do poziomu
głównie komórkowego zaliczono procesy inicjowane w ramach reakcji odpornościowej
pojedynczych komórek na mróz, suszę, jony metali cięŜkich, patogeny czy transport
jonów i wody pomiędzy komórkami. Do procesów o charakterze mieszanym,
komórkowym i systemicznym zaliczono reakcje na suszę, mróz i patogeny, a takŜe
nadwraŜliwość i apoptozę. Do procesów systemicznych zakwalifikowano termo- i
fotoindukcję kwitnienia, obfitość kwitnienia, plonowanie i architekturę rośliny,
strukturę plonu, spoczynek nasion oraz długość cyklu wegetacyjnego. Wreszcie jako
procesy o charakterze populacyjnym wymieniono produktywność łanu czy
F. Dubert, A. PłaŜek
102
współczynnik efektywności uŜytkowania wody (WUE).
Wymieniono główne „za” i „przeciw” stosowania kultur komórek i tkanek w
warunkach in vitro jako modeli roslin. Do procesów, które moŜna badać w tych
warunkach zaliczono porównanie rozwoju zarodka somatycznego i gametycznego,
zapłodnienie in vitro dla obejścia barier niekrzyŜowalności, badanie komórkowych
aspektów odporności roślin na metale cięŜkie, herbicydy i inne stresy oraz badanie
wpływu genomu na cechy fenotypowe organizmów haploidalnych lub podwojonych
haploidów. Wśród procesów, których nie moŜna badać in vitro wymieniono
plonowanie, symbiozę roślin motylkowych z bakteriami Rhizobium, transport metali
cięŜkich poprzez barierę na odcinku korzeń - łodyga, oraz dystrybucję asymilatów i
jonów przez granicę łodyga - owoc.
Sformułowano hipotezę o koniecznej zgodności stopnia organizacji danego
procesu fizjologicznego i zastosowanego do jego badania modelu.
In vitro CULTURE AS A MODEL IN THE STUDIES
OF PHYSIOLOGICAL PROCESSES IN PLANTS
1
Franciszek Dubert 1, 2, Agnieszka PłaŜek 1
Department of Plant Physiology, Polish Academy of Science, Kraków
2
Department of Plant Physiology, Agricultural University, Kraków
Key words:
callus, cell suspension, defence responses, protoplasts, stress, subcellular, cellular, mixed, systemic level
Summary
An effort was made to estimate, which of plant physiological processes might be
studied using in vitro culture as a model. The concept of „model” was defined and it
was described which of its properties are deciding what researchers choose that model
for their investigations. The classification of processes taking place in plants was done
depending on which plant structure level they take place. Subcellular, cellular, mixed
systemic and plant population level were distinguished. Processes taking place in cell
organella (cell membranes, nucleus, plastids) and in cytoplasm were included into the
subcellular level. Processes within defence response of individual cells to various
abiotic and biotic stresses (drought, frost, heavy metals, pathogens) as well as water and
ion transport between cells were included into the cellular level. Such processes as the
reactions to drought, frost, pathogens, and apoptosis and hypersensitive response were
defined as belonging to mixed (cellular and systemic) level. Thermo- and
photoinduction of flowering, abundance of florescence, yielding, plant architecture,
yield structure, seed dormancy and length of plant vegetative cycle were classified as
systemic processes. Finally, field crop productivity or water use efficiency (WUE) were
included among processes of population character.
The pros and cons related to in vitro culture used as a model were listed. The
comparison of development of somatic and gametic embryos, in vitro fertilization
allowing to avoid the natural crossing barrier, cellular responses to heavy metals,
herbicides and other stresses, influence of genom on phenotype of haploids and double
haploids may be studied in vitro conditions. Processes, which should not be investigated
in vitro include yielding, symbiosis between Rhizobium or Bradyrhizobium and
Papiliaceae plants, heavy metal transport across barrier in root-stem distance and
distribution of assimilates and ions between stem and fruits. Finally, the hypothesis
about the necessary agreement between organization of physiological processes and the
model used to their study was formulated.
KULTURY in vitro JAKO MODEL W BADANIACH ...
Prof. dr hab. Franciszek Dubert
Instytut Fizjologii Roślin im. F. Górskiego PAN
ul. Niezapominajek 21
30-239 KRAKÓW
e-mail: [email protected]
103
ZESZYTY PROBLEMOWE POSTĘPÓW NAUK ROLNICZYCH 2007 z. 523: 105-116
STAN BADAŃ NAD ZAPŁODNIENIEM in vitro
GATUNKÓW Z RODZAJU Prunus
Ewa Dziedzic, Włodzimierz Lech, Monika Małodobry
Katedra Sadownictwa i Pszczelnictwa, Akademia Rolnicza im. H. Kołłątaja w Krakowie
Wstęp
Wraz z pojawieniem się technologii in vitro otworzyły się nowe moŜliwości
badania procesów fizjologicznych, które w warunkach naturalnych zachodzą głęboko w
tkankach roślinnych. Jednym z takich procesów jest zapłodnienie zaląŜków, z których
powstają nasiona, dające szanse na rozwój następnego pokolenia. Zapłodnienie in vitro
moŜe być alternatywną metodą, mniej inwazyjną, w porównaniu do transformacji
tkanek roślinnych, umoŜliwiającą w ogólnym pojęciu uzyskiwanie nowych form roślin.
Znajduje zastosowanie przy eliminacji niezgodności gametofitycznej, umoŜliwia
wykonywanie krzyŜówek odległych form oraz skrócenie czasu otrzymywania wyników
prac hodowlanych, stwarza moŜliwość badań dotyczących kontroli zapłodnienia roślin
wyŜszych (mikrokultury zarodka i bielma), jak równieŜ moŜe być wykorzystane do
badań związanych z doborem zapylaczy dla odmian gatunków sadowniczych. W tym
ostatnim przypadku moŜe odegrać duŜą rolę dla gatunków z waŜnego gospodarczo
rodzaju Prunus, dla którego wprowadzane są aktualnie nowe technologie hodowli
[MARTINEZ-GÓMEZ i in. 2003].
Jednak przeprowadzenie zapylenia i zapłodnienia zaląŜków gatunków drzew
owocowych z rodzaju Prunus jest trudnym zadaniem, ze względu na krótki okres
kwitnienia roślin, co stwarza duŜe trudności w prawidłowym określeniu czasu
efektywnego zapylenia, warunku niezbędnego do przeprowadzenia zapylenia in vitro.
Wymagane są ponadto duŜe zdolności manualne przy izolacji zaląŜka i ziaren pyłku, jak
równieŜ znajomość składu i doboru poŜywek odpowiednich dla kiełkowania ziaren
pyłku. Potwierdzeniem powyŜej wymienionych trudności badań jest fakt, Ŝe częściej
podejmowane są badania na gatunkach krzewów owocowych, które posiadają wiele
zaląŜków w zaląŜni [GRAY i in. 1990] niŜ na gatunkach drzew pestkowych. DuŜo
trudności sprawiają równieŜ, kultury zapłodnionych zaląŜków i zarodków w
początkowych etapach swojego wzrostu, ze względu na heterotroficzny sposób
odŜywiania się tych ostatnich w bardzo wczesnych stadiach rozwoju. Mało danych
literaturowych potwierdza fakt udanej kultury wczesnych etapów rozwoju zarodka
[TRONCOSO i in. 2003], dlatego częściej prowadzi się hodowlę zarodków bardziej
zaawansowanych w rozwoju, które są juŜ zdolne do samodzielnego odŜywiania się.
Badania tego typu, które prowadzi się na znacznie szerszą skalę, mają szczególne
znaczenie w przypadku, gdy nowopowstałe zarodki są odrzucane przez tkanki
macierzyste z powodu istniejących niezgodności między nimi. Znajduje równieŜ
zastosowanie w przypadku otrzymywania roślin z nasion, których zarodki nie są zdolne
do kiełkowania, takŜe przy ominięciu barier post-zygotycznych oraz do uzyskiwania
roślin mieszańcowych, w przypadku braku rozwoju bielma. Technika ta, zwana
„embryo rescue”, umoŜliwia wyizolowanie zarodków, powstałych po zapyleniu
zaląŜków w warunkach naturalnych, oraz ich hodowlę na odpowiednich poŜywkach z
E. Dziedzic, W. Lech, M. Małodobry
106
wykorzystaniem kultur in vitro. Pełny sukces, w postaci prawidłowo rozwiniętych
roślin, osiąga się z zarodków izolowanych z tkanek matecznych 60 dni po kwitnieniu,
jednak dąŜy się do pobierania zarodków, w jak najkrótszym czasie po kwitnieniu.
W Katedrze Sadownictwa i Pszczelnictwa AR w Krakowie przez szereg lat
prowadzono doświadczenia na dwóch gatunkach z rodzaju Prunus, tj. śliwach
i czereśniach. Badania te polegały, z jednej strony na zapylaniu zaląŜków w warunkach
in vitro i podejmowaniu prób hodowli zapłodnionych zaląŜków, natomiast z drugiej na
hodowli w warunkach sztucznych zarodków, izolowanych z kwiatów zapylanych w
warunkach naturalnych, w bardzo wczesnych stadiach rozwojowych.
W prezentowanej publikacji przedstawiono część wyników wieloletnich prac, w
porównaniu do osiągnięć prezentowanych w literaturze światowej.
Materiał i metody
Zapylanie zaląŜków śliw i czereśni przeprowadzano na poŜywkach w warunkach
in vitro. Kwiaty przeznaczone do izolacji pyłku pobierano z sadu dwa dni przed
kwitnieniem i przechowywano w chłodni. Natomiast zaląŜki izolowano z zaląŜni
kwiatów w pełni kwitnienia. Sterylizację materiału roślinnego, tzn. zaląŜni i pylników
oraz zapylanie zaląŜków śliw i czereśni przeprowadzano według metodyki opracowanej
przez autorów i przedstawionej w kolejnych doniesieniach [LECH i in. 1993; DZIEDZIC i in.
1997, 1999]. Trzy dni po zapylaniu, z zaląŜków zdejmowano osłonki i wydobyte ośrodki
wraz z woreczkami zaląŜkowymi (dalej określonymi jako „ośrodki”) przenoszono na
poŜywki MURASHIGE i SKOOGA [1962] - MS z dodatkiem 3% sacharozy, zestalone 0,4%
agarem poŜywki P1, P2, P3 (tab. 1). W trakcie hodowli prowadzono obserwacje tkanek
na poŜywkach, a z części obiektów wykonano preparaty parafinowe.
Tabela 1; Table 1
PoŜywki stosowane w doświadczeniach dotyczących zapylania zaląŜków i kultury zarodków
Media used for pollination of ovules and culture of embryos
PoŜywka
MS
Medium MS
ZaląŜki
Ovules
Zarodki
Embryos
Symbol
Symbol
BAP
(mg⋅dm-3)
GA3
(mg⋅dm-3)
IAA
(mg⋅dm-3)
IBA
(mg⋅dm-3)
L-glutamina
L-glutamine
Sacharoza
Saccharose
P1
0,2
0,1
-
-
-
3%
P2
P3
0,2
-
-
-
-
-
3%
3%
P4
1,0
-
-
0,1
-
3%
P5
P6
P7
P8
P9
P10
1,0
1,0
0,5
1,0
0,5
0,1
0,1
0,5
0,1
0,2
0,1
0,1
1,0
-
-
-400
-
3%
3%
3%
3%
2%
3%
Stosunkowo łatwiejszym zadaniem jest hodowla zarodków zaawansowanych w
rozwoju tzn. takich, które są juŜ zdolne do samodzielnego odŜywiania się. Z zaląŜni
kwiatów zapylanych w sadzie pobierano zarodki i wykładano na poŜywki w celu
umoŜliwienia ich rozwoju. Zarodki pozostawały początkowo w zaląŜku (pod postacią
„niańki”), a potem izolowano zarodki z tkanek zaląŜka. Zarodki kilku odmian śliw,
pochodzące z kwiatów po swobodnym zapyleniu w sadzie, pobierano 34, 41, 46 oraz 52
STAN BADAŃ NAD ZAPŁODNIENIEM in vitro ...
107
dni po kwitnieniu umieszczając następnie na poŜywkach: P5, P6, P7, P8 (tab. 1).
Wykonywano równieŜ zapylanie odmian czereśni: Kordia × Hedelfińska, Van ×
Hedelfińska oraz Hedelfińska × Van w sadzie. Po upływie 60 dni, od czasu zapylania, z
nasion izolowano zarodki i wykładano na poŜywki P1, P2, P3 oraz P4. Po swobodnym
zapyleniu czereśni ptasiej w warunkach naturalnych pobrano zaląŜki w dwóch
terminach - 8 oraz 15 dni od kwitnienia. Z zaląŜków usunięto integumenty i tylko
ośrodki wyłoŜono na poŜywkę P10 (tab. 1).
Wyniki i dyskusja
Podstawowym warunkiem umoŜliwiającym przeprowadzenie zapylenia zaląŜków
na poŜywkach jest chemotropizm łagiewek pyłkowych. Z powodu braku tkanek szyjki
słupka, które w warunkach naturalnych biorą udział w kierowaniu wzrostem łagiewki,
udowodnienie występowania chemotropizmu łagiewek pyłkowych w pobliŜu zaląŜków
potwierdza moŜliwość skierowania łagiewek do mikropyle zaląŜków, a następnie do
woreczka zaląŜkowego. Występowanie chemotropizmu w przypadku śliw zostało
udowodnione i potwierdzone obliczeniami statystycznymi, które zamieszczono w
publikacjach [DZIEDZIC i in. 1997, 1999; DZIEDZIC 2004].
W trakcie kultury ośrodków na poŜywkach obserwowano zmiany w ich
wyglądzie, część ośrodków nie podejmowała rozwoju, tkanki ciemniały i zamierały
stopniowo, część powiększała się nadmiernie wykazując przerosty tkanek, tzw.
hiperplazję, czemu towarzyszyło kurczenie się woreczka zaląŜkowego, obserwowane na
przekrojach parafinowych tych tkanek. Jednocześnie w nielicznych przypadkach,
obserwacje woreczka zaląŜkowego wskazały, na obecność pojedynczych wolnych jąder
bielmowych od mikropyle do końca chalazalnego, co moŜe świadczyć o zapłodnieniu,
jak sugerują to badania RUBIO-CABETAS, SOCIAS [1996].
Natomiast nadmierny rozwój tkanki, od strony mikropyle, powodował powstawanie, tzw. kalotki, warstwy bardzo mocno zbitych komórek o grubych ścianach,
która uniemoŜliwiała prawidłowe pobieranie składników odŜywczych z poŜywki i w
efekcie zamieranie nowopowstałych struktur [DZIEDZIC i in. 2001]. Pozytywne symptomy
rozwoju zaląŜków obserwowano w przypadku zaląŜków czereśni odmiany Hedelfińska,
zapylanych pyłkiem tej samej odmiany. Po dziewiętnastu dniach od zapylania zaląŜków
(szesnastu od usunięcia osłonek zaląŜków) i przeniesienia ośrodków na poŜywkę P1 w
jednym spośród 45 sztuk hodowanych ośrodków zaobserwowano zamiany w wyglądzie
i rozwoju. Stwierdzono pojawienie się zawiązka korzonka oraz liścieni w kolorze
mlecznobiałym. Zygotyczny zarodek wykazywał strukturę polarną, wyraźnie
oddzielającą się od pozostałej części ośrodka. W czasie dalszej hodowli na poŜywce nie
nastąpiło jednak otwarcie się liścieni i uwolnienie stoŜka wzrostu pędu. Z kalusa,
którym pokryły się liścienie, wyrosła jasnozielona, delikatna struktura podobna do
pędu, zakończona słabo wykształconym liściem. Struktura ta nie wykazywała oznak
rozwoju, nie obserwowano równieŜ zmian nekrotycznych hodowanych tkanek.
Drugim kierunkiem badań były kultury in vitro zapłodnionych zaląŜków oraz
zarodków (pobieranych we wczesnych etapach rozwoju).
W przypadku śliw, po swobodnym zapyleniu kwiatów w sadzie, oraz czereśni po
krzyŜowym zapyleniu kwiatów zarodki izolowano w róŜnym czasie od kwitnienia i
prowadzono ich kulturę na poŜywkach (tab. 2). Jest to zgodne ze spostrzeŜeniami HU i
ZANETTINI [1995], według których, wiek izolowanych zarodków decyduje o sukcesie
kultury i naleŜy kaŜdorazowo doświadczalnie takie zaleŜności określić. JuŜ po kilku
dniach od wyłoŜenia na poŜywki zarodków, na nielicznych kulturach obserwowano
zazielenienie i otworzenie się liścieni, dzięki czemu uwalniał się merystem wierz-
E. Dziedzic, W. Lech, M. Małodobry
108
chołkowy pędu. Równocześnie zaobserwowano wzrost i wydłuŜanie się korzonka
zarodkowego. Stosowane poŜywki róŜniły się rodzajem i zawartością substancji
wzrostowych. Prawidłowością był fakt, Ŝe im młodsze zarodki były wykładane na
poŜywki tym więcej czasu potrzebowały, aby rozwinąć się w prawidłowo ukształtowane rośliny (tab. 2). Z ogólnej liczby 54 zarodków przeniesionych na trzy poŜywki
najwięcej zarodków (12) podjęło wzrost w kombinacji Kordia × Hedelfińska na
poŜywce P4 i po 14 dniach z tych zarodków rozwinęły się rośliny. Natomiast młode
zarodki śliwy odmiany Węgierka Zwykła izolowane 34 dni po kwitnieniu wymagały
znacznie dłuŜszego czasu - 42 dni, aby rozwinęły się rośliny.
Tabela 2; Table 2
Liczba dni potrzebnych do rozwoju zarodków śliwy i czereśni w rośliny,
po wyłoŜeniu na poŜywkę, w zaleŜności od liczby dni po kwitnieniu
(pobieranie zarodków śliw i czereśni)
Number of days needed for plum and cherry embryo development,
after placing them on the media, depending on a number of days after flowering
Gatunek/ Odmiana
Species/cultivar
Czereśnia; Cherry
Kordia × Hedelfińska
Śliwa; Plum
Vrogue Toulse
Śliwa; Plum
Węgierka Zwykła
Śliwa; Plum
Čačak Najbolia
Śliwa; Plum
Węgierka Zwykła
Liczba dni po kwitnieniu, w
których pobrano zarodki
Days after flowering on the
embryos when were isolated
PoŜywka dla
kultury
Medium
Liczba dni potrzebnych do
rozwoju zarodków w rośliny
po wyłoŜeniu na poŜywkę
Number of days needed for full
development of embryos
60 dni; 60 days
P3, P1, P4
14 dni; 14 days
52 dni; 52 days
P9
15 dni;15 days
46 dni; 46 days
P8
29 dni; 29 days
41 dni; 41 days
P7
33 dni; 33 days
34 dni; 34 days
P6
42 dni; 42 days
W kolejnych etapach badań skracano czas po kwitnieniu, w którym pobierano
zapłodnione zaląŜki. I tak dla czereśni ptasiej zapłodnione zaląŜki pobrano 8 oraz 15 dni
po kwitnieniu, po czym na poŜywki wyłoŜono jedynie ośrodki z woreczkami. W chwili
wykładania ośrodków na poŜywkę wyróŜniono trzy klasy wielkości. W tabeli 3
przedstawiono wyniki, jakie uzyskano po 30 dniach kultury ośrodków na poŜywce.
Ośrodki pobierane 8 dni po kwitnieniu rozróŜniono wg trzech grup długości:
średnia długość 2,1; 2,9 oraz 3,3 mm. Ośrodki izolowane z zaląŜków pobieranych w
pierwszym terminie odznaczały się jedynie większą długością, ale nie stwierdzono w
nich zróŜnicowania tkanek. Natomiast ośrodki pobieranie w terminie drugim (o średniej
długości 4,3 i 4,5 mm) znacznie powiększyły swoją wielkość i odznaczały się
zaawansowaniem w rozwoju. MoŜna było w nich wyróŜnić rozwijające się zarodki, o
prawidłowej strukturze. Liścienie - początkowo o mlecznobiałej barwie - wykazywały
rozwój, pojawiały się zielonawe struktury przypominające liście, jednak z oznakami
zaburzenia fizjologicznego, jakim jest szklistość tkanek. W kolejnych dniach początkowe szybkie tempo rozwoju stopniowo słabło i miesiąc później nie zanotowano
spodziewanych kolejnych etapów rozwoju zarodków.
Tabela 3; Table 3
Procent oraz długość ośrodków czereśni ptasiej
(pobranych 8 oraz 15 dni po kwitnieniu)
wykazujących rozwój po 30 dniach kultury na poŜywce
STAN BADAŃ NAD ZAPŁODNIENIEM in vitro ...
109
Per cent and length of Prunus avium nuceluses showing the development
after 30 days of culture (ovules isolated 8 and 15 days after flowering)
Wykładanie na poŜywkę
Placing the nucelluses on the media
liczba ośrodków
number of nuceluses
średnia długość
ośrodków
mean length
of nuceluses
(mm)
Ocena po 30 dniach kultury ośrodków na poŜywce
Estimation of nuceluses after 30 days of culture
procent ośrodków
wykazujących rozwój
percent of nuceluses
showing development
średnia długość
ośrodków
mean length
of nuceluses
(mm)
8 dni po kwitnieniu; 8 days after flowering
28
2,1
0
0
27
2,9
18,5
4,5
22
3,3
22,7
4,5
15 dni po kwitnieniu; 15 days after flowering
4
4,3
20,0
5,2
10
4,5
45,0
7,6
Porównując powyŜsze wyniki, jakie uzyskano po izolacji zapłodnionych zaląŜków w stosunkowo krótkim czasie po kwitnieniu wydaje się, Ŝe naleŜy je traktować
jako pierwsze osiągnięcie na drodze pokonywania trudności w kulturach wczesnych
etapów rozwoju zapłodnionych zaląŜków i zarodków drzew owocowych.
Potwierdzeniem powyŜszego stwierdzenia niech będzie porównanie dotychczasowych
badań w tej dziedzinie prowadzonych na świecie w ciągu ostatnich kilkudziesięciu lat
(tab. 4).
W tabeli 3 przedstawiono osiągnięcia uzyskane przez wielu autorów dotyczące
prowadzenia badań nad niedojrzałymi zarodkami izolowanymi z zaląŜni od 28 do 60
dni po kwitnieniu.
Zarodki regenerują w wysokim procencie, a następnie przekształcają się
w prawidłowo uformowane rośliny, kiedy są pobierane z nasion z niedojrzałych
owoców. Takie doświadczenia prowadzone były na brzoskwiniach [PINTO i in. 1993,
1994; RIZZO i in. 1998; SCOZZOLI, PASINI 1992; SRIVASTAV i in. 2004], czereśniach
[KUKHARCHYK, KASTRICKAYA 2006].
110
E. Dziedzic, W. Lech, M. Małodobry
Izolowane w tym terminie zarodki kiełkowały na poŜywkach w trakcie kultury
w wysokim procencie (73%) dając prawidłowo zregenerowane rośliny. Szansą rozwoju
zarodków powstałych po wykonaniu krzyŜowań oddalonych oraz w obrębie pokolenia
F2 mieszańców międzygatunkowych jest izolacja z tkanek macierzystych i hodowla na
poŜywkach. Metoda ta stanowi uproszczenie tradycyjnych metod hodowli dzięki
mniejszym wymaganiom dotyczącym miejsca i czasu kultury. Na stosunkowo
niewielkiej przestrzeni moŜna hodować wiele zarodków, które dają szansę otrzymania
obiecujących mieszańców. I tak na przykład spośród 25 000 hodowanych zarodków
czereśni ponad 500 adoptowano do warunków ex vitro i wysadzono do sadu
[KUKHARCHYK, KASTRICKAYA 2006].
Metoda izolacji zarodków, po krzyŜowym zapyleniu, stosowanym w badaniach
hodowlanych stwarza moŜliwość znacznie szybszej oceny otrzymanych siewek, tak jak
w przypadku siewek brzoskwini, gdy juŜ w sześć miesięcy po wykiełkowaniu zarodków
moŜna było dokonać oceny siewek [ARBELOA i in. 2003].
WaŜny jest termin pobierania niedojrzałych zarodków z nasion, powinien mieć
miejsce natychmiast po zbiorze owoców. Przetrzymywanie owoców, nawet
trzytygodniowe, jak w przypadku brzoskwini znacznie obniŜyło procent uzyskanych z
zarodków roślin i ich Ŝywotność [ANDERSON i in. 2006].
Najkorzystniejszym cukrem, spośród kilku przebadanych w poŜywkach, dla
rozwoju młodych zarodków brzoskwini okazały się sacharoza i glukoza, które
umoŜliwiły otrzymanie silnych roślin, przydatnych do uprawy w szklarni [SCOZZOLI,
PASINI 1992]. W niektórych przypadkach korzystna jest dwu etapowa kultura, najpierw
indukowanie wzrostu zarodka wewnątrz zaląŜka, a następnie przenoszenie na nową
poŜywkę. Taka procedura została zastosowana dla wczesnych odmian brzoskwini,
umoŜliwiając uzyskanie z zarodków izolowanych 46 dni po kwitnieniu, nawet 50%
zregenerowanych roślin [ENJI i in. 1992].
Bardzo waŜnym zagadnieniem, w trakcie kultury zarodków w zaląŜku, jest
prawidłowe odŜywienie rozwijających się zarodków. W tym przypadku tkanki zaląŜka
ograniczają kontakt zarodka z poŜywką, co skutkuje brakiem dopływu substancji
odŜywczych oraz brakiem lub nieprawidłowym rozwojem młodych struktur. Dlatego
polecana jest metoda perforacji zaląŜków, które następnie są zagłębiane mikropylarnym
końcem w poŜywkę. Opracowana i zastosowana dla zarodków brzoskwini metoda
umoŜliwiła 2-4-krotnie większy ich wzrost [PINTO i in. 1993, 1994], ponadto dodatek
aminokwasu L-glutaminy równieŜ wpłynął korzystnie na wzrost i rozwój zaląŜków.
Wnioski
1.
Po zapylaniu w warunkach in vitro zaląŜków czereśni odm. Hedelfińska pyłkiem
tej samej odmiany uzyskano rozwój zarodków do stadium liścieni.
2.
Zarodki izolowane z niedojrzałych nasion śliw oraz czereśni (od 34 do 60 dni po
kwitnieniu) po wyłoŜeniu na poŜywki wykazały prawidłowy rozwój w rośliny.
3.
Powodzenie w warunkach in vitro kultury zarodków pobieranych we wczesnych
etapach rozwoju w większym stopniu zaleŜy od stopnia zaawansowania w
rozwoju niŜ składu zastosowanej poŜywki.
Literatura
ANDERSON N., BYRNE D.H., RAMMING D.W. 2006. In ovule culture success as affected by
sugar source and fruit storage duration in nectarine. Acta Hort. 713: 89-92.
STAN BADAŃ NAD ZAPŁODNIENIEM in vitro ...
111
ARBELOA A., DAORDEN M.E., GARCIA E., MARIN J.A. 2003. Successful establishment of in
vitro culture of Prunus cerasifera hybrids by embryo culture of immature fruits. Acta
Hort. 616: 375-378.
BROOKS H.J., HOUGH L.F. 1958. Vernalization studies with peach embryos. Proc. Am.
Soc. Hortic. Sci. 71: 95-102.
CHEÉ R., POOL R.M. 1987. Improved inorganic media constituents for in vitro shoot
multiplication of Vitis. Scientia Horticulturae 32: 85-95.
DZIEDZIC E. 2004. Applying of in vitro method at the plum flowering studies. Scientific
Works of the Lithuanian Institute of Horticulture and Lithuanian University of
Agriculture 23(2): 92-104.
DZIEDZIC E., LECH W., MAŁODOBRY M., JANKUN A. 1997. Studies on fertilization of plum in
vitro. Acta Hort. 478: 113-118.
DZIEDZIC E., LECH W., MAŁODOBRY M., JANKUN A. 1999. Badania zapłodnienia śliw
w warunkach in vitro. Bibliotheca Fragmenta Agronomia 6: 75-80.
DZIEDZIC E., LECH W., MAŁODOBRY M. 2001. Wczesne stadia embriogenezy po zapyleniu
śliw w warunkach in vitro. Biotechnologia 2(53): 54-61.
DRUART PH., GRUSELLE R. 1986. Plum (Prunus domestica), w: Biotechnology in Agriculture and Forestry. Bajaj Y.P.S. (Ed.) Vol. 1 Trees I. Springer Vg. Berlin: 131-154.
ENJI Z., QIANG Y., YULANG W., DECHUN W. 1992. Studies on in-ovule embryo culture
technique of early-maturing and very early maturing peach. Acta Hort. 300: 325-330.
GERCHEVA P., ZHIVONDOV A. 2002. Embryo rescue of early ripening plum cultivars. Acta
Hort. 577: 165-168.
GRAY D.J., MORTENSTEN J.A., BENTON C.M., DURHAM R.E., MOORE G.A. 1990. Ovule culture to obtain progeny from hybrid seedless bunch rapes. J. Amer. Soc. Hort. Sci. 15(6):
1019-1024.
HU C.Y., ZANETTINI M.H.B. 1995. Embryo culture and embryo rescue for wide cross
hybrids, w: Plant Cell Tissue and Organ Culture. Gamborg O.L., Philips G.C. (Red),
Springer: 129-141.
IVANIČKA J., PRETOVA A. 1986. Cherry (Prunus avium L.), w: Biotechnology in Agriculture and Forestry, Bajaj Y.P.S. (Ed.), Vol. 1 Trees I. Springer Vg. Berlin: 154-169.
KUKHARCHYK N., KASTRICKAYA M. 2006. Embryo rescue techniques in Prunus L. breeding. Journal of Fruit and Ornamental Plant Research 14 suppl 1: 129-135.
KÜDEN A.B., BÜYÜKALACA S., TANRIVER E., GÜLEN H. 1996. Embryo rescue of peach breds.
Eucarpia Symposium, Horticulturae Research International, East Malling: 125.
LECH W., MAŁODOBRY M., LECH M., NOWAK B. 1993. In vitro fertilization of plum. Acta
Hort. 359: 269-276.
LLOYD G., MCCOWN B. 1980. Commerially-feasible micropropagation of mountain laurel
Kalmia latifolia, by use of shoot-tip culture. Proc. Int. Plant. Prop. Soc. 30: 421-427.
MARTINEZ-GÓMEZ P, SOZZI G.O., SÁNCHEZ-PÉREZ R., RUBIO M., GRADZIEL T.M. 2003. New
approaches to Prunus tree crop breeding. Food, Agriculture & Environmental 1(1):
52-63.
MONNIER M. 1976. Culture in vitro de l’embryon immature de Capsella bursa-pastoris.
Moench. Rev.Cytol. Biol. Vég. 39: 1-120.
MURASHIGE T., SKOOG F. 1962. A revised medium for rapid growth and bioassays with
tobacco tissue cultures. Physiol. Plant. 15: 473-497.
PINTO A.C., BYRNE D.H., ROGERS S.M.D. 1993. Influence of ovule perforation, plant
112
E. Dziedzic, W. Lech, M. Małodobry
growth regulators and L-glutamine on in vitro growth of immature peach embryos. In
Vitro Cell Dev. Biol. 29: 55-58.
PINTO A.C., ROGERS S.M.D., BYRNE D.H. 1994. Growth of immature peach embryos in
response to media, ovule support method and ovule perforation. HortScience 29(9):
1081-1083.
RIZZO M., BASSI D., BYRNE D., PORTER K. 1998. Growth of immature peach [Prunus
persica (L.) Batsch.] embryos on different media Acta Hort. 465: 141-147.
RUBIO-CABETAS M.J., SOCIAS R. 1996. Fertilization assessment and postzygotic development in several ontra- and interspecific Prunus hybrids. Euphytica 90: 325-330.
SCHMIDT H., KETZEL A. 1993. Regeneration of adventitious shoots in vitro cherries IV.
Adventitious shoot regeneration of cotyledons and embryo rescue as tools in cherry
breeding. Gartenbauwissenschaft 58(2): 64-67.
SCOZZOLI A., PASINI D. 1992. Effects of different media constituents on the development of
peach embryos cultured in vitro. Acta Hort 300: 265-268.
SRIVASTAV M., SINGH S.K., ARORA R.L., KRISZNA B. 2004. Embryo culture studies in subtropical peach (Prunus persica Batsch.). Acta Hort 662: 297 -301.
STEWART J.M., HSU C.L. 1977. In ovule embryo culture and seedling development of
cotton (Gossypium hirsutum L). Planta 137: 113-117.
TRONCOSO A., CANTOS M., LINAN J., TRONCOSO J., RAPOPORT F. 2003. In vitro development
and germination of immature olive embryos. J. Hort. Sci. and Biotech. 78(5): 728-733.
WHITE P.R. 1943. A handbook of plant tissue. Cattel. Lancaster.
Słowa kluczowe:
zapłodnienie in vitro, Prunus, kultury zaląŜków, zarodek
Streszczenie
Stosowane metody biotechnologiczne, polegające na transformacji tkanek
roślinnych wzbudzają często liczne kontrowersje, dlatego poszukuje się obecnie
alternatywnych, mniej inwazyjnych, sposobów prowadzenia badań z roślinami. Jedną z
waŜnych metod, która stwarza potencjalnie duŜe moŜliwości naukowych zastosowań,
jest zapłodnienie in vitro. Badania dotyczące tego zagadnienia są prowadzone głównie
na roślinach takich jak tytoń, czy kukurydza. Natomiast niewiele jest doniesień
dotyczących doświadczeń wykonywanych na roślinach drzewiastych. W omawianej
prezentacji podjęto próbę przedstawienia obecnego stanu wiedzy na temat zapłodnienia
in vitro gatunków z rodzaju Prunus. Badania dotyczące poznania tego zagadnienia
prowadzone są dwutorowo. Z jednej strony opracowywane są metody doprowadzające
do zapłodnienia zaląŜków na poŜywkach, na których umieszczane są zarówno zaląŜki
jak i ziarna pyłku, a takŜe podejmowane są próby uzyskania pierwszych podziałów
zygoty i prazarodka. Z drugiej strony pobierane są niedojrzałe zarodki powstające po
zapyleniu i zapłodnieniu w warunkach naturalnych, które są następnie prowadzone w
kulturach sterylnych w celu uzyskania z nich prawidłowo rozwiniętych roślin. Zarodki
pobierane są w róŜnych etapach rozwoju, od kilku do 60 dni po kwitnieniu.
Przedstawiono dotychczasowe osiągnięcia w badaniach, z uwzględnieniem stosowanych poŜywek, warunków kultury i etapów rozwoju, jaki osiągnięto dla poszczególnych gatunków z rodzaju Prunus.
STAN BADAŃ NAD ZAPŁODNIENIEM in vitro ...
113
CURRENT INVESTIGATIONS ON FERTILIZATION
in vitro OF Prunus SPECIES
Ewa Dziedzic, Włodzimierz Lech, Monika Małodobry
Department of Pomology and Apiculture, Agricultural University, Kraków
Key words:
in vitro fertilization, Prunus, ovule culture, embryo
Summary
Biotechnology methods relying on transformation works cause much controversy,
therefore presently less invasive methods concerning the studies on plants are
investigated. One of the important method which make possible the practical
applications is the fertilization in vitro. There are a few reports presenting the
investigations performed on the fruit trees. In this paper the current achievement
concerning fertilization in vitro of Prunus species is presented. The studies covering
that problem are conducted in two ways. On one hand, the methods of ovule fertilization
on the media and obtaining the first zygote and proembryo divisions are elaborated. On
the other hand the immature embryos are isolated after pollination of flowers in natural
conditions and cultivated on the artificial media up to the stage of correctly developed
plants. The embryos are taken at different times after flowering, from several days up to
60 days. The current status of the investigation regarding the of media used, culture conditions and stage of embryo development achieved for Prunus species are presented.
Dr inŜ. Ewa Dziedzic
Katedra Sadownictwa i Pszczelnictwa
Akademia Rolnicza im. H. Kołłątaja
Al. 29 Listopada 54
31-425 KRAKÓW
e-mail: [email protected]
25°C - 40 dni ciemność, perforacja zaląŜków; 25°C hodays, darkness, perforation of
ovules
MURASHIGE, SKOOG [1962]
MONIER [1976] MURASHIGE, SKOOG
[1962] STEWART, HSU [1977] 6-10%
sacharozy; 6-10% saccharose
poŜywka; medium
MCCOWN, LLOYDS [1981]
3% sacharoza; 3% saccharose
poŜywka; medium
STEWART, HSU [1977], 0,03 mg⋅dm-3
GA3,
róŜne cukry; various sugars
60 dni; 60 days
50, 60, 70 dni po zapyleniu,
niedojrzałe zarodki 4,0-8,7 mm;
50, 60, 70 days after pollination,
immature embryos 4.0-8.7 mm
60 dni niedojrzałe zarodki
8,6-14,3 mm; 60 days, immature
embryos 8.6-14.3 mm
60 dni zarodki 0-15 mm z nasion; 60 days, embryo, 0-15 mm
from seeds
Śliwa; Plum
Burmosa
Brzoskwinia
Peach
Springcrest
Earligrande
Brzoskwinia
(nektaryna)
Peach
Brzoskwinia
Peach
cd. tabeli 4; cont. Table 4
chłodzenie 4°C, kultura 16/8
godz. 24°C; cooling 4°C, culture
16/8 h 24°C
poŜywka; medium
BROOKS, HOUGH [1958]
60 dni; 60 days
Śliwa; Plum
Ruth
Gerstetter
stratyfikacja 2°C - 2 mies.,
kultura 20-25°C, 16/8 godz.;
stratification 2°C for 2 months,
culture 20-25°C, 16/18 h
stratyfikacja -4,4°C przez 60
dni, potem kultura 25°C, 12/12
godz.; stratification -4.4°C for
60 days, then culture 25°C,
12/12 h
chłodzenie 2°C - 3-5 mies,
kiełkowanie zarodków, ciemność 16°C, wysadzanie do
szklarni; cooling 2°C - 3-5
months, embryo germination,
darkness 16°C, planting in the
greenhouse
PoŜywka
Medium
Izolacja zarodków
(dni po kwitnieniu)
Embryo isolation
(days after flowering)
Gatunek/
odmiana
Species/
cultivar
Warunki kultury
Culture conditions
DRUART,
GRUSELLE
[1986]
GERCHEVA,
ZHIVONDOV
[2002]
PINTO i in.
[1993, 1994]
RIZZO i in.
[1998]
SCOZZOLI,
PASSINI [1992]
prawidłowy rozwój
roślin proper development of plants
kiełkowanie zarodków
100%; germination of
embryos -100%
kilkakrotnie lepszy rozwój zarodków perforowanych; several
times better development of perforated
embryos
prawidłowy rozwój
roślin; proper development of plants
prawidłowo rozwinięte
rośliny; properly development plants
Autorzy (rok)
Authors (year)
Tabela 4; Table 4
Osiągnięcie Achievement
Kultury zarodków kilku gatunków z rodzaju Prunus izolowanych w róŜnych terminach po kwitnieniu
Culture of some Prunus species embryo isolated at different times after flowering
MURASHIGE, SKOOG [1962]
2% sacharoza; 2% saccharose,
0,5 mg⋅dm-3 GA3
30-40 dni; 30-40 days
Czereśnia
Cherry
Karesova
Czereśnia
Cherry
30-40 dni; 30-40 days
MURASHIGE, SKOOG [1962]
bez substancji wzrostowych aŜ do
chwili gdy liścienie białe, potem
stratyfikacja 40 dni - 2°C
stratification 40 days - 2°C
STEWART, HSU [1977],
4% sacharoza; 4% saccharose,
1,0 mg⋅dm-3 BA,
1,0 mg⋅dm-3 IBA
46 dni; 46 days
Brzoskwinia
Peach
cd. tabeli 4; cont. Table 4
zarodki w zaląŜku, potem kultury niedojrzałych
zarodków;
embryos in the ovule, then
cultures of immature embryos
MCCOWN, LLOYDS [1981],
MURASHIGE, SKOOG [1962],
2-3% sacharoza; 2-3% saccharose,
0,5-5,0 mg⋅dm-3 GA3,
0,3-0,9 mg⋅dm-3 BA,
0,1-4,0 mg⋅dm-3 IBA,
0,01-0,02 mg⋅dm-3 kwas ferulowy;
ferulic acid
60 dni; 60 days
Czereśnia
miedzy
gatunkowe
mieszańce
z rodz Prunus
Cherry hybrids
from Prumus
family
ARBELOA i in.
[2003]
warunki kultury, 24°C, 16/8
godz.; conditions of the culture,
24°C, 16/8 h
zregenerowane pędy z
15-21% zarodków; regenerated shoots from
kiełkowanie zarodków
80%; germination of
embryos 80%
SCHMIDT,
KETZEL [1993]
IVANIČKA,
PRETOVA
[1986]
zregenerowanie roślin z ENJI i in. [1992]
75% zarodków; regeneration of plants out
of 75% embryos
KUKHARCHYK,
zregenerowanych
stratyfikacja 60-65 dni, 3-5°C,
potem 24°C; stratification 60-65 prawidłowo 500 roślin z KASTRICKAYA
[2006]
25 000 zarodków;
days, 3-5°C
properly regenerated
then - 24°C
500 plants, out of 25000
embryos
kiełkowanie zarodków
stratyfikacja 4°C, kultura 16/8
godz. - 24°C; stratification 4°C, 73%, uzyskano prawidłowo rozwinięte rośliny;
culture 16/8 h - 24°C
germination of embryos
73%, properly
developed plants obtained
poŜywka; medium
CHEÉ, POOL [1987]
63 dni; 63 days
ciemność do stabilizacji, kultura kiełkowanie zarodków; SRIVASTOV i in.
germination of embryos
12/12 godz.; darkness for
[2004]
stabilization,
culture 12/24 h
Prunus
cerasifera ×
armeniaca
MURASHIGE, SKOOG [1962],
sacharoza 4%; 4% saccharose,
2,0 mg⋅dm-3 BA,
0,5 mg⋅dm-3 IAA,
L-glutamina 200 mg⋅dm-3;
L-glutamine 200 mg⋅dm-3, hydrolizat
kazeiny 200 mg⋅dm-3; casein hydrolysate 200 mg⋅dm-3
60 dni; 60 days
Brzoskwinia
Peach
30 dni; 20 days
28 dni; 28 days
Brzoskwinia
Peach
Springtime ×
Flavorcrest
Czereśnia
wczesne
odmiany
Cherry early
cultivars
kiełkowanie zarodków;
germination of embryos
15-21% embryos
WHITE [1949],
dziesięciokrotne powarunki kultury, 8-10°C
MURASHIGE, SKOOG [1962]
conditions of the culture, 8-10°C większenie zarodków w
stadium sercowatym;
hydrolizat kazeiny, ekstrakt
ten fold enlargement of
droŜdŜowy; casein hydrolysate, yeasts
-3
embryos at the heart
extract, 2,0 mg⋅dm GA3
stage
0,1 mg⋅dm-3 kinetyna; kinetin
MURASHIGE, SKOOG [1962]
1,0 mg⋅dm-3 NAA,
2,0 mg⋅dm-3 IBA
dodatek 2,0 mg⋅dm-3 BA,
1,0 mg⋅dm-3 IAA; without growth
substances until the time of white
cotyledon 2.0 mg⋅dm-3 BA, then the
addition of 1.0 mg⋅dm-3 IAA
IVANIČKA,
PRETOVA
[1986]
KÜDEN i in.
[1996]
ZESZYTY PROBLEMOWE POSTĘPÓW NAUK ROLNICZYCH 2006 z. 523: 117-126
IMPACT OF AUXIN ANALOGUES ON in vitro
XYLEM FORMATION
IN SWEET COMMON PRUNE CALLUS TISSUE
Ewa Hanus-Fajerska
Botany Department, Faculty of Horticulture, Agricultural University, Kraków
Introduction
A plant body is composed of several types of specialized cells which have a
constitutional developmental program. However, plant cells possess a unique
transdifferentiation mechanism by which they can initiate a new program of
differentiation [RAVEN et al. 1999; DEMURA et al. 2002]. The culture medium and
appropriate external milieu together with the suitable cell or tissue type, became the
guarantor of possible perpetual cultivation of cells and tissues in vitro. Even mature
somatic cells may be induced to dediferentiate, go through a series of mitoses and
eventually redifferentiate to form organs or somatic embryos de novo. They may also be
maintained in the least differentiated of all the mature cell types of the plant, that is in
the form of callus. The two classes of plant growth regulators - auxins and cytokinins
are mostly required in culture media, as considered to be among the highest
importantance factors used for regulating the growth and development in the tissue
culture. In genus Prunus, like in many others, the manipulation of plant growth
regulator level and balance is a suitable strategy for either studying pattern of cell
division and development or cell competence for regeneration [BHANSALI et al. 1991;
ESCALETTES, DOSBA 1993].
Sweet Common Prune is a Prunus domestica cultivar of very significant economic importance, especially in Europe. Previous reports have desribed results of
experiments performed in our laboratory to improve the cultivation protocols of stock
and callus cultures, where appropriate procedures have been worked out [NOWAK,
MICZYŃSKI 1996, 2002; HANUS-FAJERSKA, NOWAK 2001]. We also tried to asses the influence
of exogenous application of chosen auxin or its analogues and cytokinin or its analogues
on cultures derived from the same mother plant [NOWAK 1999; HANUS-FAJERSKA 2006].
The conclusion was reached, that the experiment is worth to be repeated once more with
two media types, that is for friable callus tissue (FT), and nodular tissue (NT) used as
the growth control. The objective was a verification of the assumption if working with a
broadened system of this kind, a certain shift in differentiation pattern in prune tissues
cultured on a medium containing single auxin or combinated auxins treatment could be
confirmed. The approached problem deals with the role of auxins in the initiation of
tracheary element formation in cultured callus tissues [ALONI 1980], up till now not
documented for temperate fruit trees. It seems to be interesting, as the process of xylem
differentiation is not yet fully understood [KUBO et al. 2005]. The clarification of the
subsequent xylogenesis stages is important to the understanding of genetic control of
wood formation in trees [CHAFFEY et al. 2002; DEMURA et al. 2002].
E. Hanus-Fajerska
118
Materials and methods
The clone used was derived from Prunus domestica Węgierka Zwykła cv. two
years old and virus free mother plant. Shoot culture was performed for about seven
months on Murashige-Skoog medium supplemented with 0.1 mg⋅dm-3 IBA and 0.25
mg⋅dm-3 BA and solidified with 0,8% w/v Difco Agar. The medium pH was adjusted to
5.6. The designed experimental system focused on inducing callus tissue from leaf
explants, and further maintaning of proliferative tissue lines in order to carry out
morphological and histological observations of such cell populations against time. The
callus induction medium was MS modified according to NOWAK and MICZYŃSKI [1996],
adjusted to pH 5.5 before autoclaving, and supplemented with different plant growth
regulators (PGR) as indicated in Table 1.
Table 1; Tabela 1
Plant growth regulator regime used in experimental design
to induce and to maintain P. domestica odm. Węgierka Zwykła
callus tissue initiated from explanted leave tissue
StęŜenia regulatorów wzrostu stosowane w trakcie indukcji kalusa
na eksplantatach liściowych oraz proliferacji tkanki kalusowej
P. domestica Węgierka Zwykła cv.
Control
Kontrola
Induction/maintenance
Indukcja/proliferacja
Auxin/cytokinin dose
Auksyny/cytokininy
(mg⋅dm-3)
Auxin : cytokinin
ratio; Stosunek
aksyn : cytokinin
3.1/6D9-NT*
2,4-D/BA
2,4-D/BA
2.0/0.1
1.0/0.1
20 : 1
10 : 1
4.1/9D8-FT**
dicamba/BA
dicamba/BA
1.5/0.225
1.5/0.225
6.6 : 1
6.6 : 1
Xylogenic media
PoŜywki
ksylogeniczne
Induction/maintenance
Indukcja/proliferacja
Auxin dose (mg⋅dm-3)
Dawka auksyny (mg⋅dm-3)
Auxin : auxin ratio
Stosunek
auksyna : auksyna
1.1/4D11
picloram
picloram
0.2
0.2
-
2.1/3D10
2,4-D + IBA
picloram
1.1 + 0.1
0.2
11 : 1
-
2.1/5D12
2,4-D + IBA
2,4-D + IBA
1.1 + 0.1
1.1 + 0.1
11 : 1
11 : 1
*NT
nodular tissue; tkanka ziarnista
**FT
fiable tissue; luźna tkanka
After three weeks of induction, in order to maintain callus lines, tissue pieces showing
callus proliferation were twice transferred biweekly to the medium freshly prepared
with the same (treatment 1.1/4D11 and 2.1/5D12) or not the same (treatment 2.1/3D10)
PGR handling, with the level of sucrose kept constant, that is 30 g⋅dm-3. Erlenmeyer
flasks containing 25 cm3 of culture medium, with 5 explants, were kept in continuous
darkness at 24°C. 50 explants were induced in each treatment, and the experimental
block was conducted three times. Cultures were evaluated every week for callus growth,
texture and histology and representative samples were collected for fresh weight
determination. For histological examination segments of tissue were fixed in a solution
of 2% (w/v) glutaraldehyde during at least a weeek before embedding. The tissue was
dehydrated by passage through ethanol series and embedded in Epon 812 The material
IMPACT OF AUXIN ANALOGUES ON in vitro ...
119
was cut at 1 µm with a Tesla 490A microtome, the sections mounted on glass slides,
and the tissue was stained with toluidine blue. The sections were observed and documented under a light microscope.
Results
The leaf explants tissue developed callus. Heterotrophic cultures, such as those
obtained, can adjust their metabolism only from the consumption of sacharides from the
medium. During the course of experiment the level of sucrose was kept constant in
freshly prepared media. The tissues used as control, for comparison of the type and
growth rate in the performed system, were grown on media supplemented with auxin
analogues (2,4-D; dicamba) combinated with BA. The control tissues were of two types,
either white-yellowish smooth, rounded solid mass of the nodular higly proliferative
strain (NT-treatment 6D9: 2.0-1.0 mg⋅dm-3 2,4-D and 0.1 mg⋅dm-3 BA) or loose masses
of friable strain, which readily broke apart when handled (FT-treatment 9D8: 1.5
mg⋅dm-3 dicamba and 0.225 mg⋅dm-3 BA). Tissue pieces maintained a golden yellow
coloration and could be seen under the microscope to manifest abundant proliferation of
cells in the periferic zone. Such cells did not differentiate to any marked extent. The
only degree of organisation retained at the tissue level was that, the cells produced at
succesive cytokinesis exhibited a tendency to form quickly growing clusters.
It was apparent quite early in the culture that in 3D10 treatment, with the
initiation on medium supplemented with 1.1 mg⋅dm-3 2,4-D combined with a low dose
of indole-3-butyric acid (0.1 mg⋅dm-3 IBA) and further maintenance of callus tissue on
medium with 0.2 mg⋅dm-3 picloram, the growth rate of tissue and its friability were
comparable to the highly proliferative control friable tissue type (FT). Neither of
conditions with a single auxin or combinated auxins was particulary favourable to
initiate proliferation of cultured tissues in comparison with the control proliferative
media of both types, that is either friable or nodular. However, the above mentioned
3D10 treatment was clearly the best variant in terms of the growth rate verification on
xylogenic media. It would appear that more cell generations were passed through tissue
inducted on 2,4-D with IBA medium and maintained on picloram (treatment 3D10) than
on media with unique addition of picloram (4D11) or media supplemented with 2,4-D
and IBA during the initiation and maintenance phases (5D12).
In an attempt to discern anatomical differences between cultivated tissue lines
histological preparations were made. In sections of the 3D10 callus unorganized
arrangement of cells was evident.
120
E. Hanus-Fajerska
Photo 1A. Transverse section through fragment of P. domestica callus tissue cultured for 35
days on modified MS with addition of picloram in the same dose of 0.2 mg⋅dm-3
during induction and maintenance periods
Fot. 1A.
Przekrój poprzeczny kalusa kultywowanego 35 dni na zmodyfikowanej poŜywce MS
z dddatkiem 0,2 mg⋅dm-3 pikloramu zarówno w fazie indukcji, jak i proliferacji
tkanki
Photo 1B.
Representative histological section of calus cultured on xylogenic medium with 1.1
mg⋅dm-3 2,4-D and 0.1 mg⋅dm-3 BA, where strand-like arrangement of traheary elements (TEs) can clearly be seen
Fot. 1B.
Charakterystyczny obraz kalusa z pasmami elementów trachealnych, uzyskanego w
na poŜywce ksylogenicznej z dodatkiem 1,1 mg⋅dm-3 2,4-D i 0,1 mg⋅dm-3 BA
The tissue inceased in size by continued unoriented cell divisions with irregular cellular
enlargement afterwards. Signs of xylogenic activity was visible in 11% of the examined
samples, from after about three weeks of culture, so on the maintenance medium with a
low dose of picloram (0.2 mg⋅dm-3 ), after induction with 1.1 mg⋅dm-3 2,4-D and 0.1
mg⋅dm-3 IBA. In treatment 4D11 tissue exhibited unorganized growth, but in about 37%
of samples the scattered areas of tracheary elements (TEs) with spiral secondary cell
wall thickening were observed. Such areas were randomly oriented. In that particular
case, the shift in proliferative pattern of callus tissue was clear, which is demonstrated in
Figure 1A.
The medium with a combination of 2,4-D and IBA (1.1 + 0.1 mg⋅dm-3) was
especially proved to be xylogenic (Fig. 1B). During the induction and maintenance on
equal level and kind of auxin analogues, proliferation occurred in localized areas so that
IMPACT OF AUXIN ANALOGUES ON in vitro ...
121
nodular tissue fragments were formed.
The tissue was compact with extensive rows of xylem cell lineages. The combination of
compounds with auxin activity in ratio 11 : 1 reorganized the differentiation pattern in
prune callus. Tracherary elements were differentiated in observed all phases of the
callus growth.
Discussion
Cell division is not a prerequisite for the initiation of xylem differentiation, as the
mechanically isolated mesophyll cells can directly differentiate into tracheary elements,
which was convincingly proved by KOLENBACH and SCHMIDT [1975] with cells of Zinnia
elegans, and afterwards confirmed by FUKUDA and KOMAMINE [1980]. This system,
serving as a model for cytodifferentiation in higher plants, has even become a tool for
studying subcellular mechanisms in xylem formation [FUKUDA, HIROO 1994; MCCANN
1997; MILONI et al. 2002; DAHIA 2003; YOSHIDA et al. 2005]. On the other hand auxin and
sucrose were shown to be import in the initiation of xylem differentiation. It was in
1967 that JEFFS and NORTHCOTE showed that sucrose does not simply provide an energy
source for differentiating cells, but also play a role in the initiation of differentiation
process. Auxin was proved to be a limiting factor in wound xylem differentiation,
primary vascular differentiation, secondary xylem differentiation and in tracheary
element formation of in vitro cultured cells and tissues [FOSKET, TORREY 1969; NORTHCOTE
1995].
The differentiaton of tracheary elements was studied in callus culture of many
herbaceous and woody dicotyledonous species, but so far not in the genus Prunus
[BESLOW, RIER 1969; MINOCHA, HALPERIN 1974; ALONI 1980; PISSARA et al. 1990;
KUTERNOZIŃSKA et al. 1991], so the above mentioned results are part and parcel of auxin
signal flow canalization hypothesis [SACHS 1969, 1991]. Above demonstrated experiments
were at first designed to determine the hormonal requirement necessary to maintain an
adequate growth rate of the appropriate fenotype of callus tissue, because especially in
woody plant cultivars and even clones of the same cultivar vary in response to in vitro
culture [JONES 1991]. The friability of initiated parynchymatous callus was rather high in
experimental treatments with different hormonal sequence and balance, which in turn
confirmed the results obtained with Hevea brasiliensis clones [MONTORO et al. 1993].
After the induction of differentiation of tracheary elements on the media with
auxin analogues, they were continuously differentiated in all further phases of callus
growth. Cultivating sweet common prune callus on the maintenance medium with a low
dose of potent auxin-like substance, that is picloram which is rapidly utilized by
growing cells [HAGEN et al. 1991], it was possible to obtain cell populations essentially
free of tracheary elements. However, when such a dose was applied in both induction
and maintenance media, it proved to be suboptimal. In those cell populations about 18%
of cells differentiated in the nest-like arranged tracheary elements. The appearance of
tissue produced on the medium containing 2,4-D but lacking cytokinin was not basically
different from the tissue on the control 2,4-D medium combinated with BA. A clear
shift in the differentiation pattern was visible in the medium with combinated 2,4-D and
IBA, the first in a high and next in a low dose (1.1 + 0.1 mg⋅dm-3), with the growth rate
only slightly different in comparison to other auxin treatments. So even in the absence
of exogenous cytokinin, 2,4-D was found to promote both cell multiplication and
differentiation, like in the case of Glycine max cv. Biloxi [FOSKET, TORREY 1969]. It is
also consistent with the findings of ALONI [1980] and MINOCHA and HALPERIN [1974], that
auxin controls quantiatively the differentiation of xylem elements in cultured calli. The
122
E. Hanus-Fajerska
nature of the proliferating tissues in a studied clone obviously depended on chemical
and physical factors employed under tissue culture conditions. Well known is the fact,
that the level and ratio of plant growth regulators are more important factors than the
individual role of each, and their metabolism rather than content per se determine the
proliferative potential of isolated colonies of cells and their further differentiation.
Conclusions
1.
Auxin combinated with cytokinin was more effective in either establishing the
Prunus domestica callus in vitro or its further maintaining, than treatments with
single or with combinated auxins added to Murashige-Skoog medium.
2.
Callus lines grown on media supplemented with different auxins may be similar
in apparence, but histologically different.
3.
Dichlorophenoxyacetic acid added to the medium with constant sucrose level can
stimulate tracheary element formation in P. domestica callus.
4.
Modified Murashige-Skoog medium with the addition of 1.1 mg⋅dm-3 2,4-D and
0.1 mg⋅dm-3 IBA was proved to be xylogenic.
References
ALONI R. 1980. Role of auxin and sucrose in the differentiation of sieve and tracheary
elements in plant tissue cultures. Planta 150: 255-263.
BESLOW DT., RIER K. 1969. Sucrose concentration and xylem regeneration in Coleus
internodes in vitro. Plant Cell Physiol. 10: 69-77.
BHANSALI R.R., DIVERT J.A., DURZAN D.J. 1991. Adventitious embryogenesis and plant
regeneration from rescued embryos of peach, Prunus persica (L.). Ind. Jour. Exp. Biol.
29: 334-337.
CHAFFEY N., CHOLEWA E., REGAN S., SUNDBERG B. 2002. Secondary xylem development in
Arabidopsis: a model for wood formation. Physiol. Plant. 114: 594-600.
DAHIA P. 2003. Role of death in providing lifeline in plants. Trends in Plant Sciences
8/10: 462-465.
DEMURA T., TASHIRO G., HORIGUCHI G., KISHIMOTO N., KUBO M., MATSUOKA N., MINAMI A.,
NAGATA-HIWATASHI M., NAKAMURA K., OKAMURA Y., SASSA N., SUZUKI S., YAZAKI J.,
KIKUCHI FUKUDA H. 2002. Visualisation of comprehensive microarray analysis of gene
expression programs during transdifferentiation of mesophyll cells into xylem cells.
PNSA 99/24: 15794-15799.
ESCALETTES V., DOSBA F. 1993. In vitro adventitious shoot regeneration from leaves of
Prunus spp. Plant Science 90: 201-209.
FOSKET DE., TORREY JG. 1969. Hormonal control of cell proliferation and xylem
differentiation in cultured tissues of Glycine max var. Biloxi. Plant Physiol. 44:
871-880.
FUKUDA H., HIROO K. 1994. Redifferentiation of single mesophyll cells into tracheary
elements. Int Journ. Plant Scie. 155(3): 262-272.
FUKUDA H., KOMAMINE A. 1980. Establishment of an experimental system for the study of
tracheary element differentiation from single cells isolated from the mesophyll of Zinnia
IMPACT OF AUXIN ANALOGUES ON in vitro ...
123
elegans. Plant Physiol. 65: 57-60.
HAGEN SR., MUNETA P., AUGUSTIN J., LE TOURNEAU D. 1991. Stability and utilization of
picloram, vitamins and sucrose in a tissue culture medium. Plant Cell Tiss. Organ Cult.
25: 45-48.
HANUS-FAJERSKA E. 2006. Improvement of growth parameters of prune callus cultures
destined to initiate cell suspensions. Acta Soc. Bot. Pol. 75/1: 5-9.
HANUS-FAJERSKA E., NOWAK B. 2001. The initiation, growth rate and characteristics of
Prunus domestica L. ‘Węgierka Zwykła’ callus cultures. Folia Hort. 13/1A: 481-486.
JEFFS RA., NORTHCOTE DH. 1967. The influence of indol-3-acetic acid and sugar on the
pattern of induced differentiation in plant tissue culture. J. Cell Sci. 2: 77-88.
JONES OP. 1991. The role of biotechnology in the multiplication and improvement of
woody plants. Acta Hort. 289: 35-44.
KUBO M., UDAGAWA M., NISHIKUBO N., HORIGUCHI G., YAMAGUCHI M., ITO J., MIMURA T.,
FUKUDA H., DEMURA T. 2005. Transcription switches for protoksylem and metaksylem
vessel formation. Genes & Develop. 19: 1855-1860.
KOLENBACH HW., SCHMIDT B. 1975. Cytodifferenzierung in Form einer direkten
Umwandlung isolierter Mezophyllzellen zu Tracheiden. Z. Pflanzenphysiol. 75:
369-374.
KUTERNOZIŃSKA W., PILIPOWICZ M, KOROHODA W. 1991. Transitory pulse-like treatment
with IAA solution more effectively induces xylogenesis in callus culture than permanent
presence of the auxin. Biol. Plant. 33(6): 433-438.
MILONI D., SADO P., STACEY N., ROBERTS K., MCCANN M. 2002. Early gene expression
associated with the commitment and differentiation of plant tracheary element is
revealed by cDNA-Amplified Fragment Length Polymorphism Analysis. The Plant Cell
14: 2813-2824.
MINOCHA S.C., HALPERIN W. 1974. Hormones and metabolites which control tracheid
differentiation with or without concomitant effect on growth in cultured tuber tissue of
Helianthus tuberosus. Planta 116: 319-331.
MCCANN MC. 1997. Tracheary element formation: building up to a dead end. Trends
Plant Scie. 2: 333-338.
MONTORO P., ETIENNE H., MICHAUX-FERRIERE N., CARRON MP. 1993. Callus friability and
somatic embryogenesis in Hevea brasiliensis. Plant Cell Tiss. Organ Cult. 33: 331-338.
NOWAK B. 1999. Regeneracja śliwy (Prunus domestica L.) odmiany Węgierka Zwykła z
eksplantatów poraŜonych wirusem ospowatości śliwy. Zesz. Probl. Post. Nauk Rol. 469:
581-586.
NOWAK B., MICZYŃSKI K. 1996. Regeneration capacity of Prunus domestica L. cv.
Węgierka Zwykła from leaves explants of in vitro shoots, using TDZ. Folia Hort. Ann.
8/2: 41-49.
NOWAK B., MICZYŃSKI K. 2002. The course and efficiency of organogenesis on leaf
explants of plum ‘Węgierka Zwykła’ (Prunus domestica L.) induced by cytokinins.
E.J.P.A.U. www.ejpau.media.pl/series/volume5/issue1/biotechnology
NORTHCOTE DH. 1995. Aspects of vascular tissue differentiation in plants. Int. Journ.
Plant Scie. 156: 245-257.
PISSARA J., SANTOS I., SALEMA R. 1990. Xylogenesis and lignification in plant tissue
cultures differently affected by 8-hydroksyquinoline sulphate. Protoplasma 158: 19-25.
RAVEN PH., EVERT RF., EICHHORN S.E. 1999. Biology of plants. Freeman Co., New York.
E. Hanus-Fajerska
124
SACHS T. 1969. Polarity and the induction of organized vascular tissues. Ann. Bot. 33:
263-275.
SACHS T. 1991. Cell polarity and tissue pattering in plants. Development 91 (Suppl. 1):
83-93.
YOSHIDA S., KURIAMA H., FUKUDA H. 2005. Inhibition of transdifferentiation into
tracheary elements by polar auxin transport inhibitors through intracellular auxin
depletion. Plant Cell Physiol. 46/12: 2019-2028.
Key words:
auxins, callus lines, differentiation, histology, xylogenesis, Prunus sp.
Summary
Research on kinetics of growth and morphology of Prunus domestica leaf derived
callus cultured in vitro were compared with the anatomical features of proliferating cell
populations. Anatomical studies revealed that callus showed particular histological
features when subcultured on different types and levels of plant growth regulartors
added to the modified MS medium. The addition of auxin analoques induced changes in
cell populations, such as rate of cytokinesis and extent of xylogenesis. 2,4-D was found
to stimulate tracheary element formation with the level of sucrose kept constant. Tissues
cultivated on 2,4-D+IBA and picloram in the induction medium and maintenance
medium respectively, showed a certain degree of cell type differentiation as indicated
by the formation of isolated tracheary cells and in some cases organized tracheoid
development. Growth, as measured by the increase in fresh weight, was more rapid in
the control auxin/cytokinin media as compared to the media supplemented with picloram, dichlorophenoxyacetic acid (2,4-D) and indole-3-butyric acid (IBA), what was
more pronounced against time. Maximum growth occured in a medium supplemented
with 2.0-1.0 mg⋅dm-3 2,4-D and 0.1 mg⋅dm-3 BA with growth dynamic of typical
sigmoid curve, whereas 0.2 mg⋅dm-3 of picloram supported only minimal callus growth.
Abbreviations:
BA - benzyloaminopurine, 2,4-D - dichlorophenoxyacetic acid, IBA - indole-3-butyric
acid, FT - friable tissue, NT - nodular tissue, MS - Murashige-Skoog medium, PGR plant growth regulators
WPŁYW ANALOGÓW AUKSYN
NA KSYLOGENEZĘ W TKANKCE KALUSOWEJ
ŚLIWY DOMOWEJ W WARUNKACH in vitro
Ewa Hanus-Fajerska
Katedra Botaniki,
Akademia Rolnicza im. H. Kołłątaja w Krakowie
Słowa kluczowe:
auksyny, linie kalusa, róŜnicowanie, histologia, ksylogeneza,
IMPACT OF AUXIN ANALOGUES ON in vitro ...
125
Prunus sp.
Streszczenie
Struktury trachealne stanowią bardzo charakterystyczny element pojawiający się
w trakcie rozwoju tkanek kalusowych hodowanych na róŜnych poŜywkach, zwłaszcza
na poŜywkach ksylogenicznych. Zarówno zakres spontanicznej, jak i indukowanej
waskularyzacji niezróŜnicowanych komórek kalusa uzaleŜniony jest od składu i
zawartości związków chemicznych obecnych w poŜywce, szczególnie cukrowców i
auksyn. Na kierunek róŜnicowania wywierają równieŜ wpływ róŜnice w stopniu
odŜywienia poszczególnych populacji komórek oraz warunki fizyczne kultury. Obecnie
intensyfikowane są badania molekularne dotyczące aktywacji genów wywołujących
depozycję lignin w ścianie komórkowej, co skutkuje zmianą szlaków metabolicznych i
finalną kaskadą efektów biologicznych. Poszukuje się dogodnych modeli
doświadczalnych in vitro roślin drzewiastych ze względu na ogromne wartości
uŜytkowe tej grupy roślin.
Prezentowane wyniki dotyczą róŜnicowania elementów trachealnych w kalusie
Prunus domestica w odpowiedzi na róŜne kombinacje stęŜeń analogów auksyn,
dodawanych do zmodyfikowanej poŜywki Murashige-Skoog’a, w trakcie kultury tkanek
w ciemności i stałej temperaturze 24±2°C. Kwas 2,4-dichlorofenoksyoctowy dodany w
dawce 1,1 mg⋅dm-3 do poŜywki proliferacyjnej, zawierającej 30 g⋅dm-3 sacharozy,
wywołał waskularyzację komórek kalusa. Rozmieszczenie elementów tkanki
naczyniowej w obserwowanych przekrojach tkanki kalusowej było uformowane w
kształcie skupisk lub pasm. Dodatek kwasu indolilo-3-masłowego, obok 2,4-D, bądź
uŜycie pikloramu zarówno w poŜywce indukcyjnej, jak i proliferacyjnej wyraźnie w
mniejszym stopniu spowodowały róŜnicowanie się elementów przewodzących, które
były rozmieszczone w sposób bezładny w obrębie tkanki.
Dr Ewa Hanus-Fajerska
Katedra Botaniki
Akademia Rolnicza im. H. Kołłątaja
al. 29 Listopada 54
31-425 KRAKÓW
e-mail: [email protected]
ZESZYTY PROBLEMOWE POSTĘPÓW NAUK ROLNICZYCH 2007 z. 523: 127-136
DIFFERENTIATION OF WHEAT CELL SUSPENSION
CULTURED IN COLD - IMPACT OF ZEARALENONE
AND 24-EPIBRASSINOLIDE
Anna Janeczko, Jolanta Biesaga-Kościelniak, Andrzej Skoczowski,
Izabela Marcińska
Institute of Plant Physiology, Polish Academy of Sciences, Kraków
Introduction
Regenerable cell suspension cultures offer an in vitro system for mutant selection,
propagation of varieties, gene transfer experiments, secondary metabolites production
and physiological and biochemical studies [MYTHILI et al. 1999; ZANG et al. 2003]. These
variant cell lines are useful for research into the genetics and biochemistry of plant cells
and also in biotechnology for the production of new plant varieties and secondary
metabolites. Micropropagation of cereals is more difficult than that of dicotyledones
plants. The main problem is obtaining stabilized cell suspension or callus culture
capable of regeneration. Regenerative cell suspension cultures are initiated exclusively
from embryogenic callus [VASIL 1988]. The establishment of such suspension cultures, as
well as their maintenance by weekly subculture, is a difficult and time-consuming
procedure. Furthermore, embryogenic callus, as well as suspensions, lose with time
their morphogenetic competence [BEN AMER, BÖRNER 1997; MYTHILI et al. 1999]. To
enhance the efficiency of the process of cell differentiation and plant regeneration
except special hormone balance in medium various stress factors such as low or high
temperature or shortages of nutrients (starvation) are used [ORSHINSKY, TOMES 1984; HOU
et al. 1997; TSUGAWA, SUZUKI 2000; ZHENG 2003]. Significant increases in green plant
regeneration were recorded in experiments when detached tillers of rye were cold
pretreated for two or four weeks [IMMONEN, ANTTILA 1999]. In winter wheat cell
suspension cultures two weeks of cold were applied to determine the treatment aftereffects on its growth [MARCIŃSKA 2003].
Until now, the attempts at regenerating Polish wheat cultivars via suspension
culture using auxins and cytokinins have not been successful [MARCIŃSKA 2003].
The aim of this study was to determine the impact of two regulators: zearalenone
(ZEN) and 24-epibrassinolide (BR27) on differentiation of winter wheat callus
developed from cell suspension cultured 0-9 weeks at 5°C. Survival of winter wheat
suspension for a longer period of cold has not been studied yet; then the kinetic of
growth of wheat suspension during 9 weeks in cold will also be characterized.
Material and methods
Cell suspension culture
Experiments were conducted on winter wheat cv. Grana. For preparation of cell
suspension, calluses obtained from immature embryos isolated 14 days after plant
128
A. Janeczko i inni
flowering were used. Embryos were disinfected for 1 minute in 70% ethanol, 20
minutes in 10% Domestos (5.25% sodium hypochlorite) and rinsed with sterile water.
Calluses were cultured on MS medium [MURASHIGE, SKOOG 1962] containing 30 g⋅dm-3
sucrose, 2 mg⋅dm-3 2,4-D (2,4-dichlorophenoxyacetic acid) and 0.6% Bacto-Agar
(Sigma-Poland). The culture grew at 24°C, under 16 h photoperiod (80µmol
quantum⋅m-2⋅s-1 (PAR)) [MARCIŃSKA et al. 1995]. Subculture of callus was carried out at
regular periods of one month. Suspension cultures were developed by inoculating 4-5 g
of 3 month-old callus into 60 cm3 of MS liquid medium, containing 30 g⋅dm-3 sucrose
and 2 mg 2,4-D⋅dm-3. Cultures were maintained in 300 cm3 Erlenmeyer flasks in the
dark at 28°C on a rotary shaker at 60 rpm. After 14 days, 100 cm3 of fresh liquid
medium was added. After the next 2 weeks, suspensions were allowed to settle and 10
cm3 of the supernatant was removed and replaced by an equal volume of fresh medium.
This procedure was repeated after 6 weeks. The cell suspension obtained in this way
was poured out into Erlenmeyer 100 cm3 flasks with the amount of 50 cm3 of
suspension per vessel. Next, the flasks were placed onto a rotary shaker in a refrigerator
(5°C, darkness). During the next 9 weeks of culture, the medium was not changed or
added too. Cell suspension growth parameters were measured weekly over a period of 9
weeks. The growth parameters of suspension cultured at 28°C, before cold treatment,
were considered as a control and marked with „0”.
Parameters of cell suspension growth
The dry weight of a 1 cm3 sample of the suspension was estimated after drying at
60°C for 48h. For packed culture volume evaluation (PCV), 10 cm3 of suspension was
centrifuged in calibrated conical tubes for 5 min at 100 x g. Number of cells (suspension
density) was estimated in a Bürker cell and calculated per 1 cm3 of suspension. Cell
viability was determined qualitatively by mixing small volumes of the suspension cells
with Evans Blue to give a dye concentration of 0.05% [GAFF, OKONG’O-OGOLA 1971].
Metabolic activity of cell suspension was estimated as a heat emission from the cells.
Analyses were conducted in an isothermal calorimeter (BioActivity Monitor 2277) at
20°C. Suspension heat production rate (in nW) was calculated per number of cells in the
measured sample (2 cm3) and standardized for 100000 cells. The number of clusters was
estimated in 40 cm3 of cell suspension. Additionally, pH of suspension medium was
monitored with a conductivitymeter CC-317. pH decreased from 5.9 in the beginning of
culture to 5.5 in the ninth week. Measurements of suspension were carried out in four
independent replicates on samples taken from randomly chosen flasks.
The morphogenic potential of suspension
Cell aggregated were collected from suspension cultured in cold and plated onto
MS basal medium supplemented with (a) 1 mg 2,4-D + 2 mg ZEN and (b) 1 mg 2,4D+0.004 mg BR27 per dm3. Developing calli were cultured for four weeks at 24°C (16 h
photoperiod).
Statistical analysis
The data presented in the Figure 1 and Table 1 are the mean values ±SD.
Statistical significance for the influence of medium composition on callus differentiation was calculated based on the Pearson χ2 test (Tab. 2).
Results and Discussion
DIFFERENTIATION OF WHEAT CELL SUSPENSION CULTURED ...
129
Cell suspension growth in cold
In natural conditions winter cereals can survive long exposure to low temperatures due to their anatomical and morphological properties and also physicoheat production rate (nW⋅100 000 cells-1)
produkcja ciepła (nW⋅100 000 komórek-1)
chemical modifications at the cellular level [CRESPI et al. 1991; EGIERSZDORFF, KACPERSKA
2001]. However, the response of isolated cells of cereals to a long period of cold was not
known until now. The results of the presented paper show that it is possible to maintain
winter wheat cell suspension alive for 9 weeks at 5°C and without the necessity of
changing nutrient medium. However, as it was possible to predict, cold treatment slows
down the growth of suspension about few times in comparison with culture kept at 26°C
[MARCIŃSKA 2003]. Acclimation of oilseed rape suspensions at 2°C (1-3 weeks) also
results in slowing down the growth of cells and increases freezing tolerance of cells
[EGIERSZDORFF, KACPERSKA 2001].
In wheat suspension there two stages of cell response to cold are observed: the
first stage: the adaptation to cold (1-2 weeks of culture), the second stage: the growth
and stabilization of suspension (3-9 weeks of culture).
In the first stage, the percentage of live cells decreases from 99% (noticed at
28°C) to 83% (Fig. 1, inside). The dry weight of suspension does not grow (Tab. 1). At
the same time, there is fluctuation in heat production rate (Fig. 1), which reflects
intensive changes in metabolic activity of cells. It could be explained by the triggering
of defensive and adaptive processes to cold stress.
At the beginning of the second stage suspension growth the number of cells
stabilizes at a level about 94% and remains similar during the next 7 weeks at 5 °C (Fig.
1, inside). In the fourth week of suspension culture a significant increase in dry weight,
density, as well as the number of aggregates is noticed (Tab. 1). From the fifth week the
dry weight, as well as density of suspension, do not undergo essential changes
(stabilization of suspension). The described exponential phase of growth and then
stabilization phase is also characteristic for wheat suspensions growing at 26°C
[MARCIŃSKA 2003] and is noted in cell suspensions of other plant species [BLIGNY 1977;
EGIERSZDORFF, KACPERSKA 2001]. After 9 weeks of cold the weight of wheat suspension is
2.5 times higher than before cold treatment. In culture growing at 26°C a similar
increase in weight is observed already after 1 week of the culture [MARCIŃSKA 2003].
The level of metabolic activity stabilizes in cold at values a few times lower than
at 28°C. The average of heat emission in the suspension growing at 28°C is 179 nW,
whereas in the suspension growing for several weeks in cold it is in the of range 38-63
nW (Fig. 1). The metabolic activity depends on the temperature and time of its action
[BREIDENBACH et al. 1990; CRIDDLE et al. 1997; THYGERSON et al. 2002]. In the culture of
tomato and carrot cells during the lowering of temperature from 35°C to 0°C a
systematic decrease in metabolic activity is observed [CRIDDLE et al. 1988; HANSEN et al.
1994]. The metabolic activity of tomato callus tissue decreases just after several hours of
culture at 0°C [RANK et al. 1991].
A. Janeczko i inni
130
Fig. 1.
Metabolic activity (heat production rate) and number of live cells of winter wheat
cell suspension cultured in cold
Rys. 1.Aktywność metaboliczna (produkcja ciepła) i liczba Ŝywych komórek zawiesiny pszenicy
ozimej rosnącej w chłodzie
Table 1; Tabela 1
Parameters of growth of winter wheat cell suspension in cold
Parametry wzrostu zawiesiny komórkowej pszenicy ozimej w chłodzie
*
Weeks at 5°C
Tygodnie w 5°C
Dry matter
Sucha masa
(mg)
Density (numbers of
cells 104⋅ml-1)
Gęstość
(liczba
komórek 104⋅ml-1)
Packed cell
volume (PCV)
Całkowita objętość
komórek (PCV)
(cm3⋅10 ml-1)
Number of agregates
(per 40 ml
of suspension)
Liczba agregatów
(w 40 ml zawiesiny)
0 (control; kontrola)
1
2
3
4
5
6
7
8
9
2.0±0.8
2.3±0.7
2.1±0.9
2.3±1.1
5.5±1.1
4,9±0.5
4,5±0.4
4,8±1.1
4,0±1.2
5,0±1.0
20±02
15±01
48±15
31±11
83±17
23±07
44±05
32±09
40±07
28±06
1.4±0.2
1.3±0.5
1.5±0.4
1.6±0.6
1.1±0.1
0.5±0.2
1.4±0.2
1.8±0.3
1.4±0.3
1.5±0.2
141±27
97±45
90±22
108±16
148±15
107±40
80±08
97±09
79±17
103±09
dry weight of cells in 1 cm3 medium after evaporation; sucha masa komórek zawiesiny po odparowaniu 1 cm3 poŜywki
The morphogenic potential of suspension
In suspension cultured in cold, characteristic elongated and cells with large
vacuoles are observed, however small isodiametric cells also appear. The greatest
number of isodiametric cells with large nuclei and thick cytoplasm are found in the
fourth week of the culture. These cells are considered to be potentially morphogenic
[MARCIŃSKA 2003]. In fact, their tendency to colony formation is observed.
Table 2; Tabela 2
Impact of zearalenone and 24-epibrassinolide on differentiation
of winter wheat callus obtained from cell suspension cultured in cold
DIFFERENTIATION OF WHEAT CELL SUSPENSION CULTURED ...
131
Wpływ zearalenonu i 24-epibrassinolidu na róŜnicowanie kalusa otrzymanego
z agregatów powstałych w zawiesinie pszenicy ozimej rosnącej w chłodzie
Number of callus; Liczba kallusów
Weeks of growth of
suspension
Tygodnie wzrostu
zawiesiny w chłodzie
with green
spots
z zielonymi
centrami
with regenerated
roots
regenerujących
korzenie
Differentiation
of frequency
with respect to
control*
ZróŜnicowanie
częstości w
porównaniu do
kontroli*
with
differentiation
nie wykazujących
regeneracji
ZEN
0 (control; kontrol)
1
2
3
4
5
6
7
8
9
20 (41)
20 (40)
25 (50)
25 (50)
25 (50)
30 (60)
30 (60)
20 (41)
24 (48)
30 (60)
20 (41)
20 (40)
12 (24)
12 (24)
23 (46)
16 (32)
16 (32)
20 (41)
22 (44)
16 (32)
0 (control; kontrola)
1
2
3
4
5
6
7
8
9
21 (42)
15 (30)
25 (50)
19 (38)
25 (50)
23 (46)
22 (44)
20 (40)
25 (50)
18 (36)
22 (44)
30 (60)
25 (50)
23 (46)
23 (46)
26 (52)
26 (52)
28 (56)
23 (46)
30 (60)
9 (18)
10 (20)
13 (26)
13 (26)
2 (4)
4 (8)
4 (8)
9 (18)
4 (8)
4 (8)
+
+
+
+
+
BR27
7 (14)
5 (10)
0 (0)
8 (16)
2 (4)
1 (2)
2 (4)
2 (4)
2 (4)
2 (4)
+
+
+
+
+
+
*
in brackets percentage of all investigated calluses; w nawiasach podano udział procentowy
poszczególnych grup kalusów
+
significant difference acc. to χ2 test; istotność róŜnic wg testu χ2
Aggregates are used for regeneration of Monocotyledons on various hormonal
media [AHMED, SÁGI 1993; GUO, PULLI 2001]. The attempts at regenerating Polish wheat
cultivars via suspension culture with the use of auxins and cytokinins was not successful
[MARCIŃSKA 2003]. In our experiment we propose other regulators - zearalenone and 24epibrassinolide. Zearalenone is an active substance of multi-directional physiological
influence [BIESGA-KOŚCIELNIAK 2001; BIESAGA-KOŚCIELNIAK et al. 2003]. ZEN can increase,
better than 2,4-D, the number of wheat calluses (obtained from immature embryos)
capable of regenerating shoots, and especially effectively, the process of regenerating
shoots from poorly-differentiated wheat calluses. The 24-epibrassinolide (BR27) belongs
to relatively new plant hormones (brassinosteroids) engaged mainly in the processes of
growth and stress resistance [GROVE et al. 1979; MANDAVA 1988; AZPIROZ et al. 1998;
KRISHNA 2003]. Brassinosteroids are already successfully used in protocols for
regeneration or embryogenesis of Monocotyledons (Spartina patens (AITON) MUHL.,
Oryza sativa L.) and other plant species [FRANCK-DUCHENNE et al. 1998; SASAKI 2002; LU et
132
A. Janeczko i inni
al. 2003; PULLMAN et al. 2003; AZPEITIA et al. 2003; NÚŃEZ et al. 2004].
The impact of both regulators on the morphogenic potential of aggregates
obtained from suspension appears to interact with the cold derived from the suspension
cultured at 28°C and treated with cold for 1-3 weeks and do not show symptoms of
differentiation on media containing ZEN or BR27 (Tab. 2). Cold treatment (5-9 weeks)
increased the impact of both growth regulators on differentiation processes in calluses.
Zearalenone stimulates formation of green spots in calluses better then BR27; which
rather stimulates root regeneration (Tab. 2). Formation of green regions “shoot
primordial” is considered as the first indication of callus differentiation and regenerative
activity [SEARS, DECKARD 1982]. The occurrence of green spots in cereal callus cultures
was frequently noted, and a positive correlation between the presence of such spots and
regeneration was reported [BEN AMER, BÖRNER 1997]. In the present experiment wheat
plant regeneration was not successfully completed but the appearance of potentially
morphogenic cells in suspension during cold treatment seems to be interesting for
further attempts. Moreover the length of cold treatment of the cell suspension affects the
later differentiation of suspension-derived callus on media containing ZEN and BR27. It
is worth to emphasize that in comparison to the effects of ZEN and BR27, no symptoms
of callus differentiation were observed on media containing kinetin (data not shown).
Conclusions
1.
The cell suspension of winter wheat may be cultured for 9 weeks in cold without
the necessity of changing the medium. Its growth is slowed down and there is
observed a stage of adaptation to cold and subsequently a stage of fast growth and
stabilization. Suspension may be used to study response cold of isolated cells.
2.
The appearance of potentially morphogenic cells in suspension during cold
treatment seems to be interesting for further attempts of winter wheat regeneration from cell suspension culture.
3.
The length of cold treatment of the cell suspension affects the later differentiation
of suspension on media containing ZEN and BR27.
References
AHMED K.Z., SÁGI F. 1993. Culture of and fertile plant regeneration from regenerable
embryogenic suspension cell-derived protoplasts of wheat (Triticum aestivum L.). Plant
Cell Rep. 12: 175-179.
AZPEITIA A., CHAN J.L., SAENZ L., OROPEZA C. 2003. Effect of 22(S),23(S)-homobrassinolide on somatic embryogenesis in plumule explants of Cocos nucifera (L.) cultured
in vitro. J. Hort. Sci. & Biotech. 78(5): 591-596.
AZPIROZ R., WU Y., LOCASCIO J.C., FELDMANN K.A. 1998. An Arabidopsis brassinosteroid-dependent mutant is blocked in cell elongation. The Plant Cell 10: 219-230.
BEN AMER I.M., BÖRNER A. 1997. The relationship between green spot initiation and
plantlet regeneration of wheat callus grown under short-term conditions. Plant Cell
Tissue Organ Cult. 50: 67-69.
BIESAGA-KOŚCIELNIAK J. 2001. Zearalenone as a new hypothetical regulator of the plant
vegetative and generative development. 11 Monograph of The Franciszek Górski
Institute of Plant Physiology Kraków, Poland. (English summary, figures and tables
description).
DIFFERENTIATION OF WHEAT CELL SUSPENSION CULTURED ...
133
BIESAGA-KOŚCIELNIAK J., MARCIŃSKA I., WĘDZONY M. 2003. Effect of zearalenone treat-
ment on the production of wheat haploids via the maize pollination system. Plant Cell
Rep. 21: 1035-1039.
BLIGNY R. 1977. Growth of suspension-cultured Acer pseudoplatanus L. cells in automatic culture units of large volume. Plant Physiol. 59: 502-505.
BREIDENBACH R.W., RANK D.R., FONTANA A.J., HANSEN L.D., CRIDDLE R.S. 1990. Calorimetric determination of tissue responses to thermal extremes as a function of time and
temperature. Thermochim. Acta 172: 179-186.
CRESPI M.D., ZABALETA E.J., PONTIS H.G., SALERNO G.L. 1991. Sucrose synthase
expression during cold acclimation in wheat. J. Plant Physiol. 96: 887-891.
CRIDDLE R.S., BREIDENBACH R.W., LEWIS E.A., EATOUGH D.J., HANSEN L.D. 1988. Effects
of temperature and oxygen depletion on metabolic rates of tomato and carrot cell
cultures and cuttings measured by calorimetry. Plant Cell Environ. 11: 695-701.
CRIDDLE R.S., SMITH B.N., HANSEN L.D. 1997. A respiration based description of plant
growth rate responses to temperature. Planta 201: 441-445.
EGIERSZDORFF S., KACPERSKA A. 2001. Low temperature effect on growth and actin
cytoskeleton organization in suspension cell of winter oilseed rape. Plant Cell Tissue
Organ Cult. 65: 149-158.
FRANCK-DUCHENNE M., WANG Y.W., TAHAR S.F, BEACHY R.N. 1998. In vitro stem elongation of sweet pepper in media containing 24-epi-brassinolide. Plant Cell Tissue
Organ Cult. 53(2): 79-84.
GAFF D.F., OKONG’O-OGOLA O. 1971. The use of non-permeating pigments for testing the
survival of cells. J. Exp. Bot. 22: 756-761.
GROVE M.D., SPENCER F.G., ROHWEDEDER W.K., MANDAVA N.B., WORLEY J.F., WARTHEN
J.D., STEFFENS G.L., FLIPPEN-ANDERSON J.L., COOK J.C. 1979. Brassinolide, a plant
growth promoting steroid isolated from Brassica napus pollen. Nature 281: 216-217.
GUO Y., PULLI S. 2001. Somatic embryogenesis and plant regeneration from suspension
cultures of timothy (Phleum pratense L.). Acta Agric. Scand., Section B 51: 160-166.
HANSEN L.D., AFZAL M., BREIDENBACH R.W., CRIDDLE R.S. 1994. High- and low-temperature limits to growth of tomato cells. Planta 195: 1-9.
HOU B., YU H., TENG S. 1997. Effects of low temperature on induction and differentiation
of wheat calluses. Plant Cell Tissue Organ Cult. 49: 35-38.
IMMONEN S., ANTTILA H. 1999. Cold pretreatment to enhance green plant regeneration
from rye anther culture. Plant Cell Tissue Organ Cult. 57: 121-127.
KRISHNA P. 2003. Brassinosteroid-mediated stress responses. J. Plant Growth Regul. 22:
289-297.
LU Z., HUANG M., GE D.P., YANG Y.H., CAO X.N, QIN P., SHE J.M. 2003. Effect of brassinolide on callus growth and regeneration in Spartina patens (Poaceae). Plant Cell
Tissue Organ Cult. 73: 87-89.
MANDAVA N.B. 1988. Plant growth-promoting brassinosteroids. Annu. Rev. Plant Physiol. Plant Mol. Biol 39: 23-52.
MARCIŃSKA I. 2003. Wheat cell suspension culture. 11 Monograph of The Franciszek
Górski Institute of Plant Physiology, Krakow, Poland. (English summary, figures and
tables description).
MARCIŃSKA I., DUBERT F., BIESAGA-KOŚCIELNIAK J. 1995. Transfer the ability to flower in
winter wheat via callus tissue regenerated from immature inflorescences. Plant Cell
Tissue Organ Cult. 41: 258-288.
134
A. Janeczko i inni
MURASHIGE T., SKOOG F. 1962. A revised medium for rapid growth and bio-essays with
tobacco tissue cultures. Physiol. Plant. 15: 473-497.
MYTHILI P.K., SEETHARAMA N., REDDY V.D. 1999. Plant regeneration from embryogenic
cell suspension cultures of wild sorghum (Sorghum dimidiatum Stapf.) Plant Cell Rep.
18: 424-428.
NÚŃEZ M., SIQUEIRA W.J., HERNÁNDEZ M., ZULLO M.A.T., ROBAINA C., COLL F. 2004.
Effect of spirostane analogues of brassinosteroids on callus formation and plant regeneration in lettuce (Lactuca sativa). Plant Cell Tissue Organ Cult. 78: 97-99.
ORSHINSKY B.R., TOMES D.T. 1984. Effect of long-term culture and low temperature
incubation on plant regeneration from a callus line of bridsfoot trefoil (Lotus corniculatus L.). J. Plant Physiol. 119: 389-397.
PULLMAN G.S, ZHANG Y., PHAN B.H. 2003. Brassinolide improves embryogenic tissue
initiation in conifers and rice. Plant Cell Rep. 22(2): 96-104.
RANK D.R., BREIDENBACH R.W., FONTANA A.J., HANSEN L.D., CRIDDLE R.S. 1991. Time
temperature responses of tomato cells during high- and low-temperature inactivation.
Planta 185: 576-582.
SASAKI H. 2002. Brassinolide promotes adventitious shoot regeneration from cauliflower
hypocotyl segments. Plant Cell Tissue Organ Cult. 71(2): 111-116.
SEARS R.G., DECKARD E.L. 1982. Tissue culture variability: Callus induction and plant
regeneration. Crop Sci. 22: 546-550.
THYGERSON T., HARRIS J.M., SMITH B.N., HANSEN L.D., PENDLETON R.L., BOOTH D.T. 2002.
Metabolic response to temperature for six populations of winterfat (Eurotia lanata).
Thermochim. Acta 394: 211-217.
TSUGAWA H., SUZUKI M. 2000. A low-temperature method for maintaining plant regeneration activity in embryogenic callus of rice (Oryza sativa L.). Plant Cell Rep. 19:
371-375.
VASIL I.K. 1988. Progress in the regeneration and genetic manipulation of cereal crops.
Biotechnol. 6: 397-402.
ZANG X., MEI X., ZHANG C., LU C., KE T. 2003. Improved paclitaxel accumulation in cell
suspension cultures of Taxus chinensis by brassinolide. Biotechnol. Let. 23: 1047-1049.
ZHENG M.Y. 2003. Microspore culture in wheat (Triticum aestivum) doubled haploid
production via induced embryogenesis. Plant Cell Tissue Organ Cult. 73: 213-230.
Key words:
Triticum aestivum L., cold, cell suspension, differentiation, 24-epibrassinolide, zearalenone, calorimetry
Summary
The aim of this study was to determine the impact of two regulators: zearalenone
(ZEN) and 24-epibrassinolide (BR27) on the differentiation of winter wheat suspension
cultured for 0-9 weeks at 5°C. The kinetic of growth of wheat suspension for 9 weeks in
cold was also characterized. The winter wheat cell suspension was grown during 9week growth at 5°C without the necessity of medium changing. After the adaptation
period, the number of live cells in the suspension stabilized at over 90%. Metabolic
activity of cells at 5°C was several times lower than at 28°C but after 9 weeks of cold,
the dry mass of the suspension was higher than the initial one. The length of cold
DIFFERENTIATION OF WHEAT CELL SUSPENSION CULTURED ...
135
treatment of cell suspension affected the later differentiation of aggregates on media
containing ZEN and BR27. A longer cold treatment (4-9 weeks) caused an increase in
the number of calluses with green spots, especially on media containing ZEN while
BR27 rather stimulated root regeneration.
WPŁYW ZEARALENONU I 24-EPIBRASINOLIDU
NA RÓśNICOWANIE ZAWIESINY KOMÓRKOWEJ
PSZENICY HODOWANEJ W CHŁODZIE
Anna Janeczko, Jolanta Biesaga-Kościelniak, Andrzej Skoczowski,
Izabela Marcińska
Instytut Fizjologii Roślin im. F. Górskiego Polskiej Akademii Nauk w Krakowie
Słowa kluczowe:
pszenica ozima, chłód, zawiesiny komórek, róŜnicowanie kalusa,
24-epibrasinolid, zearalenon, kalorymetria
Streszczenie
Celem eksperymentu była ocena wzrostu zawiesiny komórek pszenicy ozimej
hodowanej przez 9 tygodni w temperaturach chłodowych. Po tym czasie badano wpływ
zearalenonu i 24-epibrasinosteroidu na róŜnicowanie kalusa otrzymanego z chłodzonej
zawiesiny. Kultura zawiesinowa pszenicy ozimej po przejściu okresu adaptacyjnego do
niskich temperatur (zmiany aktywności metabolicznej, spadek procentu Ŝywych
komórek) wykazywała stabilny, choć powolny wzrost. Powstałe w niej agregaty zostały
wyłoŜone na poŜywkę w celu indukcji i róŜnicowania tkanki kalusowej. Na poŜywkach
zawierających zearalenon kalus wytwarzał najwięcej zielonych centrów regeneracji,
natomiast na poŜywkach z 24-epibrasinolidem szczególnie intensywnie zachodziła
regeneracja korzeni. Zjawisko to występowało jednak tylko w przypadku kalusów
pochodzących z zawiesiny chłodzonej przez dłuŜszy czas - od 4 do 9 tygodni. Kalus
otrzymany z zawiesiny chłodzonej krócej lub niechłodzonej nie wykazywał
symptomów róŜnicowania mimo obecności wymienionych regulatorów w poŜywce.
Dr inŜ. Anna Janeczko
Instytut Fizjologii Roślin im. F. Górskiego
Polska Akademia Nauk
ul. Niezapominajek 21
30-239 KRAKÓW
e-mail: [email protected]
ZESZYTY PROBLEMOWE POSTĘPÓW NAUK ROLNICZYCH 2007 z. 523: 137-142
PRÓBA INDUKCJI ANDROGENEZY
U POLSKICH ODMIAN OWSA
Hanna Kruczkowska, Helena Pawłowska, Barbara Skucińska
Katedra Hodowli Roślin i Nasiennictwa,
Akademia Rolnicza im. H. Kołłątaja w Krakowie
Wstęp
Owies zwyczajny (Avena sativa L.) naleŜy do zbóŜ mniej opracowanych w kulturze in vitro ze względu na jego niewielkie znaczenie ekonomiczne i mało zachęcające
wyniki dotychczasowych badań. Coraz szersze wykorzystanie haploidów w hodowli
jęczmienia, pszenicy czy pszenŜyta spowodowało ostatnio wzrost zainteresowania
równieŜ gatunkami i genotypami zbóŜ o niskiej wydajności androgenezy i poszukiwanie
czynników kultury stymulujących indukcję i regenerację haploidów.
Pierwsze próby haploidyzacji owsa podjęto w kulturze pylników przeszło 25 lat
temu w USA i Kanadzie [CHUNG 1980 - cyt. za RINES i in. 1997; RINES, MCCOY 1980 - cyt. za
RINES i in. 1997], a 10 lat później zastosowano w tym celu technikę krzyŜowań
oddalonych [RINES, DAHLEEN 1990], najczęściej przez zapylanie pyłkiem kukurydzy.
Uzyskana w krzyŜowaniach liczba haploidalnych roślin owsa jest jednak bardzo niska, i
nie zawsze wszystkie chromosomy kukurydzy ulegają eliminacji, co ogranicza
przydatność tej metody dla celów hodowlanych [RINES i in. 1997; SIDHU i in. 2006]. Do tej
pory nie opisano udanej androgenezy z izolowanych mikrospor owsa, a w kulturze
pylników u większości badanych genotypów powstawał jedynie kalus lub nieliczne
zarodki niezdolne do regeneracji roślin. W literaturze jest tylko kilka doniesień o
regeneracji roślin w kulturze pylników uprawnych form owsa. Autorzy tych prac
otrzymywali najczęściej od kilku do kilkunastu roślin z wielu tysięcy pylników
wyłoŜonych na poŜywkę [RINES 1983; SUN i in. 1991 - cyt. za RINES i in. 1997; KIVIHARJU,
TAURIAINEN 1999; KIVIHARJU i in. 2000].
Ostatnio fińskim badaczom udało się znacznie zwiększyć wydajność androgenezy
u owsa zwyczajnego. U czterech badanych odmian i mieszańca odmianowego uzyskali
od 2 do 30 zielonych roślin na 100 pylników wyłoŜonych na poŜywkę [KIVIHARJU i in.
2005]. Pozytywne rezultaty osiągnięte w kulturze pylników owsa w ośrodku fińskim są
wynikiem bardzo intensywnych prac prowadzonych w ostatnim dziesięcioleciu.
Korzystne dla powstawania zarodków i późniejszej regeneracji zielonych roślin okazało
się przede wszystkim zastosowanie stresu podwyŜszonej temperatury [KIVIHARJU, PEHU
1998], uŜycie poŜywki W14 o korzystniejszym składzie i proporcji związków azotowych
w porównaniu z poŜywką MS [KIVIHARJU i in. 2000], zastąpienie sacharozy wolno
rozkładającą się maltozą [KIVIHARJU i in. 1998], podwyŜszenie zawartości 2,4-D i
obniŜenie poziomu cytokininy - BAP lub kinetyny [KIVIHARJU i in. 2000, 2005], a takŜe
wprowadzenie poŜywki dwufazowej z Ficollem w fazie płynnej [KIVIHARJU i in. 1998].
Znaczący postęp uzyskano jednak dopiero po zastosowaniu wysokiego stęŜenia
138
H. Kruczkowska, H. Pawłowska, B. Skucińska
mioinozytolu oraz zwiększeniu poziomu etylenu w kulturze przez dodanie do poŜywki
etefonu. Dzięki uŜyciu L-cysteiny udało się równieŜ ograniczyć brunatnienie i
przedwczesne zamieranie pylników, które stanowi powaŜny problem w kulturach in
vitro owsa [KIVIHARJU i in. 2005].
Jak wynika z dotychczasowych badań zdolność owsa do androgenezy jest
szczególnie zaleŜna od genotypu. Celem tej pracy było sprawdzenie reakcji kilku
polskich odmian owsa na indukcję androgenezy. Równocześnie badano wpływ
niektórych składników poŜywki zastosowanych przez KIVIHARJU i in. [2005], z eliminacją
najbardziej kosztownego jej składnika - Ficollu i próbą zwiększenia wydajności
androgenezy przez zwielokrotnienie stęŜenia jonów miedzi. Sprawdzano równieŜ
potrzebę wprowadzenia dodatkowego źródła etylenu - etefonu.
Materiał i metody
Badania przeprowadzono na pięciu polskich odmianach owsa: Chwat, Celer,
Cekin, Cwał (oplewione) i Polar (nieoplewiona). Materiał pobrano z pola
doświadczalnego Katedry Hodowli Roślin i Nasiennictwa AR w Krakowie, a odmianę
Chwat dodatkowo z pomieszczenia wegetacyjnego o regulowanych warunkach wzrostu
(temperatura 17°C, fotoperiod dzień/noc 16/8 godz., natęŜenie promieniowania 280
µmol⋅m-2⋅s-1). Odcinano źdźbła, gdy wierzchołek wiechy był wyczuwalny w pochwie
liściowej, powyŜej nasady drugiego liścia, i umieszczano je w kolbach z wodą w
temperaturze 4°C. Po 6-7 dniach chłodzenia wiechy ukryte w pochwie liściowej
dezynfekowano przez spryskanie 70% etanolem. Do kultury izolowano pylniki z
dolnych kwiatów kłoska, zawierające mikrospory w stadium średnio- i
późnojednojądrowym. Stadium rozwojowe mikrospor oznaczano na preparatach
gniecionych, barwionych acetokarminem. Ze względu na bardzo zróŜnicowany rozwój
kwiatów w wiesze, przy wyborze pylników kierowano się cechami skorelowanymi z
wybranym stadium, czyli długością pylników i ich wybarwieniem.
Pylniki wykładano do płytek Petriego (o średnicy 3 cm) zawierających 2,5 ml
poŜywki. W doświadczeniu zastosowano poŜywkę indukującą zalecaną przez KIVIHARJU
i in. [2005], bez Ficollu, zawierającą sole mineralne i witaminy jak w poŜywce W14
[OUYANG 1989 - cyt. za KIVIHARJU i in. 2005], 50 mg⋅dm-3 cysteiny, 500 mg⋅dm-3 inozytolu,
5 mg⋅dm-3 2,4-D, 0,5 mg⋅dm-3 BA, 10% maltozy oraz 0,3% Phytagelu. Wprowadzono 4
kombinacje tej poŜywki róŜniące się zawartością etefonu i soli miedzi: A - 20 mg⋅dm-3
etefonu, 0,025 mg⋅dm-3 CuSO4, B - bez etefonu, 0,025 mg⋅dm-3 CuSO4 , AC - 20
mg⋅dm-3 etefonu, 2,5 mg⋅dm-3 CuSO4, BC - bez etefonu, 2,5 mg⋅dm-3 CuSO4. Odmianę
Chwat badano we wszystkich kombinacjach poŜywki, pozostałe odmiany tylko na
poŜywkach AC i BC. W kaŜdej kombinacji wyłoŜono 360 pylników z odmiany,
powtórzenie stanowiło 6 płytek po 20 pylników. Z kaŜdej wiechy rozkładano
równomiernie pylniki na wszystkie poŜywki. Płytki umieszczono na 5 dni w
temperaturze 32°C (traktowanie wstępne), a następnie przeniesiono je do temperatury
25°C. Kulturę prowadzono w ciemności przez 8 tygodni. Powstałe w tym okresie
zarodki i kalusy, większe od 1,5 mm, przenoszono na poŜywkę regeneracyjną
zawierającą sole i witaminy jak w poŜywce W14, z dodatkiem 2 mg⋅dm-3 NAA, 0,5
mg⋅dm-3 KN, 2% sacharozy, 0,3% Phytagelu [KIVIHARJU i in. 2005]. Regenerację
prowadzono przez 4 tygodnie na świetle o natęŜeniu promieniowania ok. 100
µmol⋅m-2⋅s-1 , przy fotoperiodzie dzień/noc 16/8 godz. i temperaturze 25-26°C.
Po zakończeniu doświadczenia zestawiono dla odmian i kombinacji udział
PRÓBA INDUKCJI ANDROGENEZY U POLSKICH ODMIAN OWSA
139
reagujących pylników, liczbę zarodków i kalusów przeniesionych na poŜywkę regeneracyjną, liczbę roślin zielonych i albinotycznych. Przeprowadzono analizę
zmienności oraz obliczono błąd standardowy dla liczby zarodków i kalusów.
Wyniki i dyskusja
U dwóch odmian (Celer i Polar) nie obserwowano Ŝadnej reakcji na indukcję
androgenezy, u pozostałych odmian (Chwat, Cekin, Cwał) na pylnikach utworzyły się
zarodki i kalusy (tab. 1). Udział pylników reagujących na indukcję androgenezy był
niewielki i wahał się od 0,6% (Cekin) do 15,2% (Chwat), reszta pylników zamarła.
Zarodki i kalusy większe niŜ 1,5 mm, przeniesione na poŜywkę regeneracyjną równieŜ
zamierały, a tylko nieliczne z odmian Chwat i Cwał zregenerowały rośliny. Nie
zauwaŜono większych róŜnic pomiędzy materiałem odmiany Chwat pochodzącym z
pomieszczenia wegetacyjnego i zebranym z pola. Niewielka skuteczność
zastosowanych kombinacji i duŜa zmienność wyników uniemoŜliwiły wykazanie
istotnych róŜnic pomiędzy badanymi czynnikami i pozwoliły tylko na wskazanie
pewnych tendencji rzutujących na tok dalszych badań.
Tabela 1; Table 1
Indukcja androgenezy i regeneracja roślin w kulturze pylników owsa
(w przeliczeniu na 100 pylników)
Induction of androgenesis and plant regeneration in anther culture of oat
(per 100 anthers)
*
Odmiana
Cultivar
PoŜywka
Medium
Liczba pylników
reagujących
Reacting anthers
Liczba zarodków
i kalusów > 1,5 cm
No. embryos and calli
> 1.5 cm
(SE)
Liczba roślin
zielonych/
albinotycznych
No. of plants
green/albino
Chwat*
A
B
7,4
6,7
29,0 (15,74)
18,2 (8,01)
0
2,3/1,3
Chwat
A
B
AC
BC
9,6
11,0
15,2
14,2
32,9 (8,71)
25,4 (7,87)
29,9 (7,22)
41,3 (9,75)
0
0
0
2,2 /0,6
Cwał
AC
BC
3,7
4,5
10,5 (4,74)
18,7 (6,95)
1,9/0
1,1/0
Cekin
AC
BC
0
0,6
0
0,62 (0,15)
0
0
rośliny mateczne z pomieszczenia wegetacyjnego; donor plants from growth room
Z dwóch odmian, które regenerowały pędy, lepsze wyniki pod względem
wszystkich badanych parametrów otrzymano u odmiany Chwat. W badaniach
(niepublikowanych) nad androgenezą u owsa, prowadzonych w IHAR Radzików,
równieŜ wskazano na tę odmianę jako wyróŜniającą się zdolnością do regeneracji.
Mimo, Ŝe poŜywki indukujące nie zawierały Ficollu, liczba zregenerowanych roślin
była porównywalna z wynikami uzyskanymi przez autorów fińskich dla słabiej
regenerujących genotypów. Pozytywny wpływ Ficollu na rozwój zarodków i regenerację roślin został potwierdzony w wielu pracach nad androgenezą zbóŜ, począwszy
od badań KAO [1981]. Ze względu na wysoką cenę tego składnika Ŝelującego poŜywkę
jego szerokie zastosowanie w hodowli byłoby jednak zbyt kosztowne. Z tego powodu w
140
H. Kruczkowska, H. Pawłowska, B. Skucińska
doświadczeniu zastąpiono go Phytagelem. Wyniki osiągnięte u odmian Chwat i Cwał
pozwalają przypuszczać, Ŝe przy uŜyciu Ficollu wydajność androgenezy mogłaby być
wyŜsza.
Innym składnikiem poŜywki indukującej, który zwiększa udział reagujących
pylników oraz zregenerowanych roślin, moŜe być siarczan miedzi uŜyty w zwielokrotnionym stęŜeniu w porównaniu z ilością standardową stosowaną w poŜywkach
[WOJNAROWIEZ i in. 2002]. U badanych odmian w kombinacji ze stukrotnie zwiększonym
stęŜeniem CuSO4, lecz bez etefonu (kombinacja BC), obserwowano wyraźnie większą
zdolność do tworzenia zarodków i kalusów niŜ z dodatkiem etefonu (kombinacja AC).
Etefon dodany do poŜywki indukującej przy standardowym poziomie miedzi wpłynął
równieŜ pozytywnie na powstanie tych struktur (kombinacja A). Regeneracja roślin u
odmiany Chwat wystąpiła tylko w kombinacjach bez egzogennego etylenu (kombinacja
B i BC). Taka reakcja na dodatkowe źródło etylenu moŜe znaleźć wyjaśnienie w
literaturze, która wskazuje na genotypowe róŜnice w wytwarzaniu endogennego etylenu
przez pylniki oraz odmienne zapotrzebowanie tego hormonu w procesie indukcji
androgenezy i procesie regeneracji roślin [PUA 1999].
Wnioski
1.
W kulturze pylników pięciu polskich odmian owsa (Chwat, Celer, Cekin, Cwał,
Polar) uzyskano regenerację u odmian Chwat i Cwał: 1,1-3,6 roślin ogółem, w
tym 1,1-2,3 roślin zielonych w przeliczeniu na 100 pylników wyłoŜonych na
poŜywkę (w poŜywce indukującej nie stosowano Ficollu).
2.
Zaobserwowano, Ŝe stukrotne zwiększenie stęŜenia CuSO4 w poŜywce indukującej lub dodatek etefonu przyczyniły się do zwiększenia liczby zarodków i
kalusów utworzonych na pylnikach. Równoczesne zastosowanie obu tych
składników było mniej skuteczne.
3.
U odmiany Chwat bardziej korzystne dla regeneracji roślin były kombinacje
poŜywki indukującej bez etefonu.
Literatura
KAO K.N. 1981. Plant formation from barley anther cultures with Ficoll media.
Z. Pflanzenphysiol. 103: 437-443.
KIVIHARJU E., PEHU E. 1998. The effect of cold and heat pretreatments on anther culture
response of Avena sativa and Avena sterilis. Plant Cell Tiss. Organ Cult. 54: 97-104.
KIVIHARJU E., PUOLIMATKA M., SAASTAMOINEN M., HOVINEN S., PEHU E. 1998. The effect of
genotype on anther culture response of cultivated and wild oats. Agric. Food Sci. Finl.
7: 409-422.
KIVIHARJU E., TAURIAINEN A. 1999. 2,4-dichlorophenoxyacetic acid and kinetin in anther
culture of cultivated and wild oats and their interspecific crosses : plant regeneration
from Avena sativa L. Plant Cell Rep. 18: 582-588.
KIVIHARJU E., PUOLIMATKA M., SAASTAMOINEN M., PEHU E. 2000. Extension of anther
culture to several genotypes of cultivated oats. Plant Cell Rep. 19: 674-679.
KIVIHARJU E., MOISANDER S., LAURILA J. 2005. Improved green plant regeneration rates
from oat anther culture and the agronomic performance of some DH lines. Plant Cell
PRÓBA INDUKCJI ANDROGENEZY U POLSKICH ODMIAN OWSA
141
Tiss. Organ Cult. 81: 1-9.
PUA E.C. 1999. Morphogenesis in cell and tissue cultures: role of ethylene and polyamines, w: Morphogenesis in Plant Tissue Cultures. Soh W.Y., Bhojwani S.S. (Red.).
Kluwer, Dordrecht: 255-303.
RINES H.W. 1983. Oat anther culture: genotype effects on callus initiation and the
production of a haploid plant. Crop Sci. 23: 268-272.
RINES H.W., DAHLEEN L.S. 1990. Haploid oat plants produced by application of maize
pollen to emasculated oat florets. Crop Sci. 30: 1073-1078.
RINES H.W., RIERA-LIZARAZU O., NUNEZ V.M., DAVIS D.W., PHILLIPS R.L. 1997. Oat haploids from anther culture and from wide hybridizations, w: In vitro Haploid Production in
Higher Plants. Jain SM., Sopory SK., Veilleux RE. (Red.), Kluwer, Dordrecht 4:
205-221.
SIDHU P.K., HOWES N.K., AUNG T., ZWER P.K., DAVIES P.A. 2006. Factors affecting oat
haploid production following oat x maize hybridization. Plant Breed. 125: 243-247.
WOJNAROWIEZ G., JACQUARD C., DEVAUX P., SANGWAN R.S., CLÉMENT C. 2002. Influence of
copper sulfate on anther culture in barley (Hordeum vulgare L.). Plant Sci. 162:
843-847.
Słowa kluczowe:
owies zwyczajny, androgeneza, stęŜenie siarczanu miedzi, etylen
Streszczenie
W kulturze pylników badano zdolność do androgenezy pięciu polskich odmian
owsa. Zastosowano poŜywki zalecane przez KIVIHARJU i in. [2005], lecz bez Ficollu.
Wprowadzono róŜne kombinacje poŜywek róŜniące się stęŜeniem siarczanu miedzi i
etefonu. Regenerację uzyskano u odmian Chwat i Cwał: 1,1-3,6 roślin ogółem na 100
pylników wyłoŜonych na poŜywkę. Stukrotne zwiększenie stęŜenia CuSO4 lub dodatek
etefonu w poŜywce indukującej sprzyjały zwiększeniu liczby zarodków i kalusów.
Równoczesne wprowadzenie etefonu i podwyŜszenie stęŜenia miedzi w poŜywce było
mniej korzystne. Odmiana Chwat, która okazała większą wydajność androgenezy niŜ
odmiana Cwał, regenerowała rośliny jeśli pylniki wyłoŜono na poŜywki bez etefonu.
ATTEMPT AT INDUCTION OF ANDROGENESIS
IN THE POLISH OAT CULTIVARS
Hanna Kruczkowska, Helena Pawłowska, Barbara Skucińska
Department of Plant Breeding and Seed Science,
Agricultural University, Kraków
Key words:
oat, androgenesis, concentration of copper sulfate, ethylene
Summary
The experiment tested the potential for androgenesis in five Polish oat cultivars in
anther culture. The various combinations, used in the experiment on the medium
recommended by KIVIHARJU et al. [2005], though without Ficoll, varied in their
concentration of copper sulfate and Ethephon. Regeneration was obtained in Chwat and
Cwał cvs: 1.1-3.6 plants per 100 anthers. A hundredfold increase in CuSO4
concentration or an addition of Ethephon into the induction medium resulted in an
increased number of embryos and calli. However, an addition of Ethephon accompanied
142
H. Kruczkowska, H. Pawłowska, B. Skucińska
by a simultaneous increase in the copper concentration in the medium was less
favorable. Chwat cv. which showed greater efficiency of androgenesis than Cwał cv.,
regenerated plants better when its anthers were placed on the medium without
Ethephon.
Dr inŜ. Hanna Kruczkowska
Katedra Hodowli Roślin i Nasiennictwa
Akademia Rolnicza im. H. Kołłątaja
ul. Łobzowska 24
31-140 KRAKÓW
e-mail: [email protected]
ZESZYTY PROBLEMOWE POSTĘPÓW NAUK ROLNICZYCH 2007 z. 523: 143-154
INTERACTION BETWEEN TEMPERATURE
AND SUCROSE CONTENT DURING GROWTH
AND DIFFERENTIATION OF WHEAT (Triticum aestivum L.)
CELL SUSPENSION
Izabela Marcińska, Jolanta Biesaga-Kościelniak, Maria Filek, Marta Pilipowicz,
ElŜbieta Niemczyk
Institute of Plant Physiology of Polish Academy of Sciences, Kraków
Introduction
Our studies are devoted to searching for the optimal conditions of a long-term
embryogenic suspension culture of wheat. Suspension culture provides an ideal object
for protoplast and microprojectile-based transformation system because of their
homogeneity and small cell cluster size. The limitation of suspension culture and
protoplasts methods in wheat is the lack of real plant regeneration. VASIL et al. [1990]
suggest that in the case of Graminae only totipotent suspension culture can be a source
of cell colonies, producing somatic embryos and plants. PAVLOVA and KORDYUM [1996]
demonstrated morphology of a totipotent Lolium multiflorum suspension culture. Cells
in 20-30 µm2 of size, single or assembled in small aggregates were of meristematic
type. They had isodiametric shape, dense cytoplasm and a large nucleus. They were
totipotent and potentially capable of further somatic embryogenesis. The other cells
growing by elongation were 120-150 µm in size with large vacuoles. To maintain
regeneration potential of wheat cells, many approaches were employed such as the low
temperature treatment and optimal concentration of sucrose in the medium.
It is known recognized that low temperature induces environmental stress,
changes in cell metabolism and the uptake of nutrients in in vitro cultures. HOU et al.
[1997] showed that a treatment at 5°C which sometime significantly improved the
regeneration frequency of callus from immature inflorescence of wheat although the
callus induction was decreased. The preservation of callus tissue at a low temperature
was used as a method developed to maintain plant regeneration activity of rice cells
[TSUGAWA, SUZUKI 2000]. The preservation of rice callus at 5°C for 8 months caused cell
damage, but some surviving cells divided in the suspension culture and eventually
regenerated the whole plants. In winter wheat callus 7 days after its transfer to 4°C, the
accumulation of proteins was greater than in the control maintained at 20°C
[KARIMZADEH et al. 2000]. Cell area was significantly smaller in cooled tissue in
comparison to those maintained at 20°C. In winter rape cell suspension the cold
treatment arrested the growth of cells and prevented the exhaustion of carbohydrates
from cells [EGIERSZDORFF, KACPERSKA 2001].
Sucrose is necessary for cell growth and conditions the properties of culture
medium. It plays the basic role as an energy source and as the osmoregulatory factor in
144
I. Marcińska et al.
the heterotrofic cell suspension culture. In most cases 3% of sucrose in a medium is
applied, however, higher concentrations were also tested [FELLERS et al. 1995;
ANBAZHAGAN, GANAPATHI 1999]. After the addition of the fresh medium to cell suspension
culture, sucrose is rapidly hydrolysed to glucose and fructose [BOTHA, O’KENNEDY 1998].
Glucose is preferentially taken up, leading to the accumulation of fructose in the
medium. EBRAHIM et al. [1999] reported that the hexose uptake systems (for glucose and
fructose) of sugarcane cell suspension culture were strongly inhibited at a low
temperature. In our earlier studies it was shown that the tendency in the change of
sugars in the medium measured during the 17-day period of wheat cell suspension
culture was similar for cells, derived both from the immature embryo and inflorescence
[MARCIŃSKA et al. 2000]. The rate of cell growth and division, however, was higher for
inflorescence. It was demonstrated that changes in the sugar level are involved in cell
metabolism and can inform about physiological state of the tissue.
The aim of the present investigation was to compare the carbohydrate uptake
from a medium during the growth and differentiation of the wheat (Triticum eastivum
L.) cell suspension culture influenced by a low temperature pre-treatment and higher
than standard content of sucrose in the medium or both. Moreover, on the basis of
growth kinetics and morphology of cells, the interaction of both factors was evaluated.
Material and methods
Callus culture
Callus derived from immature inflorescence (5-10 mm long - Fig. 1a) of winter
wheat (Triticum aestivum L.) cv. Almari was prepared according to the method
previously described [MARCIŃSKA et al. 2001]. The incubation temperature was
maintained at 26±2°C in darkness. A subculture of callus cultures was made at two
week intervals. After eight weeks of culture the callus structure was friable and nodular
(Fig. 1b).
Suspension culture
Cell suspension cultures were developed by inoculating 1.5 g of the callus in the
300 cm3 Erlenmeyer flasks, containing 100 cm3 of a liquid MS2 medium [MURASHIGE,
SKOOG 1962]. It was supplemented with an original set of vitamins and 2 mg glycine, 100
mg inositol, 2 mg 2,4-D and 30 g of sucrose per 1 dm3, at pH 5.8. Flasks were
maintained on a gyratory shaker, at 60 cpm at 26°C, under 16 h-photoperiod and weak
illumination under Philips TL MF 140 Wat/33RS lamp. The cultures were passaged
every two weeks by changing 25 cm3 of the incubation medium for the fresh one of the
same composition. After 6 weeks of culture, the content of every flask was divided into
two portions and placed into new two flasks. One of them was supplemented with the
same medium (3% sucrose - standard medium) and the other one with medium
containing higher (6%) concentration of sucrose (the final the concentration in the flask
was 4.5% of sucrose). Half of the flasks (in 4 replicates), containing two various
concentrations of sugar were transferred to 6°C for 7 days and then to 10°C for the next
7 days. Flasks containing the tested suspensions, were transferred back to 26°C after
that treatment. The other ones were cultured continuously at 26°C. The control suspension contained the standard MS2 medium. Before the start of growth kinetics testing, as
a consequent effect of the earlier pre-treatment, all objects were passaged on the
standard medium, containing only 3% of sucrose. During 15 days of culture the flasks
INTERACTION BETWEEN TEMPERATURE AND SUCROSE CONTENT ...
145
were maintained continuously at 26°C and 16 h photoperiod. First measurements were
taken directly after passage, it was signed as the day 0.
Fig. 1.
(a) Immature inflorescence of wheat cv. Almari, used as an explant, magnification
12X; (b) 8-weeks old callus tissue, as a source of cell suspension culture,
magnification 12X; (c) cells in suspension in different size: E - small, embryogenic,
NE - elongated, non-embryogenic, magnification 100X; (d) pro-embryogenic
aggregates in suspension culture, consisted of small cells, coloured by DAPI (4,6diamidino-2-fenyloindol), magnification 100X
Rys. 1.(a) Niedojrzały kwiatostan pszenicy odm. Almari uŜyty jako explantat, powiększenie 12
razy. (b) 8-tygodniowy kalus, jako źródło zawiesiny komórkowej, powiększenie 12
razy, (c) komórki róŜnych rozmiarów w zawiesinie: E - małe, embriogenne, NE wydłuŜone, nie embriogenne, powiększenie 100 razy, (d) pro-embriogenne agregaty
w kulturze zawiesiny, składające się z małych komórek, wybarwione DAPI (4,6diamidino-2-fenyloindol), powiększenie 100 razy
Analytical procedure
Every 2-3 days over the 15-day period of the culture, the number of cells and dry
mass of suspension were determined, using 4 separate flasks as replicates. Both
parameters of the suspension were determined in 10 cm3 samples, taken out from each
flask on the day of measurement (7 terms of measurements), using sterile, wide cut
pipettes, collecting possibly homogenous portions. Cells number was calculated under a
reversed Olympus microscope at 100-fold magnification (Fig. 1c), in a determined
volume of Burker chamber. Simultaneously the viability of cells was determined. The
cells were incubated for 10 min in water solution containing 25% (w/v) of Evans Blue.
Only the dead cells were coloured dark blue. This colouring substance was not
infiltrated though a membrane of live cells. Portions of 10 cm3 of the suspension were
filtered on discs of blotting paper, weighed, rinsed twice with distilled water and then
the dry mass (DM) was determined after drying the disks with cells at 60°C for 24
I. Marcińska et al.
146
hours.
Using the computer Lucia G/Comet-program, version 3.52a, the differences in
cell morphology were evaluated. For four different analytical conditions, two criteria:
cell profile area, as the most principal size, and cell circularity, as useful parameter for
the shape characteristics were taken for account. Circularity was calculated from the cell
cross-section area and perimeter:
4π ⋅ area
Circularity = -----------perimeter2
Circularity is 1 only for circles, all other shapes are characterised by a lower
circularity with circularity close to 1. Differentiated cells of wheat callus are usually
small, isodiametric in shape, similar to a circle.
To determine the changes in morphology of cells in the suspension, influenced by
3 and 4.5% sucrose content in the medium and low temperature pre-treatment, the
sucrose and hexose (glucose and fructose) contents in the medium were determined.
The analysis of carbohydrate content was conducted in a Hewlett-Packard gas
chromatograph 5890 series II, with capillary column DB-170 : 1 = 15 m; ID = 0.250
mm; detector FID: temp. 150-220°C. The medium, as a supernatant of centrifuged (200
g) cell suspension was transferred into vials (50 µl) evaporated under nitrogen and then
mixed with 950 µl of silyating reagent TRI-SIL, containing: HMDS
(hexamethyldisilarone), TMCS (trimethylchlorosilslone) and pyridine (PIR) in the ratio
v:v:v 2 : 1 : 10. ISTD (metyloglucopiranoside) as the internal standard. Prepared
samples were kept at a room temperature for 30 min. After that time they were
centrifuged at 400 g for 10 min. Chromatographic analysis were done by the injection of
1 µl sample to the column. All data presented in figures are the mean values with the
standard errors.
All data were subjected to statistical analysis using the Statistica programme,
version 7.0
Results and discussion
Both tested factors, the short-term presence of a higher amount of sucrose in the
medium and pre-treatment at low temperature had a significant effect (p = 0.01) on the
most of the measured cell suspension parameters (Figs 2-4). It was: percentage increase
of the number of cells, their dry mass, cell cross-section area, circularity of cells and
concentration of sugars in the medium. Both pre-treatments caused a consequent
influence on cell suspension growth kinetics.
3% sucrose; sacharoza, 26 oC
1000
800
600
600
%
800
%
4.5% sucrose ; sacharoza, 26 oC
1000
400
400
200
200
0
0
0
0
2
4
7
11
18
days of culture; dni kultury
3% sucrose; sacharoza, 6 oC
1000
4.5% s ucrose; s acharoza, 6 oC
1000
800
600
600
%
%
800
2
4
7
11
18
days of culture ; dni k ultury
400
400
200
200
0
0
0
2
4
7
11
18
days of culture; dni kultury
0
2
4
7
11
18
days of culture ; dni k ultury
INTERACTION BETWEEN TEMPERATURE AND SUCROSE CONTENT ...
Fig. 2.
147
Effect of temperature pre-treatment (26 and 6°C) and sucrose concentration in
medium (3 and 4.5%) on growth kinetics during 15 days of culture in winter wheat
cv. Almari cell suspension culture. Curves representing percentage increase of
number of cells (--) and their dry mass (--). Means from 4 replicates ± standard
errors
Rys. 2.Wpływ wstępnego traktowania temperaturą (26 i 6°C) i stęŜenia sacharozy w poŜywce (3 i
4,5%) na kinetykę wzrostu w czasie 15 dni kultury zawiesiny komórkowej pszenicy
ozimej odm. Almaro. Krzywe reprezentują procentowy przyrost liczby komórek
(--) i ich suchej masy (--). Średnie pochodzą z 4 powtórzeń ± błąd stanadardowy
Effect on growth kinetics
The growth profiles presented in Fig. 2 show that the wheat cell growth depends
significantly on the culture conditions. The cultures exhibited a lag phase of
approximately 4 days before the cell density started to increase. The stationary phase of
growth was reached between 11-15 days of culture. The viability of cells was similar
and unaffected by both treatments (data not shown). Low temperature treatment twice
decreased dry mass production and 1.5-fold number of cells, especially after 7th day of
culture. It is in agreement with the results obtained by HOU et al. [1997] in the callus
culture of wheat and it was probably due to a limited carbohydrate supply from the
medium. The results suggest that a low temperature was unfavourable for growth
kinetics in wheat culture, however, it stimulated the metabolism of cells, which revealed
the improvement of the differentiation of cells. The direction of changes in the growth
rate were similar regardless the sucrose concentration. The most visible differences
between two treatments were noticed between 4th to 11th day after passage. The higher
amount of sucrose in the medium enhanced the lower cell biomass production in the
culture treated by a low temperature (object: 4.5% sucrose, 6°C). The present results are
in accordance with findings by ANBAZHAGAN, GANAPATTI [1999] and FELLERS et al. [1995],
when doubled concentration of sucrose lowers the rate of cell proliferation that results
from a lowered production of biomass.
4.5% sucrose; sacharoza, 26 oC
3% sucrose; sacharoza, 26 oC
cell's parameter;
700
600
500
400
300
parametr komórek
cell's parameter;
parametr komórek
700
200
600
500
400
300
200
0
2
4
7
11
18
days of culture; dni kultury
0
2
4
7
11
18
days of culture; dni kultury
3% sucrose; sacharoza, 6 oC
4.5% sucrose; sacharoza, 6 oC
700
cell's parameter;
600
500
400
300
parametr komórek
cell's parameter;
parametr komórek
700
600
500
400
300
200
200
0
2
4
7
11
18
days of culture; dni kultury
0
2
4
7
11
18
days of culture; dni kultury
I. Marcińska et al.
148
Fig. 3.
Effect of temperature pre-treatment (26 and 6°C) and sucrose concentration in
medium (3 and 4.5%) on cell’s morphology during 15 days of culture in winter wheat
cv. Almari cell suspension culture. Curves representing morphology of cells: section
area (--) and circularity (--). Means from 4 replicates ± standard errors. Units of:
section area (y⋅10-1), circularity (y⋅10-3)
Rys. 3.Wpływ wstępnego traktowania temperaturą (26 i 6°C) i stęŜena sacharozy w poŜywce (3 i
4,5%) na kinetykę wzrostu w czasie 15 dni kultury zawiesiny komórkowej pszenicy
ozimej odm. Almari. Krzywe reprezentują morfologię komórek: powierzchnia ich
przekroju (--) i sferyczność (--). Średnie pochodzą z 4 powtórzeń ± błąd
standardowy. Jednostki naleŜy pomnoŜyć: powierzchnia przekroju (y⋅10-1),
sferyczność (y⋅10-3)
3% s ucros e ; s acharoza, 26 oC
600
400
4.5% s ucr os e ; s achar oza, 26 oC
800
[mg/dm3]
[mg/dm3]
800
600
400
200
200
0
0
0
2
4
7
11
18
days of cultur e ; dni k ultury
0
4.5% s ucr os e ; s achar oza, 6 oC
3% s ucr os e ; s achar oza, 6 oC
800
800
[mg/dm3]
[mg/dm3]
2
4
7
11
18
days of cultur e ; dni k ultur y
600
400
200
600
400
200
0
0
0
2
4
7
11
18
days of cultur e ; dni k ultury
0
2
4
7
11
18
days of cultur e ; dni k ultur y
INTERACTION BETWEEN TEMPERATURE AND SUCROSE CONTENT ...
Fig. 4.
149
Effect of temperature pre-treatment (26 and 6°C) and sucrose concentration in
medium (3 and 4.5%) on carbohydrates uptake (sucrose, glucose and fructose) during
15 days of culture in winter wheat cv. Almari cell suspension culture. Curves
representing: concentration (mg⋅dm-3) of: sucrose (--), glucose (--) and fructose
(--). Means from 4 replicates ± standard errors
Rys. 4.Wpływ wstępnego traktowania temperaturą (26 i 6°C) i stęŜena sacharozy w poŜywce (3 i
4,5%) na pobieranie węglowodanów (sacharoza, glukoza i fruktoza) w czasie 15 dni
kultury zawiesiny komórkowej pszenicy ozimej odm. Almari. Krzywe reprezentują
stęŜenie (mg⋅dm-3): sacharozy (--), glukozy (--) i fruktozy (--). Średnie pochodzą z 4 powtórzeń ± błąd standardowy
Effect on cell morphology
We suggest that embryogenic culture should comprise small cells, isodiametric,
of a sphere-like shape. It was in agreement with PAVLOVA, KORDYUM [1996]. The
stimulatory effect of low temperature treatment and increased concentration of sucrose
could be visible as a decrease of cell area and increase of their circularity, towards the
value of 1.0. In Fig. 1c small, embryogenic (E) and elongated, non-embryogenic cells
(NE) are visible. The low temperature treatment of cultures, independently of sucrose
concentration in the medium, caused the decrease of cell area (Fig. 3). The similar effect
was observed in the studies on winter rape performed by EGIERSZDORFF and KACPERSKA
[2001]. Also KARIMZADEH et al. [2000] reported that cell area of winter wheat was smaller
in tissues that were treated by low temperature as compared to that in the control. Cells
of these tissues accumulated a higher amount of proteins. In our experiment the highest
decrease of cell area was observed on 7th day of culture, when the proliferation of cells
was the faster (Fig. 2 and 3). During that time the cell area assigned 27-35 µm2 and their
circularity was about 0.6. Between 11th and 15th day of culture cell area was at the
similar level that on the 7th day, however, circularity slightly decreased. At this time,
number of cells in the cell suspension culture treated by a low temperature in
comparison to 26°C, increased 5.6 and 3.7-fold for cultures grown in the medium
containing 3 and 6% of sucrose, respectively. For the suspension treated as control (3%
sucrose, 26°C), the decrease of cell area in value 32-34 µm2, was assigned on 4th day of
culture. It was earlier than for the remaining objects, when it took place on 7th day (Fig.
3). During further culture, at 26°C, with 3 and 4.5% of sucrose, the area of cells
increased up to 1.7 and 1.2-fold, respectively, as compared to cells treated with low
temperature. While on 15th day of culture cell area increased for 3% sucrose and 6°C, a
decrease was observed again for 4.5% sucrose at 6°C. TSUGAVA and SUZUKI [2000],
observed a high frequency of plant regeneration from the suspension cultured rice cells
after preservation of callus tissue at a low temperature. Probably a low temperature
acted as stress in the culture and mobilised the metabolic activity of cells. In our
experiment, a higher concentration of sucrose in the medium stimulated the
differentiation of cells in a stationary phase of culture (less cell area and higher
circularity) even after the not optimal temperature growth conditions. Similarly, FELLERS
at al. [1995], reported that in a suspension culture of wheat, a greater number of
regenerated plants was obtained when a callus, as a source of cell suspension, was
grown on 6% of sucrose in the medium.
Effect on carbohydrates uptake
It was noticed for all cultures, that sucrose hydrolysed to glucose and fructose
150
I. Marcińska et al.
already on 2nd day of culture. The same results were obtained in our previous studies
[MARCIŃSKA et al. 2000]. Similarly to that, in the cell suspension culture of Phaseolus
vulgaris [BOTHA, O’KENNEDY 1998], the observed sucrose hydrolysis was probably
facilitated by an initial decrease in external pH which would ensure the optimum
activity of the exogenous acid invertase. The supplement of media with 3% of sucrose
during the last passage (day 0), caused a slight, 1.2-fold increase of it in the medium
(Fig. 4). At that time, dependently of treatment, it was noticed also different
concentration of glucose and fructose, as a product of very quick sucrose hydrolysis.
The cells take up glucose more rapidly from a medium containing both glucose and
fructose. It was probably the result of kinetic properties of the membrane transport. For
cultures maintained at 26 and 6°C, supplemented with 4.5% of sucrose in the media, 2.8
and 2.0-fold greater amount of glucose and fructose, was observed, respectively in
comparison to media containing 3% of sucrose. In cultures pre-treated with low
temperature the increase of both hexoses was smaller, it was 1.3-fold, independently of
the sucrose concentration. Higher concentration of hexoses after sucrose hydrolysis in
the medium was observed in cultures treated with low temperature. A treatment with
3% sucrose and 6°C and the maximum amount of glucose and fructose was 2.5 and 1.3fold greater, respectively, as compared to 3% sucrose and 26°C. It was assigned on 2nd
day of culture. For treatment with 4.5% of sucrose and 6°C, the maximum took place
later on 4th day of culture, it was 1.5 and 1.3-fold greater than for glucose and fructose
than at 26°C. The treatment with 4.5% sucrose and 26°C caused 1.6 and 1.9-fold
increase of glucose and fructose, respectively, the maximum value. After 6°C treatment
that increase was lower. It was 1.3 and 1.1-fold for glucose and fructose. Standard
concentration of sucrose (3%) caused a more intensive uptake of hexoses from the
medium as compared to its higher amount (4.5%). In the control, the entire uptake of
hexoses was observed on 11th day. Pre-treatment with higher amount of sucrose and
26°C slowed down the uptake of sugars. A low temperature inhibited the uptake of
sugars in media containing 3% or 4.5% of sucrose. The effect of pre-treatment with low
temperature and higher concentration of sucrose together provided a summarised
inhibition of uptake of sugars till 4th day of culture. After that time the cells started to
uptake hexoses, especially glucose. On the 15th day of culture, when the cells reached
the stationary phase, the uptake was stopped and even slightly decreased (Fig. 4). In the
studies by EBRAHIM et al. [1999], it was found that hexose uptake systems (for glucose
and fructose) of sugarcane suspension cells were also strongly inhibited at a low
temperature.
Conclusions
Taking the cell suspension growth kinetics for glucose and fructose into account,
it is very difficult to explain why the cells took up so little sugar during the first few
days of culture. From day 0 onwards the concentration of glucose and fructose exceeded
that required for ful saturation the of active transport through membrane and soon
reached a level where the diffusion-like uptake took place. A possible explanation is
that there was a very low metabolic activity/demand for hexoses, or that the uptake
system was only induced after the cell growth and the division had been initiated. It is
interesting to note that pre-treatment with a low temperature and higher than standard
concentration of sucrose in the medium, stimulated proliferation and differentiation of
cells during culture. It was revealed as the changes of cells morphology. Cells reached
INTERACTION BETWEEN TEMPERATURE AND SUCROSE CONTENT ...
151
meristematic-like shape, which is the base of totipotent cell culture character. The
interaction of low temperature and high concentration of sucrose pre-treatment could be
the method to culture cell suspension for a long time. Unfavourable low temperature
conditions could be alleviated by a higher amount of sugars in the medium. Its leads to
accelerating the hexoses uptake by cells in the culture.
References
ANBAZHAGAN V.R., GANAPATHI A. 1999. Somatic embryogenesis in cell suspension cul-
tures of pigeonpea (Cajanus cajan). Plant Cell Tiss. Org. Cult. 56: 179-184.
BOTHA F.C., O’KENNEDY M.M. 1998. Carbohydrate utilisation by cell suspension cultures
of phaseolus vulgaris. Physiol. Plant. 102: 429-436.
EBRAHIM M.K.H., ZINGSHEIM O., VEITH R., ABOKASSEM E.E.M., KOMOR E. 1999. Sugar
uptake and storage by sugarcane suspension cells at different temperatures and high
sugar concentrations. J. Plant Physiol. 154: 610-616.
EGIERSZDORFF S., KACPERSKA A. 2001. Low temperature effects on growth and actin
cytoskeleton organisation in suspension cells of winter oilseed rape. Plant Cell Tiss.
Org. Cult. 65: 149-158.
FELLERS J.P., GUENZI A.C., TALIAFERRO C.M. 1995. Factors affecting the establishment of
embryogenic callus and suspension cultures of wheat (Triticum aestivum L). Plant Cell
Rep. 231-237.
HOU B., YU H., TENG S. 1997. Effects of low temperature on induction and differentiation
of wheat calluses. Plant Cell Tiss. Org. Cult. 49: 35-38.
KARIMZADEH G., FRANCIS D., DAVIES S. 2000. Low temperature-induced accumulation of
protein is sustained both in root meristems and in callus in winter wheat but not in
spring wheat. Annals of Bot. 85: 769-777.
MARCIŃSKA I., FILEK M., BIESAGA-KOŚCIELNIAK J., NIEMCZYK E., SAGI F. 2000. Changes of
carbohydrates level of cell suspension culture derived from immature embryo and
inflorescence of wheat (Triticum aestivum L.). Plant Physiol. and Bioch. 38: sup. 32.
MARCIŃSKA I., SZECHYŃSKA M., BIESAGA-KOŚCIELNIAK J., FILEK M. 2001. Applicability of
Polish winter wheat (Triticum aestivum L.) cultivars to long-term in vitro culture. Cer.
Res. Comm. 29: 127-134.
MURASHIGE T., SKOOG F. 1962. A revised medium for rapid growth and bioassay with
tobaco tissue culture. Physiol. Plant. 15: 473-497.
PAVLOVA M., KORDYUM E. 1996. Somatic embryogenesis in Lolium multiflorum suspension culture. Acta Soc. Bot. Pol. 65: 43-45.
TSUGAWA H., SUZUKI M. 2000. A low temperature method for maintaining plant regeneration activity in embryogenic callus of rice (Oryza sativa L.). Plant Cell Rep. 19:
371-375.
VASIL V., REDVAY F., VASIL I.K. 1990. Regeneration of plants from embryogenic suspension culture protoplasts of wheat (Triticum aestivum L.). Biotechnology 8: 429-434.
Key words:
carbohydrates, cell morphology, low temperature, suspension, wheat
I. Marcińska et al.
152
Summary
Wheat Triticum aestivum L. cell suspension cultures of were used to investigate
the effect of a low temperature and the higher than standard sucrose concentration pretreatments on carbohydrate (sucrose, fructose and glucose) contents in medium as a
result of changed growth kinetics of cells and their morphology. Two month-old cell
suspensions, maintained at 26°C and supplemented with 3 or 4.5% sucrose, were
transferred to 6-10°C for 14 days before returning to 26°C. The data obtained were
calculated as a result of interaction between a short-term low temperature and higher
then standard concentration of sucrose in the medium pre-treatment in the cell
suspension culture. Low temperature and a higher sucrose concentration in the growth
medium slowed down the percentage increase of the cell number and dry mass of
suspension culture. A slower uptake of fructose and glucose was accompanied by this
effect. It was found, however, that a low temperature improved the differentiation
frequency of cells, revealed as a decrease of their area and the increase of circularity of
individual cells. A higher sucrose concentration in the medium protected cells against
the disadvantageous causing stress low temperature treatment. It makes possible to
maintain cells in the suspension culture for a long time and to preserve cells as a bank
for using them in further studies.
WSPÓŁDZIAŁANIE NISKIEJ TEMPERATURY
I STRESU OSMOTYCZNEGO W CZASIE WZROSTU
I RÓśNICOWANIA ZAWIESINY KOMÓRKOWEJ
PSZENICY (Triticum aestivum L.)
Izabela Marcińska, Jolanta Biesaga-Kościelniak, Maria Filek,
Marta Pilipowicz, ElŜbieta Niemczyk
Instytut Fizjologii Roślin
im. F. Górskiego Polskiej Akademii Nauk, Kraków
Słowa kluczowe:
morfologia komórki, niska temperatura, pszenica, węglowodany,
zawiesina komórkowa
Streszczenie
Badano efekt współdziałania niskiej temperatury i podwyŜszonego stęŜenia
sacharozy na wzrost i róŜnicowanie zawiesiny komórkowej pszenicy ozimej (Triticum
aestivum L.). Określano morfologię komórek zawiesiny i zawartość węglowodanów
(sacharoza, glukoza i fruktoza) w 18 dniowym cyklu hodowlanym, jako następczy efekt
okresowego traktowania chłodem w obecności wyŜszego stęŜenia sacharozy. Do badań
wykorzystano 2-miesięczną zawiesinę komórkową pszenicy odm. Almari. Zawiesinę
komórkową, hodowaną w temp. 26°C, w ciemności, w płynnej poŜywce wg MURASHIGE
i SKOOG [1962] zawierającej 3 lub 4,5% sacharozy, przenoszono na okres 14 dni do
warunków chłodu, czyli 6-10°C, a następnie ponownie do temperatury 26°C. Wyniki
obserwacji odnoszono do współdziałania obu zastosowanych czynników. Okresowe
przetrzymywanie zawiesiny komórkowej w warunkach niskiej temperatury i
podwyŜszonego, w stosunku do standardowego, stęŜenia sacharozy w poŜywce
INTERACTION BETWEEN TEMPERATURE AND SUCROSE CONTENT ...
153
zmniejszało gęstość i suchą masę zawiesiny komórkowej. W czasie dalszej kultury
towarzyszyło temu spowolnione pobieranie fruktozy i glukozy z poŜywki. JednakŜe
niska temperatura powodowała stymulację róŜnicowania komórek, co objawiało się
obniŜaniem się powierzchni przekroju i większą sferycznością pojedynczych komórek.
WyŜsze stęŜenie sacharozy w poŜywce stanowiło takŜe barierę ochronną dla komórek
przebywających w niskiej temperaturze. Stwarza to moŜliwość do przetrzymywania
kultury zawiesiny komórkowej w niskiej temperaturze przez dłuŜszy okres czasu i
wykorzystania takiej kultury jako banku komórek do dalszych badań.
Doc. dr hab. Izabela Marcińska
Zakład Biotechnologii
Instytut Fizjologii Roślin im. F. Górskiego
Polska Akademia Nauk
ul. Niezapominajek 21
30-239 KRAKÓW
ZESZYTY PROBLEMOWE POSTĘPÓW NAUK ROLNICZYCH 2007 z. 523: 155-161
WPŁYW KWASU ABSCYSYNOWEGO ORAZ ŚWIATŁA NA
WZROST I ROZWÓJ ZARODKÓW SOMATYCZNYCH
TULIPANA (Tulipa gesneriana L.)
Małgorzata Maślanka, Anna Bach
Katedra Roślin Ozdobnych, Akademia Rolnicza im. H. Kołłątaja w Krakowie
Wstęp
Tulipany naleŜą do waŜnych gospodarczo ozdobnych roślin cebulowych. Swoją
popularność zawdzięczają walorom dekoracyjnym oraz wszechstronnością
zastosowania. Rośliny te odznaczają się niskim współczynnikiem rozmnaŜania, dlatego
wciąŜ poszukuje się nowych, wydajnych metod ich otrzymywania, a tym samym
obniŜenia kosztów uprawy. Tradycyjny wegetatywny sposób rozmnaŜania tulipanów to
bardzo powolny proces, a wprowadzenie nowej odmiany do produkcji zajmuje 25 lat
[DE HERTOGH, LE NARD 1993]. Kultury in vitro poprzez procesy organogenezy oraz
somatycznej embriogenezy stwarzają moŜliwość znacznego skrócenia tego okresu
[GUDE, DIJKEMA 1997]. Opracowane do tej pory metody somatycznej embriogenezy nie
pozwalają na pozyskiwanie zarodków o zadowalającej jakości [BACH, PTAK 2001].
Celem niniejszej pracy było określenie wpływu kwasu abscysynowego (ABA) na
dojrzewanie i konwersję somatycznych zarodków tulipana. ABA znany jest nie tylko
jako inhibitor wzrostu, ale takŜe jako związek wspomagający dojrzewanie zarodków
somatycznych [WILHELM i in. 2004].
Materiał i metody
Doświadczenie przeprowadzono w Katedrze Roślin Ozdobnych Akademii
Rolniczej w Krakowie. W tym celu wykorzystano cebule tulipanów odmian: Apeldoorn
(naleŜących do grupy mieszańców Darwina) i Rosy Wing (pojedyncze późne) o
obwodzie 11-12 cm. Cebule poddano 12-tygodniowemu chłodzeniu. Zdezynfekowane
słupki, wyizolowane z cebul, cięto na 1-2 mm eksplantaty i wykładano na poŜywki do
szalek Petriego. PoŜywki inicjalne zawierały sole mineralne według MURASHIGE i SKOOG
[1962], 3% sacharozy oraz regulatory wzrostu: Picloram (25 i 50 µM) i BAP (0,25-10
µM). Kultury trzymano w ciemności, w 20°C i pasaŜowano na świeŜe poŜywki w
odstępach 4-tygodniowych. Tworzący się Ŝółty, globularny kalus przenoszono następnie
na poŜywkę ze zmniejszoną zawartością regulatorów wzrostu, w celu formowania i
rozwijania zarodków somatycznych, zgodnie z procedurą według BACH i PTAK [2002].
Somatyczne zarodki w fazie statudium torpedy, długości 5-10 mm, odejmowano
od kalusa embriogenicznego i umieszczano po 5 na poŜywce wzbogaconej o ABA w
stęŜeniu 10 µM. Po tygodniu przenoszono je na poŜywkę zawierającą regulatory: NAA
M. Maślanka, A. Bach
156
i BAP (w stęŜeniu 0,25 i 2,5 µM) w celu dojrzewania i konwersji do roślin. W drugim,
dziesięciotygodniowym etapie doświadczenia część zarodków hodowano w ciemności a
część na świetle. Po tygodniu działania ABA zmierzono masę i długość zarodków oraz
oceniono zawartość suchej masy. Po 11 tygodniach od inicjacji doświadczenia
obserwacje wzbogacono jeszcze o stopień deformacji zarodków oraz o ich
przeŜywalność. Doświadczenie wykonano w pięciu powtórzeniach.
Wyniki doświadczenia opracowano statystycznie za pomocą metody analizy
wariancji, zaleŜnie od danych, w układzie dwu- lub trzyczynnikowym, z zastosowaniem
testu Duncana. Oceny istotności róŜnic pomiędzy średnimi dokonano przy
uwzględnieniu poziomu istotności α = 0,05.
Wyniki i dyskusja
Wykazano, Ŝe ABA hamował przyrost świeŜej masy zarodków oraz ich długość
w porównaniu z kontrolą. Jego wpływ dało się zauwaŜyć zarówno po tygodniu kultury,
jak i po kolejnych dziesięciu tygodniach, podczas których zachowanie się zarodków
było następstwem jego wcześniejszego działania (tab. 1-4). Po tygodniu kultury pod
wpływem ABA, odnotowano istotnie mniejszy przyrost świeŜej masy zarodków (tab.
1).
Tabela 1; Table 1
Wpływ ABA na przyrost świeŜej masy zarodków
(współczynnik przyrostu świeŜej masy GV*)
Effect of ABA on the weight of the embryos
(weight increase factor the GV*)
Odmiana; Cultivar
PoŜywka; Medium
Ciemność; Darkness
Apeldoorn
5 µM Pic, 1 µM BAP
0,474 c**
Rosy Wing
5 µM Pic, 1 µM BAP, 10 µM ABA
0,12 a
5 µM Pic, 1 µM BAP
0,242 b
5 µM Pic, 1 µM BAP, 10 µM ABA
0,11 a
*GV
= mk-mp/mp (mk - masa końcowa; final weight; mp - masa początkowa; initial weight)
**
średnie oznaczone tymi samymi literami nie róŜnią się istotnie na poziomie istotności α = 0,05; means
marked with the same letter do not differ significantly at the significance level α = 0.05
Przyrost długości zarodków pod wpływem ABA był takŜe mniejszy, choć róŜnice
między średnimi z doświadczenia i kontroli nie były istotne, a w przypadku zarodków
odmiany Apeldoorn tygodniowe działanie ABA przyczyniło się nawet do nieznacznego
wzrostu ich długości (tab. 2, 4). WILSON i in. [1999] uzyskał podobne wyniki u zarodków
Picea abies. Wykazał on, Ŝe długość zarodków poddanych działaniu ABA maleje wraz
ze wzrostem jego stęŜenia w poŜywce. Pod wpływem egzogennego ABA stwierdzono
równieŜ słabszy wzrost eksplantatów słupkowych tulipana [KAWA, SANIEWSKI 1986].
Biorąc pod uwagę czynnik światła, istotnie mniejszy przyrost długości oraz świeŜej
masy zarodków odnotowano w ciemności, ale tylko w przypadku odmiany Apeldoorn,
zarówno u zarodków poddanych wcześniej działaniu ABA jak i kontrolnych. U odm.
Rosy Wing światło nie miało wpływu na omawiane cechy (tab. 3, 4).
Tabela 2; Table 2
Wpływ ABA na przyrost długości zarodków (mm)
Effect of ABA on length of the embryos (mm)
WPŁYW KWASU ABSCYSYNOWEGO ORAZ ŚWIATŁA NA WZROST I ROZWÓJ ...
Odmiana; Cultivar
PoŜywka; Medium
Ciemność; Darkness
Apeldoorn
5 µM Pic, 1 µM BAP
0,48 ab
5 µM Pic, 1 µM BAP, 10 µM ABA
0,68 b
5 µM Pic, 1 µM BAP
0,56 ab
5 µM Pic, 1 µM BAP, 10 µM ABA
0,1 a
Rosy Wing
157
Objaśnienia: patrz tabela 1; Explanations: see Table 1
Tabela 3; Table 3
Następczy wpływ ABA na przyrost świeŜej masy zarodków
(współczynnik przyrostu świeŜej masy GV*)
Post-treatment effect of ABA on weight of the embryos
(weight increase factor the GV*)
Odmiana; Cultivar
PoŜywka; Medium
Ciemność; Darkness
Światło; Light
Apeldoorn
2,5 µM BAP, 0,25 µM NAA
4,042 b
16,158 d
2,5 µM BAP, 0,25 µM NAA***
3,492 ab
9,804 c
2,5 µM BAP, 0,25 µM NAA
2,268 ab
2,204 ab
2,5 µM BAP, 0,25 µM NAA***
0,956 a
0,708 a
Rosy Wing
*GV
= mk-mp/mp (mk - masa końcowa; final weight; mp - masa początkowa; initial weight)
**
średnie oznaczone tymi samymi literami nie róŜnią się istotnie na poziomie istotności α = 0,05; means
marked with the same letter do not differ significantly at the significance level α = 0.05
***
po wcześniejszym zastosowaniu ABA; after ABA treatment
Tabela 4; Table 4
Następczy wpływ ABA na przyrost długości zarodków (mm)
Post-treatment effect of ABA on the length of the embryos (mm)
Odmiana; Cultivar
PoŜywka; Medium
Ciemność; Darkness
Apeldoorn
2,5 µM BAP, 0,25 µM NAA
8,96 bc
15,76 d
2,5 µM BAP, 0,25 µM NAA
5,44 ab
11,94 cd
2,5 µM BAP, 0,25 µM NAA
4,78 ab
4,36 ab
2,5 µM BAP, o,25 µM NAA
1,44 a
1,6 a
Rosy Wing
Światło; Light
Objaśnienia: patrz tabela 3; Explanations: see Table 3
Ze względu na identyczność warunków doświadczenia, którym poddano obie odmiany
tulipanów moŜna przypuszczać, Ŝe reakcja zarodków na światło zaleŜy od genotypu
rośliny. Zawartość suchej masy zarodków wskazała, Ŝe pod wpływem ABA pobierały
one mniej wody z poŜywki. ABA zmniejszał więc uwodnienie zarodków. Mniejsza
ilość wody w zarodkach zwiększa ich tolerancję na suszę i daje moŜliwość ich długotrwałego mroŜenia. Zjawisko to przedstawione zostało przez SHIOTA i in. [1999]
w doświadczeniu z zarodkami somatycznymi marchwii, których desykacja była
moŜliwa po zastosowaniu egzogennego ABA. Według WILHELM i in. [2004], zawartość
wody w komórkach jest waŜnym czynnikiem wpływającym na proces dojrzewania, a
tym samym produkcję wysokiej jakości zarodków somatycznych dębu. Do większego
uwodnienia zarodków przyczyniło się natomiast światło, ale tylko w przypadku
odmiany Apeldoorn. Pod wpływem światła stwierdzono takŜe większy procent
zdeformowanych zarodków (maksymalnie o 48%), z wyjątkiem zarodków odmiany
Rosy Wing, dla których mniej korzystna w tym przypadku była ciemność (tab. 5).
M. Maślanka, A. Bach
158
Według WILHELM i in. [2004], ABA zapobiega formowaniu nienormalnych struktur
zarodka. W naszym doświadczeniu natomiast ABA nie wpłynął istotnie na deformacje
zarodków obu odmian (tab. 5). Pod wpływem światła wszystkie zarodki Apeldoorn
uległy zazielenieniu. W przypadku odm. Rosy Wing wybarwiło się zaledwie 28%
zarodków po zastosowaniu ABA i 62% w kontroli. VEISSEIRE i in. [1994] sugeruje
hamujący wpływ ABA na zazielenienie „torped” Hevea brasiliensis. Stwierdzenia tego
nie moŜna jednak odnieść do zarodków odmiany Apeldoorn. Być moŜe róŜnice między
odmianami wynikają z ich przynaleŜności do innych grup tulipanów. Odmiana Rosy
Wing, naleŜąca do tulipanów pojedynczych późnych, później rozpoczyna wegetację w
porównaniu z odmianą Apeldoorn.
Tabela 5; Table 5
Następczy wpływ ABA na stopień deformacji zarodków (%)
Post-treatment effect of ABA on the malformation of embryos (%)
Odmiana; Cultivar
PoŜywka; Medium
Ciemność; Darkness
Światło; Light
Apeldoorn
2,5 µM BAP, 0,25 µM NAA
40 ab
60 bc
2,5 µM BAP, 0,25 µM NAA
20 a
68 c
2,5 µM BAP, 0,25 µM NAA
40 ab
55 bc
2,5 µM BAP, 0,25 µM NAA
56 bc
36 ab
Rosy Wing
Po 11 tygodniach kultury stwierdzono najmniejszą przeŜywalność kontrolnych
zarodków odm. Rosy Wing umieszczonych na świetle, kształtującą się na poziomie
64%. Zarodki tej odmiany w duŜym stopniu uległy nekrozie. PrzeŜywalność
pozostałych zarodków, niezaleŜnie od zastosowanego czynnika, nie róŜniła się między
sobą istotnie (tab. 6).
Tabela 6; Table 6
Następczy wpływ ABA na przeŜywalność zarodków (%)
Post-treatment effect of ABA on the survival of embryos (%)
Odmiana; Cultivar
PoŜywka; Medium
Ciemność; Darkness
Światło; Light
Apeldoorn
2,5 µM BAP, 0,25 µM NAA
100 b
100 b
2,5 µM BAP, 0,25 µM NAA
100 b
92 b
Rosy Wing
2,5 µM BAP, 0,25 µM NAA
88 b
64 a
2,5 µM BAP, 0,25 µM NAA
100 b
100 b
Objaśnienia patrz tabela 3; Explanations see Table 3
W doświadczeniu zaobserwowano takŜe, Ŝe 40% zarodków odmiany Apeldoorn
tworzy pędy, które w przypadku odm. Rosy Wing pojawiły się zaledwie u 4%
zarodków.
W tych samych warunkach odnotowano istotne róŜnice w zachowaniu się
zarodków obu odmian, co oznaczałoby, Ŝe stopień reakcji somatycznych zarodków na
ABA zaleŜy takŜe od ich genotypu.
O jakości zarodków somatycznych decydują nie tylko cechy morfologiczne ale
takŜe zawartość wody w komórkach i relacje między ABA a poziomem proliny,
wpływające na ich dojrzewanie [WILHELM i in. 2004], dlatego teŜ niezbędne będzie
wykonanie podobnych analiz odnośnie badanych zarodków.
Wnioski
WPŁYW KWASU ABSCYSYNOWEGO ORAZ ŚWIATŁA NA WZROST I ROZWÓJ ...
159
1.
Kwas abscysynowy w kulturach in vitro zmniejsza przyrost świeŜej masy somatycznych zarodków tulipanów.
2.
Kwas abscysynowy zmniejsza uwodnienie zarodków.
3.
Zdolność syntezy chlorofilu oraz tworzenia pędów przez somatyczne zarodki
tulipanów zaleŜy od ich genotypu.
Literatura
BACH A., PTAK A. 2001. Somatic embryogenesis and plant regeneration from ovaries of
Tulipa gesneriana L. in vitro cultures. Acta Hort. 560: 391-394.
BACH A., PTAK A. 2002. Nowa metoda mikrorozmnaŜania tulipana (Tulipa gesneriana
L.) z tkanek zaląŜni. Zesz. Probl. Post. Nauk Rol. 483: 13-19.
DE HERTOGH A., LE NARD M. 1993. The physiology of flower bulbs. Elsevier, Amsterdam-London-New York-Tokyo: 624 ss.
GUDE H., DIJKEMA M.H.G.E. 1997. Somatic embryogenesis in tulip. Acta Hort. 430:
275-300.
KAWA L., SANIEWSKI M. 1986. The effect of gibberellic acid and abscisic acid on tulip
pistil growth in vitro. Acta Hort. 177: 129-134.
MURASHIGE T., SKOOG F. 1962. A revised medium on the growth and bioassays with
tobacco tissue culture. Physiol. Plant. 15: 473-497.
SHIOTA H., TACHIBANA K., WATABE K., KAMADA H. 1999. Successful long-term preservation of abscisic-acid-treated and desiccated carrot somatic embryos. Plant Cell Reports
18: 749-753.
VEISSEIRE P., LINOSSIER L., COUDRET A. 1994. Effect of abscisic acid and cytokinins on
the development of somatic embryos in Hevea brasiliensis. Plant Cell, Tissue and Organ
Culture 39: 219-223.
WILHELM E., PREWEIN CH., VAGNER M. 2004. Water status and physiological parameters
in relation to oak somatic embryo quality and germination ability. COST 843: 37-38.
Abstracts. Quality Enhancement of Plant Production through Tissue Culture. Saanen,
Switzerland 2004.
WILSON G., HUNTER CH., MOYLAN E. 1999. Effect of abscisic acid on maturation and
growth of somatic embryos of Picea abies. Abstracts of the Sixth Annual Meeting of the
Working Group. Czech Republic 1999, COST 822: 32-33.
Słowa kluczowe:
tulipan, somatyczna embriogeneza, somatyczne zarodki, kwas
abscysynowy
Streszczenie
Somatyczne zarodki tulipana odmian Apeldoorn i Rosy Wing, w stadium torpedy,
poddano tygodniowemu działaniu kwasu abscysynowego. Większość zarodków na
obecność ABA w poŜywce zareagowała mniejszym przyrostem długości (o 24-82%
w zaleŜności od warunków kultury) oraz mniejszym przyrostem świeŜej masy (o
14-75%) w porównaniu z kontrolą. Sucha masa zarodków wskazuje, Ŝe pod wpływem
ABA pobierały one mniej wody z poŜywki. Światło przyczyniło się do większego
M. Maślanka, A. Bach
160
uwodnienia zarodków (zarówno z kontroli jak i po ABA) ale tylko w przypadku
odmiany Apeldoorn. Na świetle, zielone zarodki odmiany Apeldoorn wykazały blisko
dwukrotnie większy przyrost długości oraz trzy- i czterokrotnie większy przyrost
świeŜej masy, w porównaniu z ciemnością, co stanowi istotną róŜnicę. RóŜnic takich
nie odnotowano u odm. Rosy Wing. Pod wpływem światła stwierdzono równieŜ
deformacje większości zarodków (maksymalnie o 48%). Ponadto na świetle
odnotowano najmniejszą przeŜywalność kontrolnych zarodków odm. Rosy Wing,
kształtującą się na poziomie 64%. Po 11 tygodniach od załoŜenia doświadczenia,
zaobserwowano tworzenie pędów, głównie przez zarodki odmiany Apeldoorn. Zarodki
somatyczne odmiany Rosy Wing charakteryzują się mniejszą zdolnością tworzenia
pędów i syntezy chlorofilu oraz mniejszą Ŝywotnością w porównaniu z zarodkami
odmiany Apeldoorn.
EFFECT OF ABSCISIC ACID AND LIGHT ON THE GROWTH
AND DEVELOPMENT OF TULIP (Tulipa gesneriana L.)
SOMATIC EMBRYOS
Małgorzata Maślanka, Anna Bach
Department of Ornamental Plants, Agricultural University, Kraków
Key words:
tulip, somatic embryogenesis, somatic embryos, abscisic acid
Summary
Somatic embryos of tulip, cvs Apeldoorn and Rosy Wing at the torpedo stage
were treated with abscissic acid for one week. The growth regulator contained in the
medium had an influence on the majority of embryos. Their length was much lower
(about 24-82% depending on the culture conditions) in comparison with the control.
Moreover, their weigth was also lower (about 14-75%) in comparison with non-treated
ABA embryos. Under the influence of ABA, the embryos did uptake so much water
from the medium, which was indicated by the dry weight. In case of cv. Apeldoorn, the
light enhanced the hydration of embryos, both ABA treated and non-treated ones. In
light, the green embryos increased nearly twice in length and three to four times in
weight than the embryos from darkness. It is a significant difference. Such differences
were not noticed in the case of cv. Rosy Wing. Under the influence of light, the majority
of embryos increased their malformation (max. 48%). What is more, in the same culture
condition, the viability was the lowest in the case of non-treated ABA cv. Rosy Wings
embryos. This survival rate was at the level of 64%. After 11 weeks of in vitro culture
first shoots appeared. Most of these shoots came from cv. Apeldoorn. Somatic embryos
of cv. Rosy Wing in comparison with embryos of cv. Apeldoorn showed a lower ability
of forming shoots, chlorophyll synthesis and the lower viability.
Mgr inŜ. Małgorzata Maślanka
Katedra Roślin Ozdobnych
Akademia Rolnicza im. H. Kołłątaja
Al. 29 Listopada 54
31-425 KRAKÓW
e-mail: [email protected]
ZESZYTY PROBLEMOWE POSTĘPÓW NAUK ROLNICZYCH 2007 z. 523: 163-168
ROLA WĘGLA AKTYWOWANEGO
I BENZYLOAMINOPURYNY
W MIKROROZMNAśANIU OBUWIKA POSPOLITEGO
Anna Pindel
Katedra Botaniki, Akademia Rolnicza im. H. Kołłątaja w Krakowie
Wstęp
Liczne prace donoszą o efektywnym mikrorozmnaŜaniu tropikalnych gatunków
storczyków poprzez kalus lub protokormopodobne struktury (PLB), lecz bardzo
niewiele jest doniesień o skutecznym rozmnaŜaniu in vitro gatunków Cypripedium,
jednego z bardziej niezwykłych i znoszących klimat północny rodzaju storczykowatych.
Rodzaj Cypripedium, obok innych z podrodziny Cypripedioideae, jest zaliczany do
trudnych w kulturach in vitro [ARDITTI, ERNST 1993]. Nasz najokazalszy z rodzimych
gatunków storczykowatych Cypripedium calceolus L., jak wszystkie pozostałe z tej
rodziny, objęty jest ścisłą ochroną. MoŜliwość regeneracji in vitro mogłaby ograniczyć
pozyskiwanie tych atrakcyjnych roślin ze stanowisk naturalnych do amatorskich
ogrodów.
Dość często w kulturach in vitro stosowany jest węgiel aktywowany (AC),
jakkolwiek jego dokładne działanie i funkcja nie są szerzej poznane. AC dzięki
ogromnej wewnętrznej powierzchni moŜe adsorbować wiele substancji. Znane są
doniesienia o stymulującym wpływie na somatyczną embriogenezę, androgenezę,
ukorzenianie, wydłuŜanie pędów i formowanie cebul, stabilizację kultur protoplastów,
czy ograniczanie ciemnienia poŜywki i/lub eksplantatów [MOHAMED-YASSEEN i in. 1993,
1994, 1995; TEIXEIRA i in. 1994; KUNITAKE i in. 1995]. Adsorbuje równieŜ regulatory
wzrostu, toksyczne metabolity i wydzieliny [FRIDBORG, ERIKSSON 1975; FRIDBORG i in.
1978; EBERT, TAYLOR 1990]. Stymulujący efekt AC moŜe polegać na nieodwracalnej
adsorpcji inhibitorów, toksycznych metabolitów (zwłaszcza fenoli), a uwalnianiu
naturalnych stymulujących substancji zawartych w AC. Ale proces ten wciąŜ nie jest
jasny. JOHANSSON i in. [1990] uwaŜają, Ŝe AC moŜe stopniowo uwalniać zaabsorbowane
produkty pokarmowe i regulatory wzrostu, które stają się dostępne dla roślin.
W niniejszej pracy badano wpływ wzajemnej korelacji pomiędzy dawką AC i
cytokininy 6-benzyloaminopuryny (BA) w poŜywce na powstawanie PLB na eksplantatach inicjalnych obuwika pospolitego.
Materiał i metody
Eksplantaty pobrano 20.06.2005 roku z niedojrzałych, zielonych torebek
nasiennych obuwika pospolitego (Cypripedium calceolus L.) około 10 dni po przekwitnięciu (fot. 1), czyli w momencie osiągnięcia maksymalnej wielkości przy zachowaniu jeszcze częściowo Ŝywych tkanek budujących owocnię. Po rutynowej
powierzchniowej sterylizacji torebki cięto poprzecznie na ok. 0,5-1,0 mm talarki
164
A. Pindel
i układano płasko na poŜywce zachowując układ eksplantatu taki jak w owocu tzn.
nasadową częścią do podłoŜa. Po 10 takich eksplantatów umieszczano w kolbce z
poŜywką wg Murashige i Skoog (MS) zestaloną 0,2% PhytagelemTM o zróŜnicowanej
zawartości CA i BA przy stałej zawartości auksyny NAA - 0,3 mg⋅dm-3 (tab. 1). Kultury
prowadzono w fitotronie przy słabym oświetleniu lampami fluorescsncyjnymi (30-40
µmol⋅m-2⋅s-1) na 16 godzinnym fotoperiodzie. Doświadczenie powtórzono po tygodniu.
Fot. 1.
Photo 1.
Torebki nasienne obuwika pospolitego
The capsules of lady’s slipper orchid
Wyniki obliczano po 3, 6 i 12 miesiącach, przyjmując za pozytywną odpowiedź
morfogenetyczną eksplantatu, gdy średnio przynajmniej 2 protostruktury PLB
przypadały na jeden wyłoŜony eksplantat - oznaczenie „++”, gdy średnio tworzyła się
tylko 1 taka struktura/eksplantat oznaczano pojedynczym znakiem „+”, w przypadku
mniejszej liczby oznaczano „-” (tab. 1).
Analizę histologiczną tworzących się struktur przeprowadzono na ultracienkich
skrawkach materiału utrwalonego aldehydem glutarowym i zatopionym w Eponie.
Wyniki i dyskusja
Wywołanie odpowiedzi morfogenetycznej w kulturach obuwika trwało bardzo
długo, w porównaniu do innych tego typu kultur, co stwierdzono juŜ we wcześniejszych
badaniach [PINDEL, PINDEL 2004]. Po około 6 miesiącach w niektórych obiektach (tab. 1)
zaczęły się pojawiać widoczne gołym okiem białe struktury, średnicy około 1 mm.
Powstawały one z nie do końca jeszcze zidentyfikowanych - badania w toku - komórek
owocni (miękiszu i/lub łoŜyska). Po kolejnych 6 miesiącach na poŜywce zawierającej 1
mg⋅dm-3 BA i 0,1% AC rozwijały się one w protokormo-podobne struktury (w literaturze określane jako PLB - protocorm-like body) wielkości 3-4 mm.
ROLA WĘGLA AKTYWOWANEGO I BENZYLOAMINOPURYNY ...
165
Tabela 1; Table 1
Wpływ AC i BA na morfogenezę eksplantatów obuwika pospolitego
na poŜywce MS z 0,3 mg⋅dm-3 NAA;
Effect of AC and BA on morphogenesis of Cypripedium calceolus L. explants
on MS medium with the addition of 0.3 mg⋅dm-3 NAA
BA
(mg⋅dm-3)
AC
(%)
Zmiany morfogenetyczne/czas trwania kultury
Morphogenetic response/ time of culture
3 miesiące
3 months
6 miesięcy
6 months
12 miesięcy
12 months
0,0 (kontrola; control)
0,0
-
-
-
1,0
0,0
-
-
-
2,0
0,0
-
-
-
5,0
0,0
-
-
-
1,0
0,1
-
++
PLB
2,0
0,1
-
++
++
5,0
0,1
-
++
+
część zamarła
part of them dead
1,0
0,2
-
+
zamarły; dead
2,0
0,2
-
-
-
5,0
0,2
-
-
-
+
++
średnio mniej niŜ 1 PLB/eksplantat; mean less than 1 PLB/explant
średnio 1 PLB/ekspntat; mean 1 PLB/explant
średnio 2 lub więcej PLB na eksplantat; mean 2 or more PLB/explant
WyŜsze z zastosowanych stęŜeń BA (2 i 5 mg⋅dm-3) przy tej samej zawartości AC
wprawdzie inicjowały początkowy rozwój eksplantatów, ale zatrzymywał się on na tym
etapie. Przy braku AC w poŜywce, bez względu na zawartość BA, eksplantaty
ciemniały. Obserwowano równieŜ wokół nich brązowy naciek na poŜywce.
W kulturach in vitro storczyków, generalnie z dobrym skutkiem, dodaje się do
poŜywek węgla aktywowanego. W zaleŜności od gatunku stosuje się dawki od 0,5
-3
[PARK i in. 2002], 1,0 [LEE, LEE 2003], do nawet 5 g⋅dm poŜywki [MOHAMED-YASSEN
2001]. AC powinien być obecny juŜ na etapie inicjalnym, choć niektórzy badacze
dodawali go dopiero do poŜywek w drugim etapie kultury, tzn. podczas procesu
regeneracji roślin z PLB [PARK i in. 2002]. W doświadczeniach z innymi gatunkami
storczykowatych w większości przypadków stosowaną cytokininą była równieŜ BA. W
pracy HAHNA i PEAKA [2001] najlepsze wyniki przy regeneracji cymbidium uzyskano na
takiej samej poŜywce jak w niniejszej pracy, tzn. MS z 1,0 mg⋅dm-3 BA + 0,1% CA.
Wykorzystanie torebek nasiennych daje moŜliwość otrzymania wielu eksplantatów wyjściowych (nawet ponad 30 z 1 torebki), co ma niebagatelne znaczenie,
biorąc pod uwagę trudności z pozyskiwaniem materiału wyjściowego, związane
równieŜ z przepisami dotyczącymi ochrony gatunkowej.
Preparaty anatomiczne (fot. 2) wykazały, Ŝe zaczęły się róŜnicować pierwsze
elementy tkanki przewodzącej, a w peryferyjnych komórkach PLB gromadziły się
znaczne ilości skrobi. Świadczyć to moŜe o początkach formowania pędowych
primordiów [ŠAMAJ i in. 1997].
A. Pindel
166
Fot. 2.
Przekrój poprzeczny przez PLB na eksplantacie obwika pospolitego (powiększenie
34 x)
Photo 2.
Transverse section of PLB on explants of Cypripedium calceolus (x 34)
W warunkach naturalnych nasiona obuwika kiełkują i rozwijają się w roślinę
bardzo wolno, pierwszy liść pojawia się dopiero w piątym roku. Dzięki metodom kultur
tkankowych moŜna by znacznie skrócić ten okres. Jednak mikrorozmnaŜanie tego
storczyka jest trudne. Nadzieje budzić mogą efekty prac prowadzonych z takimi
gatunkami jak: Cypripedium formosanum [LEE, LEE 2003], C. macranthos odm.
Rebunense [SHIMURA, KODA 2004] oraz C. flavum [YAN i in. 2006].
Wnioski
1.
Obecność węgla aktywowanego (AC) w poŜywce inicjalnej zapobiega ciemnieniu eksplantatów obuwika pospolitego.
2.
Skuteczna jest juŜ zawartość 100 g AC w dm3 poŜywki.
3.
Protokormo-podobne struktury obserwowano na poŜywce MS z 0,3 mg⋅dm-3
NAA, 1,0 lub 2,0 mg⋅dm-3 BA oraz 0,1% CA.
Literatura
ARDITTI J., ERNST R. 1993. Micropropagation of orchids. New York: John Wiley & Son,
Inc.: 434-466.
EBERT A., TAYLOR H.F. 1990. Assessment of the changes of 2,4-dichlorophenoxyacetic
acid concentrations in plant tissue culture media in the presence of activated charcoal.
Plant Cell Tiss. Org. Cult. 20: 165-172.
FRIDBORG G., ERIKSSON T. 1975. Effects of activated charcoal on growth and morphogenesis in cell cultures. Physiol. Plant. 34: 306-308.
ROLA WĘGLA AKTYWOWANEGO I BENZYLOAMINOPURYNY ...
167
FRIDBORG G., PEDERSEN M., LANDSTRÖM L-E., ERIKSSON T. 1978. The effect of activated
charcoal on tissue cultures: adsorption of metabolites inhibiting morphogenesis.
Physiol. Plant. 43: 104-106.
HAHN E-J., PEAK K-Y. 2001. High photosynthetic photon flux and high CO2 concentration
under increased number of air exchanges promote growth and photosynthesis of four
kinds of orchid plantlets in vitro. In Vitro Cell. Dev. Biol.-Plant 37: 678-682.
JOHANSSON L.B., CALLEBERG E., GEDIN A. 1990. Correlations between activated charcoal,
Fe-EDTA and other organic media ingredients in cultured anthers of Anemone
canadensis. Physiol. Plant. 80: 243-249.
KUNITAKE H., NAKASHIMA T., MORI K., TANAKA M., MII M. 1995. Plant regeneration from
mesophyll protoplasts of Lisanthus (Eustoma grandiflorum) by adding activated
charcoal into protoplast culture medium. Plant Cell Tiss. Org. Cult. 43: 59-65.
LEE Y-I., LEE N. 2003. Plant regeneration from protocorm-derived callus of Cypripedium
formosanum. In Vitro Cell. Dev. Biol.-Plant 39: 475-479.
MOHAMED-YASSEEN Y. 2001. Influence of agar and activated charcoal on uptake of
gibberellin and plant morphogenesis in vitro. In Vitro Cell. Dev. Biol.-Plant 37:
204-205.
MOHAMED-YASSEEN Y., BARRINGER S.A., SCHNELL R.J., SPLITTSTOESSER W.E. 1995. In vitro
shoot proliferation and propagation of guava (Psidium guajava L.) from germinated
seedlings. Plant Cell Rep. 14: 525-528.
MOHAMED-YASSEEN Y., SPLITTSTOESSER W.E., LITZ R. 1993. In vitro bulb formation and
plant recovery from onion inflorescences. Hort. Science 28: 1052.
MOHAMED-YASSEEN Y., SPLITTSTOESSER W.E., LITZ R. 1994. In vitro shoot proliferationand production of sets from garlic and shallot. Plant Cell Tiss. Org. Cult. 36: 243-247.
PARK S-Y., MURTHY H.N., PAEK K-Y. 2002. Rapid propagation of Phalaenopsis from
floral stalk-derived leaves. In Vitro Cell. Dev. Biol.-Plant 38: 168-172.
PINDEL A., PINDEL Z. 2004. Initiation of in vitro cultures of chosen endangered European
species of orchids. Folia Hort. 16: 111-117.
ŠAMAJ J., BOBAK M., OVEČKA M., BLEHOVA A., PRETOVA A. 1997. Structural features of
plant morphogenesis in vitro. Veda Bratislava: 122 ss.
SHIMURA H., KODA Y. 2004. Micropropagation of Cypripedium macranthos var rebunense through protocorm-like bodies derived from mature seeds. Plant Cell Tiss. Org.
Cult. 78: 273-276.
TEIXEIRA J.B., SONDAHL M.R., KIRBY E.G. 1994. Somatic embryogenesis from immature
inflorescences of oil palm. Plant Cell Rep. 13: 247-250.
YAN N., HU H., HUANG J-L., XU K., WANG H., ZHOU Z-K. 2006. Micropropagation of
Cypripedium flavum through multiple shoot of seedlings derived from mature seeds.
Plant Cell Tiss. Org. Cult. 84: 113-117.
Słowa kluczowe:
Cypripedium calceolus L., eksplantat, struktury protokormo-podobne (PLB)
Streszczenie
Badano zdolność morfogenetyczną eksplantatów pochodzących z niedojrzałych
torebek nasiennych obuwika pospolitego (Cypripedium calceolus L.) na poŜywkach o
A. Pindel
168
zróŜnicowanej zawartości benzyloaminopuryny (BA) i węgla aktywowanego (AC).
Powstawanie protokormo-podobnych struktur (PLB) obserwowano na poŜywce MS z 1
mg⋅dm-3 BA i 0,1% AC. Ten początkowy etap morfogenezy trwał aŜ 12 miesięcy,
obserwacje anatomiczne wykazały jednak, Ŝe został zainicjowany etap róŜnicowania
komórek, co daje nadzieję na regenerację pędów. Wykazano jednocześnie, Ŝe brak w
podłoŜu AC prowadzi do ciemnienia eksplantatów i poŜywki co w konsekwencji
skutkowało zamieraniem kultury.
THE ROLE OF ACTIVATED CHARCOAL
AND BENZYLAMINOPURINE IN MICROPROPAGATION
OF Cypripedium calceolus L.
Anna Pindel
Department of Botany, Agricultural University, Kraków
Key words:
slipper orchid, explant, protocorm-like body (PLB)
Summary
The morphogenetic ability of Cypripedium calceolus L. explants from green
capsules on the medium with different additions of benzylaminopurine (BA) and
activated charcoal (CA) were investigated. Protocorm-like bodies were observed on the
MS medium with 1 mg⋅dm-3 BA and 0.1% AC after 12 months. The anatomical study
showed that the cells are competent to caulogenesis. It was presented heat on the media
without charcoal the explants turned brown and died.
Dr hab. Anna Pindel
Katedra Botaniki
Akademia Rolnicza im. H. Kołłątaja
al. 29 Listopada 54
31-425 KRAKÓW
e-mail: [email protected]
ZESZYTY PROBLEMOWE POSTĘPÓW NAUK ROLNICZYCH 2007 z. 523: 169-174
WPŁYW STANU FIZYCZNEGO PODŁOśA
NA PRAWIDŁOWOŚĆ ROZWOJU
ZARODKÓW SOMATYCZNYCH SZPARAGA OZDOBNEGO
Anna Pindel
Katedra Botaniki, Akademia Rolnicza im. H. Kołłątaja w Krakowie
Wstęp
Na prawidłowość rozwoju zarodków somatycznych, oprócz wielu innych
czynników biotycznych i abiotycznych, wpływa w duŜej mierze rodzaj i stęŜenie,
stosowanych do zestalania poŜywek, substancji Ŝelujących. „Twardość” poŜywki
decyduje o statusie wodnym i dostępności róŜnych składników między innymi kwasu
abscysynowego (ABA) i białek wpływających na dojrzewanie zarodków, u niektórych
gatunków przez podniesienie stęŜenia agaru ogranicza się zjawisko szklistości.
Wiadomo, Ŝe róŜne gatunki w specyficzny sposób reagują na ten czynnik. Podjęto więc
próbę zbadania tej zaleŜności u powstających drogą somatycznej embriogenezy
zarodków szparaga ozdobnego.
W większości publikacji dotyczących embriogenezy u jednoliściennych autorzy
podają tylko stęŜenia stosowanych substancji zestalających, rzadko zwracając uwagę na
ich rodzaj [WANG i in. 2002; VIKRANT, RASHID 2003]. Agar jest mieszaniną polisacharydów
o duŜej masie cząsteczkowej otrzymywanych z glonów z rodziny Rhodophyceae, z
niego produkuje się przez oczyszczanie róŜne firmowe agary (Difco, Oxoid, Agarose)
natomiast PhytagelTM jest produktem fermentacji bakterii zachodzącej w
kontrolowanych warunkach (gellan gum), jego jakość jest lepsza i jest 2-3 razy
„twardszy” od pozostałych [TRIPLETT, JOHNSON 1999].
Celem pracy było zbadanie, czy rodzaj agaru uŜytego do zestalania poŜywek
moŜe mieć wpływ na embriogenezę somatyczną u szparaga ozdobnego.
Materiał i metody
Wyselekcjonowany fenotypowo jasny, ziarnisty, embriogenny kalus szparaga
gęstokwiatowego odmiany Sprengeri (Asparagus densiflorus L.) uzyskany z odcinków
(krąŜków) międzywęźli etiolowanych siewek na poŜywce UM [UCHIMIYA, MURASHIGE
-3
-3
1974] z 2,0 mg⋅dm 2,4-D oraz 0,25 mg⋅dm kinetyny umieszczano na poŜywce, która
inicjowała pierwsze stadia rozwoju zarodków. Skład poŜywki ustalono we wcześniejszych badaniach [PINDEL 2000]. Była to poŜywka płynna LS z 0,02 mg⋅dm-3 picloramu i
0,2 mg⋅dm-3 BA) [LINSMAIER, SKOOG 1965], na której badano wpływ agarów: Difco,
Oxoid (Unipath LTD.) i PhytagelTM (Sigma) zastosowanych w stęŜeniach 0,2-1,0%, a
takŜe podłoŜa płynnego na rozwój otrzymywanych drogą embriogenezy pośredniej
zarodków somatycznych. Kolbki z eksplantatami w poŜywce płynnej były okresowo
wstrząsane (maksymalna amplituda 100).
A. Pindel
170
Wyniki i dyskusja
Wiele gatunków jednoliściennych jest mikrorozmnaŜanych, równieŜ drogą
somatycznej embriogenezy, w poŜywkach płynnych. Często jednak otrzymywane tą
drogą zarodki charakteryzują się nieprawidłowym rozwojem, a u zregenerowanych
roślin obserwowano szklistość. Z drugiej jednak strony zwiększanie stęŜenia agaru
wpływa na dostępność nie tylko wody, ale i innych waŜnych składników poŜywki a
szczególnie cytokinin [DEBERGH 1983; MOHOMED-YASSEN 2001]. Nie ma jednak jednoznacznych danych, poniewaŜ róŜne eksplantaty dają róŜną odpowiedź.
W tabeli 1 zestawiono wyniki dotyczące rozwoju zarodków somatycznych
szparaga (Asparagus densiflorus ‘Sprengeri’) z embriogennego kalusa na poŜywkach
zestalonych agarami, PhytagelemTM oraz w poŜywce płynnej.
Tabela 1; Table 1
Rozwój zarodków somatycznych szparaga gęstokwiatowego odm. Sprengeri
w zaleŜności od stopnia utwardzenia poŜywki i rodzaju substancji Ŝelującej
Development of asparagus Sprengeri cv. somatic embryos depending
on the medium hardness and type of gelling agents
Substancja
Ŝelująca
Gelling agent
StęŜenie
Concentration
(%)
Prawidłowo rozwijające
się zarodki somatyczne
Normally developed
somatic embryos
(%)
Agar Difco
0,8
brak; lack
Agar Oxoid
1,0
brak; lack
jw.; see above
PhytagelTM
0,2
0,3
50
83
u pozostałych zarodków zakłócony rozwój przez
spłaszczenie osi zarodka
in some embryos the development is disturbed
by flatting embryonal axis
1,0
brak; lack
0
10
PoŜywka płynna
Liquid medium
Obserwacje
Observations
zatrzymany rozwój zarodków w stadium inicjalnym
the development of embryos is stopped at the
initial stage
zamarły; dead
większość silnie wydłuŜonych, często bez plumuli, liczne wtórne zarodki o nieprawidłowym
rozwoju
majority with elongated radicula, without
plumula pole, the secondary embryos with
developmental abnormalities
Z powyŜszych danych (tab. 1) wynika, Ŝe aby otrzymać zarodki szparaga odm.
Sprengeri trzeba uŜyć poŜywek zestalanych PhytagelemTM najlepiej o stęŜeniu 0,3%.
Agary Difco, Oxoid, oraz wysokie stęŜenie PhytageluTM nie gwarantują prawidłowego
rozwoju. Fotografia 1 ilustruje powstawanie zarodków na poŜywce z Phytagelem TM ,
niektóre z nich mają nietypowy rozwój, zwłaszcza przy jego 0,2% stęŜeniu. Na to, Ŝe
marka handlowa agaru odgrywa waŜną rolę w kulturach in vitro, zarówno juwenilnych
jak i dojrzałych roślin, zwrócili uwagę juŜ PIERIK i in. [1997]. W większości prac do
stabilizacji poŜywek stałych stosuje się agary głównie Difco, choć wielu autorów nie
podaje nazw firm tylko stęŜenia. Agary róŜnią się między sobą zawartością róŜnych
związków mineralnych, największe róŜnice dotyczą obecności jonów Ca, K, S i Cu, w
agarze Oxoid jest teŜ stosunkowo duŜo azotu [BERUTO i in. 1999]. W połączeniu ze skład-
WPŁYW STANU FIZYCZNEGO PODŁOśA ...
171
nikami poŜywki mogą one wchodzić w pewne interakcje wpływające na rozwój kultury.
Fot. 1.
Photo 1.
Zarodki somatyczne na poŜywce utwardzonej Phytagelem TM. Strzałką zaznaczony
zarodek o spłaszczonej osi
Somatic embryos on PhytagelTM containing medium. Abnormal embryo with flatting
axis indicated by the arrow
Tabela 2; Table 2
Stopień uwodnienia zarodków somatycznych szparaga odm. Sprengeri
w zaleŜności od rodzaju i stęŜenia substancji Ŝelującej
Water content in somatic embryos of asparagus Sprengeri cv. depending
on the type and concentration of gelling agents
Substancja Ŝelująca
Gelling agent
StęŜenie agaru
Agar concentration
(%)
Zawartość wody w zarodkach
Water content in embryos
(%)
Agar Difco
0,8
brak zarodków (w embriogennym kalusie 90,1)
lack of embryos (in embryogenic tissue 90.1)
Agar Oxoid
1,0
brak zarodków (w embriogennym kalusie 90,1)
lack of embryos (in embryogenic tissue 90.1)
PhytagelTM
0,2
0,3
1,0
85,1
84,9
brak zarodków; lack of embryos
PoŜywka płynna
Liquid medium
0
88,5
PEREZ-TORNERO i in. [2001] stosowali np. agar Hispanlab. S.A. w stęŜ. 0,7 lub 0,8%
lub Agargel (Sigma) 0,45 lub 0,5% i stwierdzili, Ŝe im wyŜsze stęŜenie tych substancji
tym mniej szklistych pędów u moreli, choć zaleŜało to w duŜym stopniu od genotypu. U
jednoliściennych np. u Crocus sativus często stosowany jest PhytagelTM [LOSCUTOV i in.
1999], choć VARSHNEY i in. [2000] w kulturach lilii uŜywali 0,8% agaru Quixcel.
RównieŜ w poŜywce płynnej (tab. 1) dojrzewanie zarodków szparaga było
zakłócone, być moŜe wstrząsanie przyspieszało wtórną embriogenezę, zanim pierwotny
zarodek osiągnął ostateczne stadium rozwoju (fot. 2).
A. Pindel
172
Zawartość wody w zarodkach (tab. 2) była niŜsza niŜ w embriogennym kalusie (o
5,5-5,8%), najmniej uwodnione były zarodki rozwijające się na poŜywce z
PhytagelemTM w stęŜeniu 0,3%, czyli na podłoŜu gwarantującym najwyŜszą liczbę
prawidłowo rozwijających się zarodków. MoŜna to chyba tłumaczyć jego wysokim
stopniem „czystości” i duŜą twardością w porównaniu z innymi agarami.
Fot. 2.
Photo 2.
WydłuŜone zarodki z poŜywki płynnej
Elongated embryos from liquid medium
Wnioski
1.
PoŜywki płynne, oraz agary Difco i Oxoid nie są przydatne w procesie
embriogenezy somatycznej u szparaga odm. Sprengeri.
2.
Najlepiej przebiega rozwój zarodków na poŜywkach zestalonych PhytagelemTM,
ale w dość niskich stęŜeniach.
Literatura
BERUTO M., BERUTO D., DEBERGH P. 1999. Influence of agar on in vitro cultures.
I. Physicochemical properties of agar and agar gelled media. In Vitro Cell. Dev. Biol.Plant 35: 86-93.
DEBERGH P.C. 1983. Effects of agar brand and concentration on the tissue culture
medium. Physiol. Plant. 59: 270-276.
LINSMAIER E.M., SKOOG F. 1965. Organic growth factor requirements of tobacco cultures. Physiol. Plant. 18: 100-127.
LOSCUTOV A.V., BENINGER C.W., BALL T.M., HOSFIELD G.L., NAIR M., SINK K.C. 1999.
Optimization of in vitro conditions for stigma-like-structure production from half-ovary
explants of Crocus sativus L. In Vitro Cell. Dev. Biol.-Plant 35: 200-205.
MOHOMED-YASSEN Y. 2001. Influence of agar and activated charcoal on uptake of
gibberellin and plant morphogenesis in vitro. In Vitro Cell. Dev. Biol.-Plant 37:
204-205.
WPŁYW STANU FIZYCZNEGO PODŁOśA ...
173
PEREZ-TORNERO O., EGEA J., OLMOS E., BURGOS L. 2001. Control of hyperhydricity in
micropropagated apricot cultivars. In Vitro Cell. Dev. Biol.-Plant 37: 250-254.
PIERIK R.L.M., OOSTERKAMP J., MANSCHOT G.A.J. BARTH T., SCHOLTEN H.J. 1997. Agar
brand, a dominating factor for shoot growth of juvenile and adult Quercus robur L.
‘Fastigiata” in vitro. Plant Tiss. Cult. and Biot. 3/1: 27-31.
PINDEL A. 2000. Przydatność róŜnych metod in vitro w rozmnaŜaniu szparagów ozdobnych. Zesz. Nauk. AR w Krakowie 266: 1-69.
TRIPLETT B.A., JOHNSON D.S. 1999. Adding gelling agents to cotton ovule culture media
leads to subtle changes in fiber development. In Vitro Cell. Dev. Biol.-Plant 35:
265-270.
UCHIMIYA H., MURASHIGE T. 1974. Evaluation of parameters in the isolation of viable
protoplasts from cultured tobacco cells. Plant Physiol. 54: 936-944.
VARSHNEY A., DHAVAN V., SRIVASTAVA P.S. 2000. A protocol for in vitro mass propagation
of Asiatic hybrids of lily through liquid stationary culture. In Vitro Cell. Dev. Biol.Plant 36: 383-391.
VIKRANT, RASHID A. 2003. Somatic embryogenesis from mesocotyl and leaf-base segments of Paspalum scrobiculatum L., a Minor Millet. In Vitro Cell. Dev. Biol.-Plant 39:
485-489.
WANG Z.Y., SCOTT M., HOPKINS A. 2002. Plant regeneration from embryogenic cell suspension cultures of Lolium temulentum. In Vitro Cell. Dev. Biol.-Plant 38: 446-450.
Słowa kluczowe:
Asparagus densiflorus L. odm. Sprengeri, embriogeneza, agary
Streszczenie
Zarodki somatyczne otrzymywano drogą pośredniej embriogenezy somatycznej z
kalusa indukowanego z odcinków międzywęźli siewek szparaga ozdobnego odmiany
Sprengeri (Asparagus densiflorus) na poŜywce UM z 2,0 mg⋅dm-3 2,4-D i 0,25 mg⋅dm-3
kinetyny [PINDEL 2000]. Embriogenną tkankę umieszczano na poŜywkach o składzie
podstawowym jak w LS z dodatkiem 0,02 mg⋅dm-3 pikloramu i 0,2 mg⋅dm-3 BA: płynnej
(okresowo wstrząsanej przy 100 rpm) oraz zestalanych agarem Difco, Oxoid i
PhytagelemTM. Obserwowano wpływ róŜnych rodzajów agarów i ich stęŜeń na
prawidłowość rozwoju zarodków somatycznych. Stwierdzono, Ŝe PhytagelTM w stęŜeniu
0,3% gwarantował największą liczbę (83%) normalnie rozwiniętych zarodków.
THE EFFECT OF MEDIA HARDNESS ON THE ORNAMENTAL
ASPARAGUS SOMATIC EMBRYOS DEVELOPMENT
Anna Pindel
Department of Botany, Agricultural University, Kraków
Key words:
Asparagus densiflorus L. Sprengeri cv., somatic embryogenesis, gelling
agents
Summary
Somatic embryos were obtained via indirect embryogenesis from ornamental
174
A. Pindel
asparagus. Calli were induced from the internodal segments of seedlings Asparagus
densiflorus Sprengeri cv. on UM medium with 2.0 mg⋅dm-3 2,4-D and 0.25 mg⋅dm-3
kinetin [PINDEL 2000]. The embryogenic tissues were grown on liquid medium
(temporary immersion) on a rotary shaker at 100 rpm and on Agar Difco, Oxoid or
Phytagel - solidified LS media with the addition of 0.02 mg⋅dm-3 Picloram and 0.2
mg⋅dm-3 BA.
The differences between the type and concentrations of gelling agents on somatic
embryos development were observed. It was concluded that PhytagelTM was very
effective for normally development of ornamental asparagus somatic embryos. At the
hardness of 0.3% of Phytagel TM 83% of normal developed somatic embryos were
obtained.
Dr hab. Anna Pindel
Katedra Botaniki
Akademia Rolnicza im. H. Kołłątaja
al. 29 Listopada 54
31-425 KRAKÓW
e-mail: [email protected]
ZESZYTY PROBLEMOWE POSTĘPÓW NAUK ROLNICZYCH 2007 z. 523: 175-184
KULTURY in vitro
MISKANTA OLBRZYMIEGO (Miscanthus × gigantheus)
1
Agnieszka PłaŜek , Franciszek Dubert
1
2
1, 2
2
, Iwona śur , Piotr Waligórski
2
Katedra Fizjologii Roślin, Akademia Rolnicza im. H. Kołłątaja w Krakowie
Instytut Fizjologii Roślin im. F. Górskiego PAN w Krakowie
Wstęp
Miskant olbrzymi jest mieszańcem międzygatunkowym diploidalnego gatunku
miskanta chińskiego (Miscanthus sinensis) i tetraploidalnego miskanta cukrowego
(Miscanthus sacchariflorus). Powstały gatunek Miscanthus × gigantheus jest sterylnym
triploidem, rozmnaŜanym wegetatywnie przez kłącza (karpy). Fakt ten powoduje duŜe
ograniczenia w jego hodowli, uniemoŜliwiając tradycyjne metody krzyŜowania i
wykorzystywanie zmienności, którą daje rozmnaŜanie generatywne (zmienność
gametyczna i zygotyczna). Znaczenie gospodarcze tej rośliny w ostatnich latach wzrasta
głównie w związku z jej zastosowaniem jako biopaliwo. Miskant jest rośliną wieloletnią
przeprowadzającą fotosyntezę typu C4, charakteryzującą się zatem zwiększoną
absorpcją dwutlenku węgla, wysokim potencjałem plonowania oraz oszczędnym
gospodarowaniem wodą. Miskant nie jest wymagający pod względem nawoŜenia i
dobrze plonuje na glebach słabszych. Ponadto, w wyniku tworzenia licznych,
splątanych podziemnych kłączy dobrze przytrzymuje glebę, zapobiegając jej
wywiewaniu i erozji. Cecha ta ma ogromne znaczenie we współczesnym rolnictwie,
nastawionym na ekologiczne gospodarowanie, a takŜe na zachowanie w dobrym stanie
nieuŜytków rolnych i gleby pozostawionej odłogowaniu [LEWANDOWSKI 2006].
Miskant olbrzymi jest wraŜliwy na mróz, zwłaszcza w pierwszym roku uprawy.
Wypadanie duŜej liczby roślin powoduje konieczność wiosennego ich dosadzania, co
podwyŜsza znacznie koszty produkcyjne. Ze względu na bardzo małe zróŜnicowanie
osobnicze roślin, które rozmnaŜają się wegetatywnie, trudno wyselekcjonować formy o
podwyŜszonej mrozoodporności. W takim przypadku, wywoływanie zmienności
somaklonalnej zachodzącej w kulturach tkankowych moŜe budzić coraz większe
zainteresowanie hodowców. Wyprowadzenie kultur kalusowych miskanta jest jednak
trudne, poniewaŜ gatunek ten charakteryzuje się wytwarzaniem duŜej ilości związków
fenolowych w reakcji na stres spowodowany cięciem eksplantatów, lub zabiegiem
sterylizacji tkanki wykładanej na poŜywkę, czy wreszcie warunkami hodowli in vitro.
Produkty utlenienia związków fenolowych, wyraźnie widoczne dzięki ciemnemu
zabarwieniu, gromadzą się wokół eksplantatów, silnie ograniczając indukcję kalusa.
Gromadzenie się fenoli w kulturach in vitro zostało opisane u róŜnych gatunków roślin.
LAUKKANEN i in. [1999] obserwowali to zjawisko w kulturach kalusa wyprowadzonych z
dojrzałych stoŜków wzrostu Pinus sylvestris, BHAT i CHANDEL [1991] w kulturach
176
A. PłaŜek i inni
kalusowych Dioscorea alata uzyskanych z węzłów, a LORENZO i in. [2001] w płynnych
kulturach stoŜków wzrostu trzciny cukrowej. W celu eliminacji związków fenolowych
moŜna dodawać do poŜywek związki hamujące róŜne etapy szlaku fenolowego, bądź
teŜ inhibitory oksydazy polifenolowej, ograniczające utlenianie fenoli [LEWANDOWSKI,
KAHNT 1993].
Miskant wytwarza wiechy, których kwiatki zawierają słupki oraz pręciki
produkujące pyłek, co stwarza moŜliwość inicjacji kalusa z niedojrzałych mikrospor.
Indukowanie androgenezy w kulturach in vitro jest obecnie często wykorzystywane w
hodowli wielu gatunków roślin uprawnych, w celu uzyskiwania podwojonych
haploidów. Metoda ta pozwala uzyskać rośliny o róŜnych kombinacjach genów,
trudnych do uzyskania techniką konwencjonalną. Androgeneza umoŜliwia bowiem
ujawnienie się cech maskowanych zazwyczaj przez geny dominujące. Niektóre
androgeniczne genotypy prezentują cechy zwiększonej tolerancji na róŜne stresy
środowiskowe [HUMPHREYS i in. 1998].
Celem pracy było wyprowadzenie kultur kalusowych z mikrospor miskanta w
róŜnych fazach rozwoju. Ponadto, podjęto próbę ograniczenia produkcji związków
fenolowych przez eksplantaty stosując poŜywki o róŜnym składzie hormonalnym, a
takŜe zmodyfikowanych dodatkiem związków hamujących produkcję fenoli: kwasu αaminooksyoctowego (AOA) – inhibitora amoniakoliazy fenyloalaniny oraz poliwinylopirolidonu (PVP).
Materiał i metody
Indukcja kalusa
Kalus indukowano z wiech o długości od 0,5 do 20 cm (fot. 1). Kwiatostany
zamknięte w pochwie liściowej dezynfekowano w 70% etanolu przez 1 minutę
i w roztworze komercyjnego środka dezynfekującego Domestos (1 : 10) przez 20 minut,
a następnie płukano trzykrotnie w sterylnej wodzie dejonizowanej. Kwiatostany o
długości od 0,5 do 2 cm wykładano w całości na poŜywki, natomiast większe wiechy
cięto na fragmenty o długości ok. 1 cm. Z wiech o długości 20 cm izolowano równieŜ
zaląŜnie i pylniki. Kultury zakładano na poŜywkach agarowych i płynnych
zawierających makro- i mikroelementy według MURASHIGE i SKOOGA [1962] uzupełnione
500 mg⋅dm-3 hydrolizatu kazeiny i 100 mg⋅dm-3 mezoinozytolu oraz: 1) 5 mg⋅dm-3 2,4D (kwasu 2,4-dichlorofenoksyoctowego), 2) 2 mg⋅dm-3 dikamby (kwasu 3,6-dichloro-oanyŜowego) i 3) 5 mg⋅dm-3 2,4-D i 0,1 mg⋅dm-3 BAP (benzyloaminopuryny). PoŜywki
agarowe rozlewano po 20 cm3 do szalek o średnicy 10 cm. Na jedną szalkę wykładano
20 eksplantatów. PoŜywki płynne rozlewano po 100 cm3 do kolb Erlenmayera o
objętości 300 cm3. Do jednej kolby wkładano 10 eksplantatów. Wszystkie kultury
przetrzymywano w ciemności w 25°C. Kultury płynne wytrząsano (60 cpm).
KULTURY in vitro MISKANTA OLBRZYMIEGO ...
177
Fot. 1. Niedojrzałe kwiatostany miskanta. A - 0,5 cm (powiększenie 10 x) B - 5-20 cm)
Photo 1.
Immature inforrescences of Miscanthus × gigantheus. A - 0.5 cm (magnification 10
x) B - 5-20 cm
Kultury mikrospor
Kultury mikrospor wyprowadzano z niedojrzałych pylników pobieranych
z całych wiech o długości około 30 cm. Mikrospory były w róŜnych fazach rozwojowych, jedno- lub dwujądrowe. Wiechy były sterylizowane przez 1 minutę w 70%
etanolu, potem w wodnym roztworze Domestosu (w rozcieńczeniu 1 : 10) przez 20
minut, a następnie trzykrotnie płukane w wodzie sterylnej. Kwiatostany pocięte na
segmenty rozdrabniano w homogenizatorze przeznaczonym do uwalniania mikrospor
(tzw. blenderze Warringa) w ok. 10 cm3 0,3 M roztworze mannitolu. Zawiesinę
mikrospor przesączano przez sitko o średnicy oczek 80 µm, przenoszono do probówek i
odwirowywano przez 7 minut przy 100 x g. Supernatant usuwano, a zawiesinę
mikrospor rozprowadzano w 2 cm3 0,3 M mannitolu. Następnie przy uŜyciu pipety
Pasteur’a zawiesinę delikatnie nanoszono na warstwę 21% maltozy i ponownie
odwirowywano przy 80 x g przez 10 minut. śywe komórki pozostające na granicy faz
zbierano i przenoszono do ok. 5 cm3 0,3 M roztworu mannitolu i ponownie
odwirowywano przy 100 x g. Supernatant usuwano, osadzone na dnie próbówek
mikrospory rozprowadzano w 1,5 cm3 poŜywki ZHUANG i JIA [1983] w modyfikacji
PAUK’A i in. [2000], a następnie przenoszono do szalek o średnicy 3 cm. Dodatkowo, na
kaŜdą szalkę, wykładano po 10 zaląŜni, które wspomagały przetrwanie mikrospor.
Kultury mikrospor przetrzymywano w ciemności w temp. 26°C przez około 6 tygodni.
Ocena wpływu inhibitorów produkcji związków fenolowych
Wpływ inhibitorów na akumulację fenoli badano na poŜywkach stałych o takim
samym składzie jak poŜywki 1, 2 i 3. KaŜda z nich była sporządzona w trzech
wariantach a) z dodatkiem 1 mM AOA b) 2% PVP oraz c) jako poŜywka kontrolna bez
inhibitorów. Ocenę wizualną przeprowadzono po 2 miesiącach kultury na podstawie
akumulacji ciemnych produktów utleniania związków fenolowych wokół eksplantatów.
Analiza zawartości związków fenolowych
Zawartość związków fenolowych oceniano w kontrolnych poŜywkach płynnych
po 2 miesiącach kultury metodą spektrofotometryczną (Spektrofotometr LKB Ultrospec
II) oraz metodą cieczowej chromatografii HPLC.
Widmo spektrofotometryczne sporządzano w zakresie długości fali 210-400 nm.
Pomiar dokonywano w 3 cm3 kwarcowej kuwetce pobierając 0,2 cm3 poŜywki do 2,8
cm3 wody destylowanej. Jako ślepą próbę stosowano wodę.
W analizie chromatograficznej uŜyto standardów następujących kwasów
fenolowych (SIGMA): p-kumarowy – 4,6 min., chlorogenowy – 2,37, protokatechowy
– 1,89, trans-ferulowy – 5,34, kawowy – 2,98, syringowy – 3,1, p-hydroksybenzoesowy
178
A. PłaŜek i inni
– 2,53, salicylowy – 4,7, 2,6-dihydroksybenzoesowy – 2,24, 2,5-dihydroksybenzoesowy
– 1,8, 2,3-dihydroksybenzoesowy – 1,77, wanilinowy – 2,85 oraz alkohol
2-hydroksybenzylowy – 2,68 oraz oznaczono ich czas retencji.
Wyniki i dyskusja
Wydajność indukcji kalusa miskanta na zastosowanych poŜywkach była bardzo
mała, dlatego teŜ nie podano danych dotyczących liczby uzyskanych kalusów i nie
poddano ich analizie statystycznej. PETERSON [1997] takŜe donosiła o bardzo małej
wydajności w uzyskiwaniu kalusów z róŜnych części wegetatywnych i generatywnych
roślin Miscanthus × ogiformis, oraz próbach jej podniesienia poprzez dodawanie
cytokininy do poŜywek indukujących kalusowanie.
Fot. 2. Akumulacja związków fenolowych wokół ekspantantów miskanta na poŜywce agarowej
(powiększenia 3 x)
Photo 2.
Accumulation of phenolic compounds around Miscanthus explants on the agar
medium (magnification 3 x)
W prezentowanym eksperymencie kalus uzyskano jedynie na poŜywkach
agarowych z niedojrzałych wiech o długości powyŜej 8 cm. Indukcja kalusa trwała
około 2 miesięcy. Eksplantaty ciemniały juŜ po 2-3 dniach od momentu izolacji. W
związku z silnym gromadzeniem się związków fenolowych wokół eksplantatów,
tworzący się kalus pasaŜowano co 2 tygodnie na świeŜą poŜywkę (fot. 2). Kalus o białej
grudkowatej strukturze tworzył się na poŜywce MS z dodatkiem 5 mg⋅dm-3 2,4-D (fot.
3). LEWANDOWSKI i KAHNT [1993] największą wydajność w uzyskiwaniu kalusa z
niedojrzałych kwiatostanów miskanta uzyskali na poŜywce MS z dodatkiem 6,5
mg⋅dm-3 2,4-D oraz 0,25 mg⋅dm-3 BAP. W prezentowanym doświadczeniu nie
wykazano pozytywnego wpływu cytokininy na ilość indukowanego kalusa, jednakŜe
wynik ten moŜe być związany z toksycznym działaniem związków fenolowych
produkowanych na wszystkich rodzajach poŜywek, niezaleŜnie od ich składu
hormonalnego. Dodanie AOA czy PVP nie ograniczyło produkcji związków
fenolowych przez eksplantaty.
KULTURY in vitro MISKANTA OLBRZYMIEGO ...
179
Fot. 3. Grudkowy kalus rozwijający się z niedojrzałego kwiatostanu miskanta na poŜywce MS + 5
mg⋅dm-3 2,4-D (powiększenie 10 x)
Photo 3.
Globular callus developing from immature Miscanthus inflorescences on the MS
medium + 5 mg⋅dm-3 of 2,4-D (magnification 10 x)
Izolowane zaląŜnie i pylniki szybko ciemniały i obumierały juŜ w pierwszym
tygodniu kultury (fot. 4). RównieŜ z kultur mikrospor nie udało się uzyskać kalusa,
aczkolwiek obserwowane w ciągu pierwszych dni komórki charakteryzowały się dobrą
Ŝywotnością (fot. 5). Nie wykazywały one jednak zdolności do podziałów. Przypuszcza
się, Ŝe metoda ta moŜe być wykorzystywana w przyszłości, ale będzie wymagać
pewnych modyfikacji np. składu poŜywki indukcyjnej, określenia optymalnego stadium
rozwojowego mikrospor w momencie izolacji, wprowadzenia łagodnego stresu
indukującego podziały w obrębie mikrospor, czy teŜ zmiany warunków hodowli in
vitro.
A. PłaŜek i inni
180
Fot. 4. Ciemniejące pylniki i zaląŜnia miskanta (powiększenie 10 x)
Photo 4.
Darkened anthers and ovary of Miscanthus (magnification 10 x)
Fot. 5. Mikrospory miskanta (powiększenie 400 x)
Photo 5.
Microspores of Miscanthus (magnification 400 x)
W poŜywkach płynnych, niezaleŜnie od składu hormonalnego, nie uzyskano
tkanki kalusowej. W poŜywce nr 1 i 2 eksplantaty bardzo szybko brązowiały.
W poŜywce nr 3 eksplantaty takŜe ściemniały, ale w mniejszym stopniu w porównaniu
do tkanek w poŜywkach 1 i 2. PoŜywka nr 3, zawierająca oprócz auksyny takŜe BAP,
była zdecydowanie jaśniejsza od pozostałych, poniewaŜ było w niej zdecydowanie
mniej fenoli utlenionych, w porównaniu do poŜywek 1 i 2, jak równieŜ porównując do
poŜywki agarowej nr 3 o tym samym składzie hormonalnym (rys. 1). Reakcja ta moŜe
być wyjaśniona wpływem cytokininy, która moŜe częściowo łagodzić wpływ stresu,
jakim jest zranienie tkanki, oraz hamować proces utleniania fenoli. Dodanie cytokininy
do poŜywki agarowej nie zapobiegło jednak gromadzeniu się fenoli wokół wyłoŜonej
tkanki.
1400
PoŜywka
(Medium) nr 1
PoŜywka
(Medium) nr 2
PoŜywka
(Medium) nr 3
ABSx1000
1200
1000
800
600
400
200
40
0
39
0
38
0
37
0
36
0
35
0
34
0
33
0
32
0
31
0
30
0
29
0
28
0
27
0
26
0
25
0
24
0
23
0
22
0
21
0
0
długość fali (wave length) [nm]
Rys. 1.Spektrum absorbancji (210-400 mm) związków fenolowych wydzielonych w płynnych
kulturach niedojrzałych kwiatostanów miskanta. Skład poŜywek: 1) 5 mg⋅dm-3 2,4-D;
KULTURY in vitro MISKANTA OLBRZYMIEGO ...
181
2) 2 mg⋅dm-3 dikamby; 3) 5 mg⋅dm-3 2,4-D i 0,1 mg⋅dm-3 BAP
Fig. 1. Absorbance spectrum (210-400 mm) of phenolic compound secreted into liquid media by
the immature inforescences of Miscanthus. Composition of media: 1) 5 mg⋅dm-3 2,4D; 2) 2 mg⋅dm-3 dicamba; 3) 5 mg⋅dm-3 2,4-D and 0.1 mg⋅dm-3 BAP
Analiza HPLC nie wykazała obecności Ŝadnego kwasu fenolowego uŜytego jako
standard. Wynik ten moŜna by uzasadnić tym, Ŝe analiza chromatograficzna była
wykonana w okresie, gdy prawdopodobnie nastąpił juŜ proces utlenienia kwasów
fenolowych wydzielonych do poŜywek.
Uzyskane wyniki wskazują, jak duŜą barierą w wyprowadzeniu kultur tkankowych miskanta olbrzymiego jest silna reakcja tego gatunku na stres, objawiająca się
gwałtowną produkcją związków fenolowych. Związki te ograniczają rozwój kalusa i
działają toksycznie na tkankę. Do tej pory autorom udało się podtrzymywać rozwój
jedynie niewielkiej części uzyskanych kalusów, dzięki częstemu pasaŜowaniu ich na
nową poŜywkę. Kalusy te jednak tworzą się na ciemnych, obumarłych częściach
eksplantatów, a kaŜdy pasaŜ powoduje ponowne obumieranie części pasaŜowanego
kalusa.
Problem kultur in vitro miskanta rzadko jest podejmowany przez naukowców,
stąd teŜ w literaturze światowej mało jest na ten temat danych. LEWANDOWSKI i KAHNT
[1993] przytaczają przykłady bezskutecznego stosowania kwasu askorbinowego,
cysteiny czy węgla aktywnego w celu ograniczenia akumulacji związków fenolowych w
kulturach miskanta. Autorzy ci uzyskali embriogenny kalus z niedojrzałych
kwiatostanów tej rośliny w kulturach płynnych stosując tzw. „tratwy”, dzięki którym
produkowane fenole były wymywane z tkanki, co zapobiegało bezpośredniemu
kontaktowi toksycznych związków z tkanką. Z kolei HOLME i in. [1997] donoszą o
zwiększeniu wydajności w indukcji embriogennego kalusa z niedojrzałych
kwiatostanów miskanta poprzez dodawanie do poŜywki proliny, ale nie wspominają nic
o brązowieniu tkanek. Rozwiązanie tego problemu będzie zatem przełomem w
rozwinięciu produkcji kalusa miskanta olbrzymiego i rozpoczęciu badań nad indukcją
zmienności somaklonalnej.
Wnioski
1.
Kwas α-aminooksyoctowy (AOA) oraz poliwinylo-pirolidon (PVP) nie hamują
gromadzenia się produktów utleniania fenoli w poŜywce indukującej kalus
miskanta olbrzymiego.
2.
WzmoŜona produkcja fenoli w reakcji na stres zranienia eksplantatu hamuje
rozwój kalusa miskanta.
3.
Obecność Ŝywotnych mikrospor miskanta stwarza moŜliwość uzyskania regenerantów jednakŜe metoda ta wymaga dopracowania.
Literatura
BHAT S.R., CHANDEL K.P.S. 1991. A novel technique to overcome browning in tissue
culture. Plant Cell Rep. 10: 358-361.
182
A. PłaŜek i inni
HUMPHREYS M.W., ZARE A.G., PAŠAKINSKIENË I., THOMAS H., ROGERS W.J., COLLIN H.A.
1998. Interspecific genomic rearrangements in androgenic plants derived from a Lolium
multiflorum × Festuca arundinacea (2n = 5x = 35) hybrid. Heredity 80: 78-82.
HOLME I.B., KROGSTRUP P., J. HANSEN. 1997. Embryogenic callus formation, growth and
regeneration in callues and suspension culture of Miscanthus x ogiformis Honda
‘Gigantheus’ as affected by proline. Plant Cell Tiss. Org. Cult. 50: 203-210.
LAUKKANEN H., HIGGMAN H., KONTUNEN-SOPPELN S., HOHTOLN A. 1999. Tissue browning
of in vitro cultures of Scots pine: Role of peroxidase and polyphenol oxidase. Physiol.
Plant. 106: 337-343.
LEWANDOWSKI I. 2006. Miscanthus – a multifunctional biomass crop for the future,
w: Alternative plants for sustainable agriculture. S. JeŜowski, M.K. Wojciechowicz, E.
Zenkteler (Ed.), PAGEN, Centre of Excellence in Plant Agrobiology and Molecular
Genetics, Institute of Plant Genetics, Polish Academy of Sciences 5: 83-90.
LEWANDOWSKI I., KAHNT G. 1993. Development of a tissue culture system with unemerged
inflorescence of Miscanthus ‘Gigantheus’ for the induction and regeneration of somatic
emrbryoids, w: Beiträge zur Biologie der Pflanzen. H. Schraudolf, S. Vogel, F.
Weberling (Eds). Duncker & Humblot, Berlin: 439-451.
LORENZO J.C., BLANCO M., PELÁEZ O., GONZÁLES A., CID M., IGLESIAS A., GONZÁLES B.,
ESCALONA P., ESPINOSA P., BORROTO C. 2001. Sugarcane micropropagation and phenolic
excretion. Plant Cell & Org. Cult. 65: 1-8.
MURASHIGE T., SKOOG F. 1962. A revised medium for rapid growth and bioassays with
tobacco tissue cultures. Physiol. Plant. 15: 473-497.
PAUK J., PUOLIMATKA M., TÓK L., MONOSTORI T. 2000. In vitro androgenesis of triticale in
isolated microspore culture. Plant Cell Tiss. Org. Cult. 61: 221-229.
PETERSEN K.K. 1997. Callus induction and plant regeneration in Miscanthus x ogiformis
Honda ‘Gigantheus’ as influenced by benzyladenine. Plant Cell. Tissue Org. Cult. 9:
137-140.
ZHUANG J.J., JIA X. 1983. Increasing differentiation frequencies in wheat pollen callus,
w: Cell and Tissue Culture Techniques for Cereal Crop Improvement. Hu H.,Vega M.R.
(Eds), Science Press, Beijing: 431.
Słowa kluczowe: cytokinina, kalus, kwas α-aminooksyoctowy, kwiatostany, mikrospory, poliwinylopirolidon, zaląŜnie, związki fenolowe
Streszczenie
Podjęto próbę wyprowadzonia kultur kalusowych z kwiatostanów miskanta
(Miscanthus × gignatheus) w róŜnych fazach rozwoju, z izolowanych kwiatków, a takŜe
z zaląŜni i mikrospor. Ponadto, zbadano moŜliwość ograniczenia produkcji związków
fenolowych przez eksplantaty, stosując poŜywki o róŜnym składzie hormonalnym,
a takŜe zmodyfikowane dodatkiem związków hamujących produkcję fenoli: kwasu αaminooksyoctowego (AOA) – inhibitora amoniakoliazy fenyloalaniny oraz poliwinylopirolidonu (PVP).
Kalus uzyskano jedynie na poŜywkach agarowych z niedojrzałych wiech
o długości powyŜej 8 cm. Indukcja kalusa trwała około 2 miesięcy. Większość eksplantatów ciemniała juŜ po 2-3 dniach od wyłoŜenia na poŜywkę. Najwięcej przypadków tworzenia się kalusa o białej grudkowatej strukturze obserwowano na poŜywce
MS z dodatkiem 5 mg⋅dm-3 2,4-D.
Nie wykazano pozytywnego wpływu cytokininy na ilość indukowanego kalusa.
KULTURY in vitro MISKANTA OLBRZYMIEGO ...
183
W kulturach płynnych związek ten jednakŜe ograniczał ilość utlenionych związków
fenolowych. Dodanie AOA czy PVP nie hamowało nagromadzania się związków
fenolowych w kulturach. Izolowane zaląŜnie i pylniki takŜe szybko ciemniały i
obumierały juŜ w pierwszym tygodniu kultury. RównieŜ z kultur mikrospor nie udało
się uzyskać kalusa, aczkolwiek obserwowane w ciągu pierwszych dni hodowli komórki
charakteryzowały się dobrą Ŝywotnością. Nie wykazywały one jednak zdolności do
podziałów.
Uzyskane wyniki wskazują, jak duŜą barierą w wyprowadzeniu kultur tkankowych miskanta olbrzymiego jest silna reakcja tego gatunku na stres, objawiająca się
gwałtowną produkcją związków fenolowych. Rozwiązanie tego problemu będzie zatem
kluczowe dla rozwinięcia produkcji kalusa miskanta olbrzymiego i rozpoczęcia badań
nad indukcją zmienności somaklonalnej.
In vitro CULTURE OF Miscanthus × gigantheus
Agnieszka PłaŜek 1, Franciszek Dubert 1, 2 , Iwona śur 2, Piotr Waligórski 2
1
Department of Plant Physiology, Polish Academy of Science, Kraków
2
Department of Plant Physiology, Agricultural University, Kraków
Key words:
α-aminoxyacetic acid, callus, cytokinin, inflorescences, microspores,
ovaries, phenolic compounds, polivinylpirrolidone
Summary
The aim of the study was the initiation of callus from the immature inflorescences
at different development phases, and also from isolated flowers, ovaries and
microspores of Miscanthus x gigantheus. Moreover, an effort was made to limit the
phenolic synthesis by explants using media supplemented with different hormones and
modified with such compounds inhibiting phenolic production as α-aminoxyacetic acid
(AOA) or polivinylpirrolidone (PVP).
Callus was obtained only on agar media from the immature inflorescences longer
than 8 cm. Callus was obtained after 2 month-culture. The most explants darkened
already 2-3 days after the isolation. White callus with globular-structure was initiated
only on MS medium supplemented with 5 mg⋅dm-3 of 2,4-D.
Cytokinine had no positive effect on the number of obtained calli. However,
contrary to AOA or PVP in liquid media this hormone limited the amount of oxidized
phenolics. Isolated ovaries and anthers also darkened quickly and died already during
the first week of culture. Isolated microspores were characterized by a high vitality but
they did not divide, and no callus was induced from then.
The results obtained indicate what a big barrier for the induction of callus culture
of Miscanthus is its strong reaction to stress manifested with phenolic synthesis. The
solution of this problem would be crucial to the production of callus of Miscanthus x
gigantheus and the beginning of studies on the somaclonal variation.
Dr hab. Agnieszka PłaŜek
Katedra Fizjologii Roślin
Akademia Rolnicza im. H. Kołłątaja
ul. PodłuŜna 3
30-239 KRAKÓW
e-mail: [email protected]
184
A. PłaŜek i inni
ZESZYTY PROBLEMOWE POSTĘPÓW NAUK ROLNICZYCH 2007 z. 523: 185-193
SOMATIC EMBRYOGENESIS IN CALLUS CULTURES
OF TOMATO Lycopersicon peruvianum (L.) MILL.
Danuta Rzepka-Plevneš, Danuta Kulpa, Jadwiga Kurek
Department of Horticulture Plant Breeding, Agricultural University, Szczecin
Introduction
The continuous progress in breeding of most cultivated plants is, to a considerable degree, limited by a lack of material for breeding and principally its small
variability. Artificially created mutants and natural populations of wild species may
constitute such a source because, among them, one may find genotypes resistant to
diseases and pests as well as plants well adapted to local conditions. Cultivated varieties
of tomato are very susceptible to numerous bacterial, fungous and viral diseases. One
must also remember their considerable susceptibility to nematodes. In the light of
studies hitherto conducted genotypes occurring among L. peruvianum (L.) MILL., L.
hirsutum HUMB. et BONP. and L. peruvianum (L.) MILL. var. glandulosum ined. may be
considered the most valuable in breeding of tomato varieties resistant to diseases and
pests [CANO et al. 1998; PICO et. al 2000, 2002].
The transfer of individual genes from one species to another is usually extremely
difficult, sometimes impossible by using the conventional breeding methods [SEGEREN et
al. 1993; SACKS et al. 1997]. In the case of numerous cultivated plants, including tomato it
is possible by means of genetic transformation and production of somatic crosses [CHEN,
ADACHI 1998; DE FARIA et al. 2002]. In both cases to multiply the forms obtained somatic
embryogenesis can be used. In the last years more and more attention is paid to this
method as a way of micropropagation of plants on a production scale [CANO et al. 1990,
DUZYAMAN et al. 1994; CHEN et al. 1999]. Thus all studies on this subject are of extreme
importance.
An attempt at multiplying L. esculentum × L. peruvianum crosses was undertaken
by CHEN and ADACHI [1998]. To initiate the culture those authors used fragments of
hypocotyls obtained as a result of germination of the crossed embryos. The present
work concentrates on L. peruvianum and determines the optimal, for this species, level
of plant growth regulators in the culture, necessary for initiation of the somatic
embryogenesis and also for the subsequent regeneration of plants obtained from somatic
embryos. The studies comprise a part of a wider work, devoted to the search for forms
tolerant to soil salination among wild species and cultivated varieties of tomato.
The aim of the study was to determine the effects of the PGRs on the somatic
embryogenesis in the cultures of Lycopersicon peruvianum (L.) MILL.
Material and methods
The seeds of L. peruvianum (L.) MILL. were obtained from the Tomato Genetics
Resource Centrum University of California, Davis (origin - Peru, in the vicinity of
Lima). The experiment was conducted in three stages. During the first the callus was
initiated and multiplied, during the second the somatic embryogenesis was initiated and
D. Rzepka-Plevneš, D. Kulpa, J. Kurek
186
during the third the mature embryoids were regenerated [BHOJWANI, RAZDAN 1990;
MONNIER 1990]. The callus was initiated on the cotyledon fragments of 14-day-old
seedlings of L. peruvianum grown on MS mediums supplemented with cytokinine BAP
and auxins IAA and NAA (Tab. 1). The callus obtained after four weeks was measured
twice. During the first transfer onto the fresh medium, different concentrations of
cytokinine BAP and auxin NAA were used (Tab. 2), while during the second - 2
mg⋅dm-3 BAP and 1 mg⋅dm-3 IAA. During both stages, the callus fragments 3 mm in
diameter and weighing 0.05 g were used as explants. Each multiplication stage lasted
four weeks and 100 explants were analysed per experiment.
Table 1; Tabela 1
Influence of plant growth regulators on callus initiation
in cotyledon cultures of Lycopersicum peruvianum
Wpływ roślinnych regulatorów wzrostu na inicjacje kalusa
w kulturach liścieni Lycopersicum peruvianum
Growth regulators
Roślinne regulatory wzrostu
(mg⋅dm-3)
Colour
Zabarwienie
0.10e1
green, loose; zielony, luźny
green, loose; zielony, luźny
BAP
IAA
2,4-D
1.0
0.5
0.0
1.0
1.0
0.0
0.15e
1.0
2.0
0.0
0.39de
green, loose; zielony, luźny
1.0
0.0
1.0
0.05e
darkgreen, compact; ciemnozielony, zbity
1.0
0.0
2.0
0.13e
darkgreen, compact; ciemnozielony, zbity
2.0
0.5
0.0
0.29e
green, loose; zielony, luźny
2.0
1.0
0.0
0.59cd
green, loose; zielony, luźny
2.0
2.0
0.0
0.89ab
lightgreen; jasnozielony
2.0
0.0
1.0
0.59cd
darkgreen, compact; ciemnozielony, zbity
2.0
0.0
2.0
0.78bc
darkgreen, compact; ciemnozielony, zbity
5.0
0.5
0.0
0.46cd
green, loose friable; zielony, luźny gruzełkowaty
5.0
1.0
0.0
0.68bc
green, loose fraible; zielony, luźny gruzełkowaty
5.0
2.0
0.0
1.09a
green, loose friable; zielony, luźny gruzełkowaty
5.0
0.0
1.0
0.64bcd
darkgreen, compact; zielony, luźny gruzełkowaty
5.0
0.0
2.0
0.72bc
darkgreen, compact; zielony, luźny gruzełkowaty
0.05e
lightgreen; jasnozielony
Control; Kontrola
1
Mass of
initiated callus
Masa zainicjowanego kalusa
(g)
different letters within columns indicate significant differences at p < 0.95, using Tuckey’s test, LSD
= 0.26; róŜne litery wskazują na róŜnice istotne według testu Tuckey’a przy poziomie istotności p <
0,95, NIR 0,26
Somatic embryogenesis was induced on MS medium supplemented with different
levels of auxins IBA, IAA and NAA (Tab. 3). After eight weeks of culture the mature L.
peruvianum embryos were transferred to a full and half-strength MS mediums,
supplemented with different concentrations of IAA and KIN (Tab. 4). Hormone-free
medium was used as a control.
Table 2; Tabela 2
Callus proliferation after 4 weeks on MS medium with various composition
of plant growth regulators
SOMATIC EMBRYOGENESIS IN CALLUS CULTURES OF TOMATO ...
187
NamnaŜanie się kalusa po czterech tygodniach namnaŜania
na poŜywkach o zróŜnicowanym składzie hormonalnym
Growth regulators; Roślinne regulatory wzrostu
(mg⋅dm-3)
BAP
NAA
1.0
0.0
1.0
1.0
0.05c
1.0
2.0
0.12bc
1.0
4.0
0.24b
1.0
6.0
0.12bc
2.0
0.0
0.05c
2.0
1.0
0.14bc
2.0
2.0
0.21bc
2.0
4.0
0.14bc
2.0
6.0
0.12bc
5.0
0.0
0.13bc
5.0
1.0
0.45ab
5.0
2.0
0.89a
5.0
4.0
0.87a
5.0
6.0
Control; Kontrola
1
Mass of proliferated callus
Masa namnoŜonego kalusa
(g)
0.05c
0.67a
0.01c
Different letters within columns indicate significant differences at p < 0.95, using Tuckey’s test, LSD
= 0.02; róŜne litery wskazują na róŜnice istotne według testu Tuckey’a przy poziomie istotności p <
0,95, NIR 0,02
Experiment were conducted in a phytotron at a temperature of 24°C, relative air
humidity of 70-80%, fluorescent lighting of 40 PAR (µE⋅M-2⋅s-1) and day length of 16
hours. The pH of the medium was adjusted to 5.6, the growth regulators were added to
the medium before its sterilization.
Results and discussion
Various plant tissues may be a source of the callus. CHEN and ADACHI [1998]
inducted the callus on the cotyledons of young seedlings of L. esculentum, CANO et al.
[1998] on leaf fragments obtained from cultivated tomato varieties regenerated from
shoot apex in the in vitro cultures. In the present studies selected cotyledon fragments
and shoot apex of 14 day-old seedlings were used as explants. The callus cultures were
initiated on the cotyledon fragments. The weight, colour and structure of the callus
obtained are presented in Table 1. A dark green compact callus was characteristic for 6
experimental combinations. In each of them the medium initiating the formation of the
callus contained 1 or 2 mg⋅dm-3 2,4-D and 1, 2 or 5 mg⋅dm-3 BAP. A green and loose
callus was obtained on 5 medium combinations in which 2,4-D was replaced by IAA. If
the medium contained no 2,4-D also a light-green, friable callus was formed on the
cotyledon. The callus obtained on a MS hormone free medium was light green in
colour. Significantly most calluses were obtained on a MS medium supplemented with
D. Rzepka-Plevneš, D. Kulpa, J. Kurek
188
5 or 2 mg⋅dm-3 BAP and 2 mg⋅dm-3 IAA. The callus was friable and light-green. The
smallest amount of callus (0.05 g) was formed on the control medium and on the MS
medium supplemented with 1 mg⋅dm-3 BAP and 1 mg⋅dm-3 2,4-D. A poor callus
initiation was observed also on the media marked in Table 1 by numbers 1 to 6.
The callus was transferred to 15 mediums containing different levels of PGRs:
BAP and NAA. A hormone free medium was the control (Tab. 2). The greatest increase
in the weight of callus (0.89, 0.87, 0.67 g) was obtained on MS mediums supplemented
with 5 mg⋅dm-3 BAP and 2, 4 or 6 mg⋅dm-3 NAA. However, this callus was watery, not
capable to differentiate shoots and embryogenesis. During the observations of callus
lines obtained, a selection was conducted for the structure desired. As far as the
capability capable of embryogenesis was considered the callus of a small weight (0.14
g), was multiplied on a MS medium supplemented with 2 mg⋅dm-3 BAP and 1 mg⋅dm-3
NAA. After it was again passaged onto a medium with the same hormone composition
another selection was conducted, the tissue that was not uniform was removed and the
somatic embryogenesis was initiated.
The composition of the medium initiating somatic embryogenesis is one of the
most important factors of the in vitro culture, decisive as regards of the possible success. Among the most often used mediums is the standard MS medium, supplemented
with auxins and in particular 2,4-D - 0.5 to 1 mg⋅dm-3 [BHOJWANI, RAZDAN 1990; MONNIER
1990]. CHANDEL et al. [2000] for the initiation of embryogenesis in cultures of tomato used
auxin NAA (1 mg⋅dm-3) and cytokine BAP (1,5 mg⋅dm-3). The cultures were maintained
in darkness.
In the present studies embryogenesis was induced using two auxins, IAA and 2,4D, without cytokine (four combinations) as well as 2 or 5 mg⋅dm-3 of BAP (Tab. 3). In
the media without cytokine the formation of an embryogenic callus was not observed,
similarly as in the samples containing 2 mg⋅dm-3 of BAP and 2 mg⋅dm-3 of IAA. The
remaining experimental combinations resulted in a mean of 0.5 to 8.9 embryos (5 to
89% of the explants used). In the case of L. peruvianum, BAP was proved to be an
important and necessary growth hormone in the formation of somatic embryos. Their
greatest number (a mean of 8.9 and 6.7 per explant) was obtained on the medium
containing 5 mg⋅dm-3 of BAP and 2 mg⋅dm-3 2,4-D and on the medium 11, containing 5
mg⋅dm-3 of BAP and 2 mg⋅dm-3 2,4-D (Tab. 3, Photo 1, 2). In the control the formation
of an embryogenic callus was not observed.
Table 3; Tabela 3
Number of initiated somatic embryo on medium with different growth
regulators composition
Liczba tworzących się zarodków somatycznych na poŜywkach
o zróŜnicowanym składzie hormonalnym
Growth regulators; Roślinne regulatory wzrostu
(mg⋅dm-3)
Numbers of somatic embryo per 1 g callus
Liczba zarodków somatycznych przypadających na 1
g tkanki kalusowej
BAP
IAA
1
2
2,4-D
3
4
0.0
2.0
0.0
0.0
0.0
4.0
0.0
0.0
0.0
0.0
2.0
0.0
0.0
0.0
4.0
0.0
SOMATIC EMBRYOGENESIS IN CALLUS CULTURES OF TOMATO ...
2.0
2.0
0.0
0.0
2.0
4.0
0.0
0.5
2.0
0.0
2.0
2.8
2.0
0.0
4.0
2.3
5.0
2.0
0.0
3.1
5.0
4.0
0.0
4.5
5.0
0.0
2.0
6.7
5.0
0.0
4.0
8.9
Control; Kontrola
Photo 1.
189
0.0
Embryogenic callus prolifered on medium with 5 mg⋅dm-3 BAP and 4 mg⋅dm-3 2,4-D
(bar reperesent 1 mm)
Fot. 1. Kalus embriogeniczny namnaŜany na poŜywce uzupełnionej 5 mg⋅dm-3 BAP and 4
mg⋅dm-3 2,4-D (pasek oznacza 1 mm)
D. Rzepka-Plevneš, D. Kulpa, J. Kurek
190
Somatic embryo at globular and cotyledonous stage on MS medium with 5 mg⋅dm-3
BAP and 4 mg⋅dm-3 2,4 D (bar reperesent 1 mm)
Fot. 2. Zarodki somatyczne pomidora w stadium globularnym i zaraodka dojrzałego indukowane
na poŜywce MS, uzupełnionej 5 mg⋅dm-3 BAP i 4 mg⋅dm-3 2,4 D (pasek oznacza 1
mm)
Photo 2.
Table 4; Tabela 4
Influence of medium composition on regeneration of somatic embryo
Wpływ składu poŜywki na procent zregenerowanych zarodków somatycznych
Mineral
composition
Skład mineralny
Growth regulators
Roślinne regulatory wzrostu
(mg⋅dm-3)
Percent of regenerated
embryo
Procent zregenerowanych
zarodków
Percent of
control
Procent
kontroli
IAA
kinetin
MS
0.2
0.0
62
127
MS
0.4
0.0
69
141
MS
0.0
0.2
98
200
MS
0.0
0.4
87
178
1/2MS
0.2
0.0
7
14
1/2MS
0.4
0.0
9
18
1/2MS
0.0
0.2
22
45
1/2MS
0.0
0.4
29
59
49
100
Control; Kontrola
The L. peruvianum embryos, obtained in the experiment presented here,
demonstrated a good regenerating ability on the MS medium containing the basic
inorganic salts and organic compounds supplemented with auxin IAA or kinetin (Tab.
4). The greatest number of regenerated embryos (80 and 78%) was observed on the
medium containing 0.2 and 0.4 mg⋅dm-3 kinetin, respectively. Supplementing BAP with
IAA (0.4 and 0.2 mg⋅dm-3) lowered the regeneration ability of embryos by about 20%.
Reducing the nutritive components in the MS medium by half had, in the case of L.
peruvianum, a negative effect on the regeneration of the embryos obtained.
The obtained results indicate that somatic embryogenesis may be successfully
used for a rapid reproduction of L. peruvianum plants and all selection work conducted
on this tomato species on the level of in vitro culture.
References
BHOJWANI S.S., RAZDAN M.K. 1990. Plant tissue culture: theory and practice. Deve-
lopments in Crop Science, Elsevier 5: 125-169.
CANO E.A., MORENO V., ROMERO M, BOLARIN M.C. 1990. The role of culture medium,
explants source and genotype on callus growth in cultivated and wild tomato species
and interspecific hybrids. Proceedings of the XIth Eucarpia meeting on tomato genetics:
167-172.
CANO E.A., PEREZ-ALFOCEA F., MORENO V., CARO M., BOLARIN M. 1998. Evaluation o salt
SOMATIC EMBRYOGENESIS IN CALLUS CULTURES OF TOMATO ...
191
tolerance in cultivated and wild tomato species through in vitro shoot apex culture.
Plant Cell Tiss. Org. Cult. 53: 19-26.
CHANDEL G., KATIYAR S.K., CHANDEL G. 2000. Organogenesis and somatic embryogenesis in tomato (Lycopersicon esculantum Mill.). Adv. in Plant Sci. 13: 11-17.
CHEN H., ZHANG J., ZHUANG T., ZHOU G. 1999. Studies on optimum hormone levels for
tomato plant regeneration from hypocotyls explants cultured in vitro. Acta Agric.
Shanghai 15: 26-29.
CHEN L.Z., ADACHI T. 1998. Plant Regeneration via somatic embryogenesis from cotyledon protoplasts of tomato (Lycopersicum esculentum Mill.). Breed. Sci. 44: 337-338.
DE FARIA R.T., DESTRO D., FILHO J.C.B. ILLG R.D. 2002. Introgression of in vitro regeneration capability of Lycopersicon pimpenellifolium Mill. into recalcitrant tomato
cultivars. Euphitica 124: 59-63.
DUZYAMAN E., TANRISEVER A, GUNVER G. 1994. Comparative studies on regeneration of
tomato in vitro. Acta Horti. 235-242.
MONNIER M. 1990. Induction of embryogenesis in callus culture. Pollard J.W., Walker
J.M. (Ed.), Plant Cell and Tiss. Culture Meth. in Molec. Biol. 6: 141-148.
PICO B., HERRIAZ J., RUIZ J.J., NUEZ F. 2002. Widening the genetic basis of virus resisitance in tomato. Sci. Hort 94: 73-89.
PICO B., SIFRES A., ELI M., DIEZ M.J., NUEZ F. 2000. Searching for new resistance sources
to tomato yellow leaf curl virus within a highly variable wild Lycopersicon genetic pool.
Acta Physiol. Plant. 22: 344-350.
SACKS E.J., GERHARDT L.M., GRAHAM E.B., JACOBS J., THORRUP T.A., ST. CLAIR D.A. 1997.
Variation among genotypes of tomato (Lycopersicum esculentum Mill.) for crossability
to L. peruvianum (L.) Mill. Ann. Bot. 80: 469-477.
SEGEREN M.I., SONDAHL M.R., SIQUEIRA W.J. MEDINA FILHO H.P., NAGAI H., LOURENCAO L.
1993. Tomato breeding: embryo rescue of interspecific hybrids between Lycopersicon
esculentum Mill. and Lycopersicum peruvianum (L.) Mill. Rev. Brasileira Genet. 16:
367-380.
Key words:
tomato, callus, somatic embryogenesis, plant regeneration
Summary
Investigations were conducted on the level of plant growth regulators, necessary
for the initiation of callus, somatic embryogenesis and plant regeneration in in vitro
cultures of a wild form of tomato - the Lycopersicon peruvianum. Cotyledons and shoot
apex of 14-day-old seedlings were used as explant source. Explants were inoculated on
the MS medium, supplemented with various concentrations of cytokines (BAP, KIN)
and auxins (IAA, 2,4-D, NAA). It was observed that the formation of the callus in
Lycopersicon peruvianum depended on the content of BAP and 2,4-D and IAA. The
best callus development was observed on the cotyledons placed on MS medium with 5
mg⋅dm-3 BAP and 2 mg⋅dm-3 IAA (1.09 g) or 2 mg⋅dm-3 BAP and 2 mg⋅dm-3 IAA (0.89
g). In control (hormone-free medium) callus formation was not observed. For the initiation of somatic embryogenesis in Lycopersicon peruvianum 12 medium combinations
were supplemented with BAP and IAA or 2,4-D. The largest number of emrbyoids was
obtained on mediums containing 5 or 4 mg⋅dm-3 BAP and 2 mg⋅dm-3 2,4-D. On
hormone free medium (control) no embryoids were observed. The obtained results
D. Rzepka-Plevneš, D. Kulpa, J. Kurek
192
indicate that for Lycopersicon peruvianum a somatic embryogenesis is more efficient
than the organogenesis method of plant propagation in in vitro cultures. For the
regeneration of plants through somatic embryogenesis the MS medium supplemented
with 0.2 g⋅dm-3 of kinetin proved to be optimal. Its higher or lower levels limited the
ability of embryoids to regenerate.
SOMATYCZNA EMBRIOGENEZA
W KULTURACH KALUSOWYCH Lycopersicon peruvianum (L.) MILL
Danuta Rzepka-Plevneš, Danuta Kulpa, Jadwiga Kurek
Zakład Hodowli Roślin Ogrodniczych,
Akademia Rolnicza w Szczecinie
Słowa kluczowe:
pomidor, kalus, somatyczna embriogeneza, regeneracja roślin
Streszczenie
W pracy określono wpływ roślinnych regulatorów wzrostu niezbędnych do
inicjacji kalusa, somatycznej embriogenezy i regeneracji roślin w kulturach in vitro
Lycopersicon peruvianum. Źródłem eksplantatów były liścienie 14 dniowych siewek,
poŜywką podstawową - poŜywka MS uzupełniona na kaŜdym etapie badań róŜną ilością
cytokinin (BAP, KIN) i auksyn (IAA, 2,4-D, NAA). Stwierdzono, Ŝe formowanie się
kalusa u L. peruvianum zaleŜało od ilości zastosowanej cytokiny BAP oraz auksyn 2,4D i IAA. Najwięcej obserwowano go na liścieniach wyłoŜonych na poŜywkę MS
wzbogaconą 5 mg⋅dm-3 BAP i 2 mg⋅dm-3 IAA (1,09 g) oraz 2 mg⋅dm-3 BAP i 2 mg⋅dm-3
IAA (0,89 g). W próbach kontrolnych bez hormonów wzrostu nie obserwowano
formowania się kalusa. Do inicjacji somatycznej embriogenezy u L. peruvianum
zastosowano 12 kombinacji poŜywek MS z udziałem BAP oraz IAA lub 2.4-D.
Najwięcej embrioidów otrzymano na poŜywkach uzupełnionych 5 lub 4 mg⋅dm-3 BAP i
2 mg⋅dm-3 2.4-D, ich brak - na poŜywkach bez hormonów wzrostu (kontrola) oraz bez
cytokiny BAP lub auksyny 2.4-D. Otrzymane wyniki wykazały, Ŝe somatyczna
embriogeneza jest dla L. peruvianum wydajniejszą, niŜ organogeneza, metodą
rozmnaŜania roślin w kulturach in vitro.
Prof. dr hab. Danuta Rzepka-Plevneš
Zakład Hodowli Roślin Ogrodniczych
Akademia Rolnicza
ul. Janosika 8
71-424 SZCZECIN
ZESZYTY PROBLEMOWE POSTĘPÓW NAUK ROLNICZYCH 2007 z. 523: 195-201
THE EFFECT OF INHIBITORS OF LIPOXYGENASE
AND CYCLOOXYGENASE ON THE MYCELIUM GROWTH
OF Phoma narcissi 1
Marian Saniewski, Alicja Saniewska
Research Institute of Pomology and Floriculture, Skierniewice
Introduction
Phoma narcissi (ADERH.) BOEREMA, de GRUYTER et NOORDEL. is a world wide
recorded pathogen of Hippeastrum, Narcissus, Hymenocallis (syn. Ismene) and other
species of Amaryllidaceae [SANIEWSKA 1998]. The pathogen causes red spots on various
organs of Hippeastrum × hybr. hort. Isolates of Phoma narcissi from Hippeastrum,
Narcissus and Hymenocallis were pathogenic to all three species; it indicates the
possibility of infection and expansion of the disease caused by P. narcissi on different
species belonging to the family Amaryllidaceae [SANIEWSKA, ORLIKOWSKI 1989].
The effect of some biotic and abiotic factors on the growth and development of
Phoma narcissi in vitro and in vivo was previously studied. It was showed that
polyamine biosynthesis inhibitors, DL-α-difluoromethylornithine (DFMO) and DL-αdifluoromethylarginine (DFMA) at a concentration 1.0 and 3.0 mM, greatly inhibited the
mycelial growth of P. narcissi on Czapek-Dox-Agar whereas putrescine at a
concentration of 1.0 mM completely or partially reversed the inhibition. DFMO and
DFMA at a concentration of 3 mM evidently inhibited development of red spots on
Hippeastrum leaves when applied preventively [SANIEWSKA 1996]. Thus, the endogenous
polyamines are necessary compounds in the growth and development of P. narcissi.
It was found that garlic (Allium sativum L.) clove extracts and garlic-derived
ajoene and diallyl disulphide applied as vapour or added into PDA medium greatly
inhibited the mycelium growth of P. narcissi [SANIEWSKA 1998]. It is possible that the
inhibitory effect of those garlic compounds on the mycelium growth of P. narcissi is the
result of inhibition of sterols biosynthesis.
The occurrence of jasmonates, jasmonic acid (JA), methyl jasmonate (JA-Me)
and many other related compounds of JA are well known also in fungi, i.e. in
Botryodiplodia theobromae (syn. Lasiodiplodia theobromae) [MIERSCH et al. 1991],
Gibberella fujikuroi [MIERSCH et al. 1992], Fusarium oxysporum f. sp. matthiolae
[MIERSCH et al. 1999], but the role of the endogenous jasmonates in the growth and
development of fungi is unknown.
In this work the effect of some inhibitors of jasmonic acid biosynthesis, acting on
different stages of biochemical conversion of α-linolenic acid to jasmonic acid, on the
mycelium growth of Phoma narcissi is presented.
1
The research was supported by Ministry of Science and Information Society Technologies,
Grant No. 2 P06R 125 26.
196
M. Saniewski, A. Saniewska
Material and methods
The stock culture of Phoma narcissi was maintained on potato-dextrose-agar
(PDA) slants at 25°C in the dark.
The effect of two inhibitors of lipoxygenase - phenidone (1-phenyl-3-pyrazolidone) [BAKER et al. 1985] and ibuprofen [α-methyl-4-(isobutyl)phenylacetic acid]
[PEŃA-CORTÉS et al. 1993], and inhibitor of cyclooxygenase - indomethacin [1-(4chlorobenzoyl)-5-methoxy-2-methyl-3-indoleacetic acid] [PEŃA-CORTÉS et al. 1993] on
the mycelium growth of Phoma narcissi on PDA medium were investigated. Sodium
diethyldithiocarbamate trihydrate (DIECA), which reduces the conversion of 13(S)hydroperoxylinolenic acid to 13-hydroxylinolenic acid and this way decreases the
biosynthesis of jasmonic acid was also included in the experiment [FARMER et al. 1994;
KOIWA et al. 1997]. All these used inhibitors, phenidone, ibuprofen, indomethacin and
sodium diethyldithiocarbamate, are the inhibitors of jasmonates biosynthesis on
different stages of biochemical conversion of α-linolenic acid to jasmonic acid.
These inhibitors were used at final concentration of 10, 50, 100, 250, and 500
µg⋅cm-3 in the PDA medium. Phenidone, ibuprofen and indomethacin were dissolved in
ethanol and DIECA was dissolved in distilled and sterilized water and then were added
to PDA medium after sterilization at temperature of about 50°C. Five mm diameter
plugs were taken from 7-day-old culture of P. narcissi, and placed in the middle of 90
mm Petri dishes containing PDA medium earlier supplemented with the tested
compounds. Control plates contained the culture growing on pure PDA, without any
additions. Five Petri dishes were used as an experimental unit and the trial was repeated
twice. Incubation was conducted in darkness at 25°C. After 6 days of the process a
diameter of fungal colonies was measured in two perpendicular directions.
The data was subjected to the analysis of variance and Duncan’s multiple range
test at 5% significance was used for means separation.
Results and discussion
All the used inhibitors, phenidone, ibuprofen, indomethacin and sodium
diethyldithiocarbamate, applied directly to PDA medium showed a great inhibitory
effect on the mycelium growth of Phoma narcissi (Fig. 1-4). After 6-7 days of
incubation with these inhibitors at a concentration of 500 µg⋅cm-3 in the medium the
mycelium growth of the pathogen was totally or almost totally inhibited (Fig. 1-4).
Lower concentration of the used inhibitors inhibited mycelium growth to a lesser
degree, generally proportionally to its concentrations. The strongest inhibitory effect
was caused by indomethacin, at a concentration of 10 µg⋅cm-3 it limited the mycelium
growth in about 67% (Fig. 3).
THE EFFECT OF INHIBITORS OF LIPOXYGENASE ...
100
a
inhibition of mycelium growth (%)
90
a
197
a
b
80
50 µg·cmֿ³
b
b
70
c
60
100 µg·cmֿ³
250 µg·cmֿ³
500 µg·cmֿ³
c
50
c
d
40
d
30
d
20
10
0
2
4
7
D a y s o f in c u b a t io n
Fig. 1.
The effect of phenidone on the mycelium growth of Phoma narcissi. Absolute values
of the surface of mycelium growth in the control medium after 2; 4 and 7 days of
incubation was 5.6; 26.4 and 60.1 cm2, respectively
Rys. 1.
Wpływ fenidonu na wzrost grzybni Phoma narcissi. Bezwzględne wartości powierzchni grzybni na poŜywce kontrolnej po 2; 4 i 7 dniach inkubacji wynosiły
odpowiednio 5,6; 26,4 i 60,1 cm2
M. Saniewski, A. Saniewska
198
100
a
90
a
a
b
Inhibition of mycelium growth (%)
80
10 µg·cmֿ³
b
70
b
50 µg·cmֿ³
100 µg·cmֿ³
60
500 µg·cmֿ³
50
40
c
30
c
c
20
10
0
-10
2
4
6
-20
-30
-40
D ays of incub ation
Fig. 2.
The effect of ibuprofen on the mycelium growth of Phoma narcissi. Absolute values
of the surface of mycelium growth in the control medium after 2; 4 and 6 days of
incubation was 3.9; 16.5 and 39.6 cm2, respectively
Rys. 2.
Wpływ ibuprofenu na wzrost grzybni Phoma narcissi. Bezwzględne wartości powierzchni grzybni na poŜywce kontrolnej po 2; 4 i 6 dniach inkubacji wynosiły
odpowiednio 3,9; 16,5 i 39,6 cm2
It is interesting that ibuprofen applied at a concentration of 10 µg⋅cm-3
substantially stimulated the mycelium growth of P. narcissi; after 2, 4 and 6 days of
incubation in 35, 8 and 3%, respectively (Fig. 2).
It is well known in literature that the inhibitors used in our work blocked the
elicitor-induced formation of jasmonic acid.
Diethyldithiocarbamic acid inhibited the elicitor-induced production of jasmonic
acid and the activation of terpenoid indole alkaloid biosynthetic genes [MENKE et al.
1999].
NOJIRI et al. [1996] showed that the treatment with ibuprofen reduced the
production of momilactone A in the suspension cultured rice cells treated with Nacetylchitoheptaose, but the addition of JA increased the production of momilactone A
to higher levels than those in elicited rice cells. These results strongly suggest that JA
functions as a signal transducer in the induction of biosynthesis of momilactone A by
N-acetylchitoheptaose in the suspension cultured rice cells [NOJIRI et al. 1996].
PEŃA-CORTÉS et al. [1993] documented that ibuprofen did not prevent activation of
wound-induced JA-Me mediated genes in tomato leaves. These observations suggest
that ibuprofen may be involved in a special transduction pathway unrelated to the
inhibitory effect on biosynthesis of jasmonate.
THE EFFECT OF INHIBITORS OF LIPOXYGENASE ...
a
9 0
a
a
a
a
a
a
a
a
a
8 0
10 µg·cmֿ³
a
b
7 0
50 µg·cmֿ³
100 µg·cmֿ³
6 0
500 µg·cmֿ³
5 0
4 0
3 0
2 0
1 0
0
2
4
D a y s
6
o f in c u b a tio n
Fig. 3. The effect of indomethacin on the mycelium growth of Phoma narcissi. Absolute values of the surface
of mycelium
growth in the control medium after 2; 4 and 6 days of incubation was 4.7; 19.7 and
42.4 cm2, respectively
Rys. 3. Wpływ indometacyny na wzrost grzybni Phoma narcissi. Bezwzględne wartości powierzchni grzybni
na poŜywce kontrolnej po 2; 4 i 6 dniach inkubacji wynosiły odpowiednio 4,7; 19,7 i 42,4 cm2
In the soybean (Glycine max (L.) MERR.) seedlings the lipoxygenase transcript
pTK18 was found in all non-embryonic tissues examined: axes and roots and leaves of
two-week plant and the transcript was elevated by methyl jasmonate in the seedlings
[PARK et al. 1994]. These authors observed that ibuprofen, the known inhibitor of jasmonates biosynthesis [STASWICK et al. 1991], applied alone stimulated the accumulation of
pTK18 transcript in soybean seedlings suggesting that this inhibitor may have other
than the specific effects on endogenous jasmonic acid levels [PARK et al. 1994].
Thus, all the applied inhibitors, phenidone, ibuprofen, indomethacin and sodium
diethyldithiocarbamate, which are the inhibitors of jasmonates biosynthesis on diffrent
stages of biochemical conversion of α-linolenic acid to jasmonic acid, evidently
inhibited the mycelium growth of Phoma narcissi.
It is probable that endogenous jasmonates play an important role in the growth
and development of Phoma narcissi and other fungi; the occurrence of jasmonates in
fungi is well documented [MIERSCH et al. 1991, 1992, 1999].
100
Inhibition of mycelium growth (%)
Inhibition of mycelium growth (%)
1 0 0
199
a
a
b
90
b
a
a
a
80
b
b
10 µg·cmֿ³
70
50 µg·cmֿ³
100 µg·cmֿ³
60
500 µg·cmֿ³
50
40
30
20
10
c
b
c
0
2
4
D a y s o f in c u b a t io n
6
200
M. Saniewski, A. Saniewska
Fig. 4.
The effect of sodium diethyldithiocarbamate on the mycelium growth of Phoma narcissi.
Absolute values of the surface of mycelium
growth in the control medium after 2; 4 and 6 days
of incubation was 5.3; 18.8 and 41.7cm2, respectively
Rys. 4. Wpływ dietyloditiokarbaminianu sodu na wzrost grzybni Phoma narcissi. Bezwzględne wartości
powierzchni grzybni na poŜywce kontrolnej po 2; 4 i 6 dniach inkubacji wynosiły odpowiednio
5,5; 18,8 i 41,7 cm2
Conclusion
On the basis of those inhibitors of jasmonate biosynthesis, i.e. phenidone,
ibuprofen, indomethacin and sodium diethyldithiocarbamate, which inhibit the
mycelium growth of Phoma narcissi it is suggested that jasmonates may play an
important role in the growth and development of the pathogen.
References
BAKER J.E., WANG C.Y., TERLIZZI D.E. 1985. Delay of senescence in carnations by pyrazon, phenidone analogues, and Tiron. Hort Science 20: 121-122.
FARMER E.E., CALDELARI D., PEARCE G., WALKER-SIMMONS M.K., RYAN C.A. 1994.
Diethyldithiocarbamic acid inhibits the octadecanoid signaling pathway for the wound
induction of proteinase inhibitors in tomato leaves. Plant Physiol. 106: 337-342.
KOIWA H., BRESSAN R.A., HASEGAWA P.M. 1997. Regulation of protease inhibitors and
plant defence. Trends Plant Sci. 2: 379-384.
MENKE F.L.K., PARCHMANN S., MUELLER M.J., KIJNE J.W., MEMELINK J. 1999. Involvement of the octadecanoid pathway and protein phophorylation in fungal elicitor-induced expression of terpenoid indole alkaloid biosynthetic genes in Catharanthus
roseus. Plant Physiol. 119: 1289-1296.
MIERSCH O., SCHNEIDER G., SEMBDNER G. 1991. Hydroxylated jasmonic acid and related
compounds from Botryodiplodia theobromae. Phytochem. 30: 4049-4051.
MIERSCH O., BRÜCKNER B., SCHMIDT J., SEMBDNER G. 1992. Cyclopentane fatty acids from
Gibberella fujikuroi. Phytochem. 32: 3835-3837.
MIERCH O., BOHLMANN H., WASTERNACK C. 1999. Jasmonates and related compounds
from Fusarium oxysporum. Phytochem. 50: 517-523.
NOJIRI H., SUGIMORI M., YAMANE H., NISHIMURA Y., YAMADA A., SHIBUYA N., KODAMA O.,
MUROFUSHI N., OMORI T. 1996. Involvement of jasmonic acid in elicitor-induced
phytoalexin production in suspension-cultured rice cells. Plant Physiol. 110: 387-392.
STASWICK P.E., HUANG J.-F., RHEE Y. 1991. Nitrogen and methyl jasmonate induction of
soybean vegetative storage protein genes. Plant Physiol. 96: 130-136.
PARK T.K., HOLLAND M.A., LASKEY J.G., POLACCO J.C. 1994. Germination-associated
lipoxygenase transcripts persist in maturing soybean plants and are induced by jasmonate. Plant Sci. 96: 109-117.
PEŃA-CORTÉS H., ALBRECHT T., PRAT S., WEILER E., WILLMITZER L. 1993. Aspirin prevents wound-induced gene expression in tomato leaves by blocking jasmonic acid
biosynthesis. Planta 191: 123-128.
SANIEWSKA A. 1996. Effect of polyamine biosynthesis inhibitors on growth of Stagonospora curtisii (Berk.) Sacc. (= Phoma narcissi (Aderh.) Boerema, de Gruyter et
Noordel., comb. nov.). Phytopathol. Pol. 11: 23-30.
THE EFFECT OF INHIBITORS OF LIPOXYGENASE ...
201
SANIEWSKA A. 1998. Czynniki biotyczne i abiotyczne hamujące wzrost i rozwój Phoma
narcissi (Aderh.) Boerema, de Gruyter et Noordel., comb. nov. Zesz. Nauk. Instytutu
Sadownictwa i Kwiaciarstwa, Monografie i Rozprawy, Skierniewice: 1-32.
SANIEWSKA A., ORLIKOWSKI L. 1989. Występowanie, szkodliwość i elementy biologii
Stagonospora curtisii (Berk.) Sacc. na narcyzach. Prace Instytutu Sadownictwa i
Kwiaciarstwa, Ser. B - Rośliny Ozdobne 14: 179-189.
Key words:
ibuprofen, phenidone, indomethacin, sodium diethyldithicarbamate,
mycelium growth, Phoma narcissi
Summary
Phoma narcissi is a pathogen of the species from the family Amaryllidaceae,
including Hippeastrum × hybr. hort. Disease symptoms may occur on all organs of
Hippeastrum, the pathogen causes reddish colouration of tissues and development of
red necrotic spots.
It was showed that all the applied inhibitors of jasmonates biosynthesis, i.e.
phenidone, ibuprofen, indomethacin and sodium diethyldithiocarbamate, acting at
different stages of biochemical conversion of α-linolenic acid to jasmonic acid, greatly
inhibited the mycelium growth of Phoma narcissi on PDA medium, proportionally to
the concentration used. The strongest inhibitory effect was caused by indomethacin; at a
concentration of 10 µg⋅cm-3 the mycelium growth was limited in about 67%. It is
suggested that inhibition of mycelium growth of P. narcissi in vitro by the applied
inhibitors is caused by blocking the jasmonate biosynthesis in the mycelium of this
pathogen. It should be mentioned that other action of those inhibitors on metabolic
processes in mycelium hyphae, resulting to inhibition of growth and development of the
Phoma narcissi can not be exluded.
WPŁYW INHIBITORÓW LIPOKSYGENAZY I CYKLOOKSYGENAZY
NA WZROST GRZYBNI Phoma narcissi
Marian Saniewski, Alicja Saniewska
Instytut Sadownictwa i Kwiaciarstwa w Skierniewicach
Słowa kluczowe:
ibuprofen, fenidon, indometacyna, dietyloditiokarbaminian sodu,
wzrost grzybni, Phoma narcssi
Streszczenie
Phoma narcissi jest patogenem gatunków z rodziny Amaryllidaceae, w tym
głównym patogenem Hippeastrum x hybr. hort. Objawy chorobowe mogą występować
na wszystkich organach Hippeastrum, a są to czerwienienie tkanek i rozwój
nekrotycznych plam.
Stwierdzono, Ŝe wszystkie zastosowane inhibitory biosyntezy kwasu jasmonowego, tj. fenidon, ibuprofen, indometacyna i dietyloditiokarbaminian sodu, działające
na róŜnych etapach przemiany kwasu α-linolenowego do kwasu jasmonowego,
hamowały wzrost grzybni Phoma narcissi na poŜywce PDA proporcjonalnie do uŜytego
stęŜenia. Najsilniej działającym inhibitorem na wzrost grzybni tego patogena okazała
202
M. Saniewski, A. Saniewska
się indometacyna - w stęŜeniu 10 µg⋅cm-3 hamowała wzrost grzybni Phoma narcissi w
67%. Sugeruje się, Ŝe hamowanie wzrostu grzybni Phoma narcissi w warunkach in
vitro przez zastosowane inhibitory jest powodowane obniŜeniem lub zahamowaniem
biosyntezy jasmonianów w strzępkach grzybni tego patogena. Nie moŜna wykluczyć
takŜe innego działania tych inhibitorów w procesach metabolicznych w strzępkach
grzybni, doprowadzającego do hamowania wzrostu grzybni Phoma narcissi.
Prof. dr hab. Marian Saniewski
Instytut Sadownictwa i Kwiaciarstwa
ul. Pomologiczna 18
96-100 SKIERNIEWICE
e-mail: [email protected]
ZESZYTY PROBLEMOWE POSTĘPÓW NAUK ROLNICZYCH 2007 z. 523: 203-212
WPŁYW AKUMULACJI ZWIĄZKÓW FENOLOWYCH
NA ZDOLNOŚCI REGENERACYJNE KALUSA
WYBRANYCH GATUNKÓW ROŚLIN1
1
1
Edyta Skrzypek , Magdalena Szechyńska-Hebda , GraŜyna Dąbrowska
1
2
2
Instytut Fizjologii Roślin im. F. Górskiego Polskiej Akademii Nauk w Krakowie
Zakład Genetyki, Uniwersytet Mikołaja Kopernika w Toruniu
Wstęp
Związki fenolowe są jednym z czynników decydujących o zdolnościach regeneracyjnych tkanek roślinnych w kulturach in vitro [CVIKROVÁ i in. 1996; LORENZO i in.
2001]. Ich ilość w tkankach roślinnych zaleŜy od wielu czynników zewnętrznych i
wewnętrznych, np. od intensywności światła, temperatury, regulatorów wzrostu, czy
zawartości składników mineralnych i cukrów w podłoŜu [TANAKA i in. 1995; LARRONDE i
in. 1998; LEWIS i in. 1998; RUIZ i in. 1999; CLOSE i in. 2001]. HUTZLER i in. [1998] oraz
SCHOENWAELDER i WIENCKE [2000] wykazali, Ŝe nie tyko ilość związków fenolowych, ale i
miejsce ich gromadzenia (ściana komórkowa, wakuole) wpływa na potencjał
morfogenetyczny tkanek. Mechanizm ich działania jest trudny do wyjaśnienia, jednak
wydają się one w duŜej mierze decydować o potencjale morfogenetycznym tkanek,
głównie poprzez lignifikację ścian komórkowych, oraz regulację poziomu auksyn.
Polifenole stymulują utlenianie IAA i tworzenie kompleksów, przez co wpływają na
poziom czynnej auksyny oraz regulują transport auksyn [MURPHY i in. 2000]. Monofenole
prawdopodobnie spełniają funkcję ochronną, zabezpieczając endogenną auksynę przed
jej utlenianiem. Znoszą teŜ hamujące działanie ABA na wzrost i przeciwdziałają
zamykaniu aparatów szparkowych [MURPHY i in. 2000]. Uznawane są takŜe jako
antyoksydanty, broniące komórki przed róŜnego rodzaju stresem środowiskowym.
Działają one równieŜ jak inhibitory wzrostu, tworząc połączenia z enzymami. Związki
fenolowe, głównie taniny (występujące w duŜych ilościach tkankach bobiku) hamują
wzrost indukowany przez GA3. Natomiast produkty ich utleniania powodują
brunatnienie tkanek i nekrozy.
Celem prowadzonych badań było określenie wpływu związków fenolowych na
regenerację kalusa pszenicy, bobiku i rzepaku w zaleŜności od zdolności regeneracyjnych tkanki i temperatury stymulującej regenerację.
Materiał i metody
Materiał roślinny stanowiły eksplantaty oraz kalus nieregenerujący i regenerujący: pszenicy odm. Kamila, bobiku odm. Nadwiślański, i rzepaku odm. Licosmos.
1
Badania finansowane przez Ministerstwo Nauki i Szkolnictwa WyŜszego w ramach grantu nr 3
PO6A 009 25.
E. Skrzypek, M. Szechyńska-Hebda, G. Dąbrowska
204
Kalus pszenicy indukowano na poŜywce MS [MURASHIGE, SKOOG 1962] z dodatkiem 2
mg⋅dm-3 2,4-D, bobiku na poŜywce MS zawierającej 1 mg⋅dm-3 hydrolizatu kazeiny,
750 mg dm-3 myo-inozytolu, 1 mg⋅dm-3 BAP, 0,5 mg⋅dm-3 NAA, 0,25 mg⋅dm-3 GA3 i
3% sacharozy, a rzepaku na poŜywce MS z dodatkiem 1 mg⋅dm-3 BAP, 0,5 mg⋅dm-3
2,4-D i 6% sacharozy. Kalus regenerujący indukowano z niedojrzałych zarodków
(pszenica, bobik) i hypokotyli (rzepak), a nieregenerujący z dojrzałych zarodków
(pszenica, bobik) i korzeni (rzepak). Po okresie 3-tygodniowej indukcji kalus
przenoszono na poŜywki regeneracyjne: kalus rzepaku na poŜywkę MS bez regulatorów
wzrostu, kalus bobiku na poŜywkę o takim samym składzie jak poŜywka indukcyjna, a
rzepaku na poŜywkę MS z dodatkiem 3 mg⋅dm-3 BAP, 0,5 mg⋅dm-3 GA3 i 3%
sacharozy. Poza tym, celem stymulacji regeneracji, część kalusa poddano działaniu
temperatury 4°C i 30°C przez 3 tygodnie. Następnie kalus przeniesiono do temperatury
25°C do momentu regeneracji. Kontrolę stanowił kalus rosnący przez cały czas indukcji
i regeneracji w temperaturze 25°C.
Zawartość związków fenolowych oznaczono metodą Folina i Ciocalteu [SINGLETON, ROSSI 1965]. 100-250 mg tkanki roślinnej (kalus, eksplantaty) homogenizowano
w 2 cm3 80% etanolu i wirowano przy 2800 r.p.m. przez 20 min. Mieszanina reakcyjna
zawierała: 1 cm3 rozcieńczonego ekstraktu z tkanek roślinnych, 0,5 cm3 25% Na2CO3 i
0,125 cm3 odczynnika Folina i Ciocalteu (rozcieńczonego przed uŜyciem wodą
destylowaną w stosunku 1 : 1). Po 30 min. mierzono absorbancję na spektrofotometrze
przy 760 nm. Zawartość fenoli określono w mg kwasu chlorogenowego na 1 g świeŜej
masy tkanki roślinnej. Pomiary ilości fenoli wykonano w eksplantatach, w kalusie po 3
tygodniach indukcji i podczas regeneracji w dniach: 0, 1, 2, 4, 7, 14 i 28 po
przeniesieniu na poŜywki regenerujące oraz po 3 tygodniowym okresie wzrostu w
temperaturze 4°C i 30°C.
Wyniki i dyskusja
Zdolności regeneracyjne roślin oraz ilość syntetyzowanych przez nie związków
fenolowych regulowana jest przez wiele czynników środowiskowych oraz jest zaleŜna
od gatunku rośliny. Wiele związków fenolowych jest nietrwałych, ze względu na
reakcje chemiczne i biochemiczne zachodzące z ich udziałem. Do najwaŜniejszych
naleŜy reakcja utleniania enzymatycznego powodująca brązowienie. To brązowienie
tkanek zachodzi pod wpływem enzymu oksydazy polifenolowej. W obecności tlenu
zawartego w powietrzu, enzym katalizuje pierwszą fazę biochemicznej przemiany
związków fenolowych do chinonów, które dalej polimeryzują do nierozpuszczalnych
polimerów o ciemnej barwie nazywanych melaninami. W kulturach in vitro ciemnienie
tkanek wywołane utlenianiem polifenoli wydaje się być główną przyczyną słabej
regeneracji kalusa. Reakcja utleniania polifenoli następuje zwykle po skaleczeniu tkanki
lub innym mechanicznym oddziaływaniu, powodującym uszkodzenie komórek. Z
przeprowadzonych eksperymentów wynika, Ŝe ilość związków fenolowych
występujących w eksplantatach i kalusie bobiku była równieŜ zaleŜna od ich potencjału
morfogenetycznego.
P s z e n ic a; W h e at
E k s p la n t a t y ; E xp la n t s
20
Fenole; Phenols [mg/g FW]
K a lu s ; C a llu s
15
10
5
0
N R
Fenole; Phenols [mg/g FW]
20
R
B obik ; F ie ld be an
15
10
5
0
N R
Fenole; Phenols [mg/g FW]
20
R
R z e pak ; R ape
15
10
5
0
N R
R
WPŁYW AKUMULACJI ZWIĄZKÓW FENOLOWYCH ...
Rys. 1.
Fig. 1.
205
Ilość endogennych związków fenolowych w nieregenerujących (NR) i regenerujących (R) eksplantatach i kalusie pszenicy, bobiku oraz rzepaku po 3 tygodniach
indukcji w 25°C. Wartości średnie z trzech powtórzeń ± SD
Endogenic amount of phenolic compounds in non-regenerable (NR) and regenerable
(R) explants and callues of wheat, field bean and rape after 3 weeks of induction at
25°C. Mean values from three replicates ± SD
Kalus pszenicy, charakteryzujący się największym potencjałem regeneracyjnym (tab.
1), zawierał najmniej związków fenolowych, a słabo regenerujący kalus rzepaku gromadził ok. 9-krotnie więcej polifenoli (rys. 1). Tkanki eksplantatów odznaczały się
znacznie wyŜszą zawartością polifenoli (ok. 7-18 mg⋅g-1 św.m.) w porównaniu z 3tygodniowym kalusem rosnącym na poŜywkach indukujących (ok. 0,7-7 mg⋅g-1 św.m.),
(rys. 1). Ponadto tkanki nieregenerujące, zarówno eksplantaty jak i kalus gromadziły
większe ilości polifenoli (o ok. 20%) w porównaniu z tkankami regenerującymi.
RównieŜ HRUBCOVÁ i in. [1994] oraz CVIKROVÁ i in. [1996, 1999] wykazali, Ŝe
nieembriogenna zawiesina komórkowa i kalus Medicago sativa produkują więcej
związków fenolowych niŜ zawiesina embriogenna. BERUTO i in. [1996] takŜe opisuje
wysoki poziom fenoli w nieregenerującym kalusie Ranunculus asiaticus L. w
porównaniu z kalusem regenerującym.
Tabela 1; Table 1
Procent kalusów pszenicy, bobiku oraz rzepaku regenerujących pędy
w zaleŜności od 3 tygodniowego okresu wzrostu w temperaturze 4°C, 25°C i 30°C
(analizy wykonano na 9 tygodniowym kalusie)
Per cent of wheat, field bean and rape calluses regenerating shoots in response
to 3 weeks growth at the temperature of 4°C, 25°C and 30°C
(analyses were done on the 9 week old calluses)
Rośliny; Plants
Pszenica; Wheat
Bobik; Field bean
Rzepak; Rape
% kalusów regenerujących pędy; % of calluses regenerating shoots
4°C
25°C
30°C
72
65
8
33
30
5
0
0
0
Powstrzymywanie reakcji brązowienia enzymatycznego polega zwykle na
inaktywacji oksydazy polifenolowej (termicznie) lub usunięciu podstawowych reagentów z produktu (najczęściej tlenu). Po pasaŜu kalusa na poŜywki regeneracyjne (i co
za tym idzie dostarczeniu nowej porcji tlenu), wzrastała ilość związków fenolowych w
nieregenerującym kalusie pszenicy i bobiku (rys. 2; 0 dzień prowadzenia kultury). W
kolejnych dniach wzrostu kalusa zmiany zawartości polifenoli miały charakter
E. Skrzypek, M. Szechyńska-Hebda, G. Dąbrowska
206
Fenole; Phenols [mg/g FW]
oscylacyjny. W kalusie zdolnym do regeneracji ich ilość wzrastała z chwilą pojawienia
się centrów merystematycznych i pierwszych pędów. W przypadku kalusa pszenicy był
to ok. 3-4 dzień po pasaŜu, a bobiku ok. 18 dzień po pasaŜu. Kalus rzepaku odznaczał
się słabym potencjałem regeneracyjnym (ok. 5% kalusów regenerowało), co tłumaczy
niŜszy poziom polifenoli w kalusie regenerującym, w porównaniu z nieregenerującym,
przez cały okres prowadzenia kultury. Podobną zaleŜność obserwowali LOZOVAYA i in.
[1996, 2000] w kalusie Fagopyrum esculentum, Fagopyrum tataricum i Zea mays, gdzie
tkanki ze zregenerowanymi pędami charakteryzowały się zawartością związków
fenolowych na poziomie tkanki nieróŜnicującej. Analizowali oni równieŜ zawartość
kwasów ferulowego i wanilinowego w kalusie, w zaleŜności od zdolności
regeneracyjnych tkanek. Najwięcej tych kwasów obserwowali w kalusie regenerującym,
we wczesnych stadiach morfogenezy. Ok. 20% mniej w kalusie regenerującym
korzenie, a w kalusie nieregenerującym ich ilość była znikoma. Autorzy sugerują, Ŝe
zawartość związków fenolowych w ścianie komórkowej, a w szczególności ilość kwasu
ferulowego, moŜe być biochemicznym wskaźnikiem zdolności tkanek do róŜnicowania.
RównieŜ LAUKKANEN i in. [1999] oraz LORENZO i in. [2001] odnotowali zaleŜność pomiędzy
ilością polifenoli i ich utlenianiem, po kolejnych pasaŜach i zdolnościami regeneracyjnymi
tkanek.
Pszenica; Wheat
1,6
R
1,4
NR
1,2
1
0,8
0,6
0,4
0,2
0
0
2
4
7
14
28
7
14
28
7
14
28
Bobik; Field bean
16
Fenole; Phenols [mg/g FW]
1
14
12
10
8
6
4
2
0
0
1
4
Rzepak; Rape
1,4
Fenole; Phenols [mg/g FW]
2
1,2
1
0,8
0,6
0,4
0,2
0
0
1
2
4
Dni prowadzenia kultury; Days of culture
WPŁYW AKUMULACJI ZWIĄZKÓW FENOLOWYCH ...
207
Pszenica; Wheat
R
1,5
Endogenic amount of phenolic compounds in non-regenerable (NR) and regenerable (R) calluses of wheat, field bean a
0,5
0
4 ºC
25 ºC
30 ºC
Bobik; Field bean
20
Fenole; Phenols [mg/g FW]
Fig. 2.
NR
1
Ilość endogennych związków fenolowych w kalusie pszenicy, bobiku oraz rzepaku nieregenerującym (NR) i regenerują
15
10
5
0
4 ºC
25 ºC
30 ºC
Rzepak; Rape
4
Fenole; Phenols [mg/g FW]
Rys. 2.
Fenole; Phenols [mg/g FW]
2
3
2
1
0
4 ºC
25 ºC
30 ºC
208
E. Skrzypek, M. Szechyńska-Hebda, G. Dąbrowska
Rys. 3.
Ilość endogennych związków fenolowych w nieregenerującym (NR) i regenerującym
(R) kalusie pszenicy, bobiku oraz rzepaku po 3 tygodniach wzrostu w temperaturze
30°C, 4°C i 25°C. Wartości średnie z trzech powtórzeń ± SD
Fig. 3.
Endogenic amount of phenolic compounds in non-regenerable (NR) and regenerable
(R) calluses of wheat, field bean and rape after 3-week growth at the temperature of
30°C, 4°C and 25°C. Mean values from three replicates ± SD
Temperatura wpływała równieŜ na metabolizm polifenoli. JuŜ w temperaturze
poniŜej 7°C następuje wstrzymanie aktywności oksydazy polifenolowej, choć enzym
nie jest dezaktywowany. W badaniach własnych temperatura 4°C przedłuŜała
Ŝywotność kalusa i stymulowała tworzenie pędów (tab. 1) oraz syntezę związków
fenolowych w kalusie zdolnym do regeneracji (rys. 3). LAUKKANEN i in. [1999] stwierdzili
w swoich badaniach, Ŝe czynniki które indukują róŜnicowanie, stymulują równieŜ
syntezę związków fenolowych. W badaniach własnych temperatura 30°C hamowała
regenerację oraz przyspieszała brunatnienie i obumieranie tkanek. Niska zawartość
związków fenolowych w tej temperaturze w kalusie bobiku i rzepaku świadczy o
szybkim utlenieniu związków fenolowych. Jednak w kalusie pszenicy ilość
endogennych związków fenolowych była niezaleŜna od temperatury.
Wnioski
1.
Tkanki regenerujące (eksplantaty i kalus) charakteryzują się niŜszą zawartością
endogennych związków fenolowych w porównaniu z tkankami nieregenerującymi. RóŜnice te są tym większe im większy jest potencjał morfogenetyczny tkanki.
2.
Niska temperatura, hamująca utlenianie polifenoli w kalusie, stymuluje regenerację.
Literatura
BERUTO M., CUIRI P., DEBERGH P. 1996. Callus growth and somatic embryogenesis in
thalamus tissue of Ranunculus asiaticus L. cultivated in vitro: cytokinin effect and
phenol metabolism. In Vitro Cell Dev. Biol. 32: 154-160.
CLOSE D.C., DAVIES N.W., BEADLE CH.L. 2001. Temporal variation of tannins (galloylglucoses), flavonols and anthocyanins in leaves of Eucalyptus nitens seedlings: implications for light attenuation and antioxidant activities. Aust. J. Plant Physiol. 28:
269-278.
CVIKROVÁ M., BINAROVÁ P., EDER J., VÁGNER M., HRUBCOVÁ M., ZOŃ J., MACHÁČKOVÁ I.
1999. Effect of inhibition of phenylalanine ammonia-lyase activity on growth of alfalfa
cell suspension culture: Alterations in mitotic index, ethylene production, and contents
WPŁYW AKUMULACJI ZWIĄZKÓW FENOLOWYCH ...
209
of phenolics, cytokinins and polyamines. Physiol. Plant. 107(3): 329-337.
CVIKROVÁ M., HRUBCOVÁ M., EDER J., BINAROVÁ P. 1996. Changes in the levels of
endogenous phenolics, aromatic monoamines, phenylalanin ammonia-lyase, peroxidase
and auxin oxidase activities during initiation of alfalfa embryogenic and nonembryogenic calli. Plant Physiol. Biochem. 34(6): 853-861.
HRUBCOVÁ M., CVIKROVÁ M., EDER J. 1994. Peroxidase activities and contents of phenolic
acids in embryogenic and nonembryogenic alfalfa cell suspension cultures. Biol. Plant.
36: 175-182.
HUTZLER P., FISCHBACH R., HELLER W., JUNGBLUT T. P., REUBER S., SCHMITZ R., VEIT M.,
WEISSENBOCK G., SCHNITZLER J. P. 1998. Tissue localization of phenolic compounds in
plants by confocal laser scanning microscopy. J. Exp. Bot. 49(323): 953-965.
LARRONDE F., KRISA S., DECENDIT A., CHAZE C., DEFFIEUX G., MERILLON J. M. 1998. Regulation of polyphenol production in Vitis Vinifera cell suspension cultures by sugars.
Plant Cell Rep. 17: 946-950.
LAUKKANEN H., HÄGGMAN H., KONTUNEN-SOPPELA S., HOHTOLA A. 1999. Tissue browning
of in vitro cultures of Scot pine: Role of peroxidase and polyphenol oxidase. Physiol.
Plant. 106: 337-343.
LEWIS CH.E., WALKER J.R.L., LANCASTER J.E., CONNER A.J. 1998. Light regulation of
anthocyanin, flavonoid and phenolic acid biosynthesis in potato minitubers in vitro.
Aust. J. Plant Physiol. 25: 915-922.
LORENZO J.C., DE LOS ANGELES BLANCO M., PELAEZ O., GONZALEZ A., CID M., IGLESIAS A.,
GONZALEZ B., ESCALONA M., ESPINOSA P., BORROTO C. 2001. Sugarcane micropropagation
and phenolic excretion. Plant Cell, Tissue and Organ Culture 65: 1-8.
LOZOVAYA V.V., GORSHKOVA T.A., RUMYANTSEVA N., ULANOV A.V., VALIEVA A.I., YABLOKOVA E.V., MEI CH., WILDHOLM J.M. 2000. Cell wall-bound phenolics in cells of maize
(Zea mays, Gramineae) and buckwheat (Fagopyrum tataricum, Polygonaceae) with
different plant regeneration abilities. Plant Sci. 152: 79-85.
LOZOVAYA V.V., GORSHKOVA T., YABLOKOVA E., ZABOTINA O., AGEEVA M., RUMYANTSEVA
N., KOLESNICHENKO E., WARANYUWAT A., WILDHOLM J. 1996. Callus wall phenolics and
plant regeneration ability. J. Plant Physiol. 148: 711-717.
MURASHIGE T., SKOOG F. 1962. A revised medium for rapid growth and bioassays with
tobacco tissue cultures. Physiol. Plant. 15: 473-497.
MURPHY A., PEER W.A., TAIZ L. 2000. Regulation of auxin transport by aminopeptidases
and endogenous flavonoids. Planta 211: 315-324.
RUIZ J.M., GARCIA P.C., RIVERO M., ROMERO L. 1999. Response of phenolic metabolism to
the application of carbendazim plus boron in tobaco. Physiol. Plant. 106: 151-157.
SCHOENWAELDER M.A., WIENCKE C. 2000. Phenolic compounds in the embryo development of several northern hemisphere fucoids. Plant Biol. 2: 24-33.
SINGLETON V.S., ROSSI JR J.A. 1965. Colorimetry of total phenolics with phosphomolybdic
phosphotungstic acid reagent. Amer. J. Enol. Viticult. 16: 144-158.
TANAKA N., SHIMOMURA K., ISHIMARU K. 1995. Tannin production in callus cultures of
Quercus acutissima. Phytochem. 40(4): 1151-1154.
Słowa kluczowe:
Brassica napus ssp. oleifera, związki fenolowe, kalus, regeneracja,
Triticum aestivum, Vicia faba L. minor
Streszczenie
Związki fenolowe są jednym z czynników uniemoŜliwiającymi regenerację
w kulturach in vitro. Produkty ich utleniania, chinony, powodują brunatnienie tkanek,
nekrozy, a następnie obumieranie całego kalusa. Ich rola w procesie regeneracji nie
została jednoznacznie określona, poniewaŜ są one znane zarówno jako antyoksydanty
E. Skrzypek, M. Szechyńska-Hebda, G. Dąbrowska
210
jak i inhibitory wzrostu. Celem prowadzonych badań było określenie ilości
endogennych związków fenolowych w zaleŜności od zdolności regeneracyjnych kalusa
i warunków prowadzenia kultury. W wyniku przeprowadzonych eksperymentów
stwierdzono, Ŝe endogenny poziom związków fenolowych zaleŜał od rodzaju tkanki, jej
zdolności regeneracyjnych i gatunku rośliny. Eksplantaty zawierały kilkakrotnie więcej
związków fenolowych niŜ kalus. Największą ilość związków fenolowych zawierały
eksplantaty bobiku, ok. 15-18 mg⋅g-1 św.m., a najmniej rzepaku, ok. 8 mg⋅g-1 św.m.
RównieŜ kalus bobiku zawierał ok. 10-krotnie więcej związków fenolowych w
porównaniu z kalusem pszenicy i rzepaku. Eksplantaty niedojrzałych zarodków i kalus
regenerujący, zawierały mniejsze ilości związków fenolowych w porównaniu z
tkankami, z których regeneracja nie powiodła się. W kalusie zdolnym do regeneracji, w
początkowym etapie organogenezy, kiedy obserwowano powstawanie centrów
merystematycznych odnotowano znaczący wzrost zawartości związków fenolowych.
Natomiast kalus ze zregenerowanymi pędami charakteryzował się ich zawartością na
poziomie tkanki nieróŜnicującej. Ilość endogennych związków fenolowych była
równieŜ zaleŜna od temperatury stymulującej regenerację. Po okresie wzrostu w 4°C,
kalus bobiku i rzepaku zdolny do regeneracji syntetyzował większe ilości związków fenolowych w porównaniu z kalusem rosnącym w 25°C i 30°C. Temperatura nie miała
istotnego wpływu na ilość związków fenolowych w kalusie pszenicy.
THE INFLUENCE OF PHENOLIC ACUMULATION
ON CALLUS REGENERATION ABILITIES
OF CHOOSEN PLANT SPECIES
Edyta Skrzypek 1, Magdalena Szechyńska-Hebda 1, GraŜyna Dąbrowska 2
1
Institute of Plant Physiology, Polish Academy of Sciences, Kraków
2
Nicolas Copernicus University, Department of Genetic, Toruń
Key words:
Brassica napus ssp. oleifera, callus, phenolics, regeneration, Triticum
aestivum, Vicia faba L. minor
Summary
Phenolics are one of the main factors which inhibit tissue regeneration in tissue
culture. Their oxidation products, quinons, cause tissue darkening and necrosis, and
next death of the whole callus. Oxidized phenolics compounds can react with enzymes,
inhibit their activity and act as growth inhibitors. However, their role in the regeneration
process is unambiguous, because they are also known as antioxidants. The aim of the
experiment was to determine the amount of endogenous phenolics in relation to the
regeneration abilities of callus and culture conditions. The results presented here
indicate that the level of endogenous phenolics depends on the type of tissue, its
regeneration ability and plant species. Explants contain more phenolics than callus. The
highest amounts of phenolics were observed in explants of field bean, ca 15-18 mg⋅g-1
FW and the lowest in rape explants, ca 8 mg⋅g-1 FM. Field bean callus also contained
more phenols (ca ten times more) than wheat or rape callus. Phenolic content in callus
which is able to shoot regeneration is lower an compared with non-regenerable one. At
the beginning of callus differentiation, when the formation of meristematic centers were
observed, the amount of phenols increased. Then, the amount of phenolics in the callus
with regenerating shoots decreased to the level observed before the differentiation.
Phenolic content also depended on temperature used for stimulation of callus
regeneration. Regenerable callus of field bean and rape grown at 4°C synthesized more
phenolics than the callus grown at 25°C or 30°C. Temperature had no influence on
phenolic content in wheat callus.
WPŁYW AKUMULACJI ZWIĄZKÓW FENOLOWYCH ...
Dr Edyta Skrzypek
Instytut Fizjologii Roślin im. F. Górskiego
Polska Akademia Nauk
ul. Niezapominajek 21
30-239 KRAKÓW
e-mail: [email protected]
211
ZESZYTY PROBLEMOWE POSTĘPÓW NAUK ROLNICZYCH 2007 z. 523: 213-221
ZMIANY AKTYWNOŚCI ENZYMÓW ANTYOKSYDACYJNYCH
PODCZAS REGENERACJI KALUSA
BOBIKU (Vicia faba L. minor)1
1
1
Edyta Skrzypek , Magdalena Szechyńska-Hebda , GraŜyna Dąbrowska
1
2
2
Instytut Fizjologii Roślin im. F. Górskiego Polskiej Akademii Nauk w Krakowie
Zakład Genetyki, Uniwersytet Mikołaja Kopernika w Toruniu
Wstęp
Zdolności do róŜnicowania i regeneracji komórek roślinnych zakodowane są w
genomie, ale na ich efektywność wpływa wiele czynników wewnętrznych (np. rodzaj i
wiek eksplantatu) oraz środowiskowych (np. temperatura prowadzenia kultur in vitro),
których modyfikacje uruchamiają odpowiednie procesy rozwojowe [LI i in. 2001;
VRANOVA i in. 2002]. Zmiany czynników stymulujących, bądź hamujących róŜnicowanie
wpływają na metabolizm komórek oraz na ich aktywność enzymatyczną. Bobik w
kulturach in vitro jest trudną rośliną. Jego kalus szybko obumiera i słabo regeneruje.
Temperatura oraz rodzaj eksplantatu wydaje się odgrywać szczególnie waŜną rolę jako
czynnik sprawczy w kulturach in vitro bobiku i mający wpływ na aktywność enzymów
antyoksydacyjnych. Wstępne traktowanie kultur in vitro niską temperaturą zwiększa
znacząco efektywność indukcji kalusa i regeneracji roślin [HOU i in. 1997; JIMÉNEZ,
BANGERTH 2001; XYNIAS i in. 2001; TREJO-TAPIA i in. 2002]. Zmiany aktywności enzymów
antyoksydacyjnych: dysmutazy ponadtlenkowej (SOD), katalazy (CAT) oraz
peroksydazy (POD) odnotowane zostały podczas somatycznej embriogenezy [RACCHI,
TERRAGNA 1993; KAIRONG i in. 1999; LIBIK i in. 2005]. Przydatność POD w ocenie zdolności
do róŜnicowania i regeneracji opisują w swoich badaniach: DE VRIES [1992], CORTELAZZO
i in. [1996] oraz LIMAM i in. [1998]. Peroksydazy pełnią funkcję regulatorową w kataboliźmie auksyn [GAZARYAN i in. 1996], mają zdolność wiązania ze sobą róŜnych
składników ściany komórkowej, zaangaŜowane są w metabolizm komponentów
aromatycznych i proces lignifikacji [DE MARCO i in. 1999]. Wymienione enzymy
antyoksydacyjne współdziałają ze sobą w regulacji stęŜenia nadtlenku wodoru (H2O2).
SOD przeprowadza reakcje dysmutacji anionorodnika ponadtlenkowego, produkując
H2O2, CAT katalizuje rozkład H2O2, a POD utlenia róŜne substraty w jego obecności.
H2O2 jako słaby czynnik utleniający o relatywnie długim czasie trwania moŜe być
wtórnym przekaźnikiem informacji, zdolnym do indukowania ekspresji genów i
regulowania syntezy białek wspomagających regenerację. Poziom H2O2 zmieniał się
podczas namnaŜania komórek w kulturach zawiesinowych [PAPADAKIS, ROUBELAKISANGELAKIS 1999] oraz podczas somatycznej embriogenezy komórek kalusa [KAIRONG i in.
1999].
Celem badań było określenie aktywności dysmutazy ponadtlenkowej, katalazy i
peroksydazy oraz ilości endogennego nadtlenku wodoru podczas róŜnicowania i
1
Badania finansowane przez Ministerstwo Nauki i Szkolnictwa WyŜszego w ramach grantu nr 3
PO6A 009 25.
214
E. Skrzypek, M. Szechyńska-Hebda, G. Dąbrowska
regeneracji kalusa bobiku w kulturach in vitro.
Materiał i metody
Materiał roślinny stanowiły eksplantaty i kalus bobiku odm. Nadwiślański,
indukowany na poŜywce MS [MURASHIGE, SKOOG 1962] zawierającej 1 mg⋅dm-3
hydrolizatu kazeiny, 750 mg⋅dm-3 myo-inozytolu, 1 mg⋅dm-3 BAP, 0,5 mg⋅dm-3 NAA,
0,25 mg⋅dm-3 GA3 i 3% sacharozy. Kalus regenerujący otrzymywano z niedojrzałych
zarodków, a nieregenerujący z dojrzałych zarodków. Po okresie 3-tygodniowej indukcji
kalus pasaŜowano i przenoszono do temperatury 4°C i 30°C na okres 3 tygodni.
Następnie kalus przeniesiono do temperatury 25°C do momentu regeneracji. Kontrolę
stanowił kalus rosnący przez cały czas indukcji i regeneracji w temperaturze 25°C.
Materiał roślinny do analiz enzymatycznych homogenizowano w 0,05 mol⋅dm-3
buforze fosforanowym o pH 7,0, w obecności poliwinylopyrolidonu celem usunięcia
drobnocząsteczkowych fenoli zakłócających pomiar. Aktywność SOD oznaczono
metodą cytochromową [MCCORD, FIODOVICH 1969], aktywność CAT mierzono wg AEBI
[1984], a aktywność POD wg LÜCK [1962]. Aktywności enzymów przeliczono na ilość
białka oznaczonego spektrofotometrycznie metodą BRADFORDA [1976].
Ilość wewnątrzkomórkowego nadtlenku wodoru (H2O2) sprawdzono metodą
spektrofluorometryczną wg ISHIKAWA i in. [1993] w świeŜych próbkach eksplantatów i
kalusa, po uprzedniej homogenizacji w 5% TCA.
Pomiary aktywności enzymów antyoksydacyjnych i H2O2 wykonano w eksplantatach, w kalusie po 3 tygodniach indukcji i podczas regeneracji w dniach: 0, 1, 2,
4, 7, 14 i 28 po przeniesieniu na poŜywki regenerujące oraz po 3 tygodniowym okresie
wzrostu w temperaturze 4°C i 30°C.
Wyniki i dyskusja
Analizy aktywności enzymów oraz ilość endogennego H2O2 wykonano w dwóch
rodzajach kalusa bobiku: nieregenerującym, otrzymanym z dojrzałych zarodków i
regenerującym, otrzymanym z niedojrzałych zarodków. Z przeprowadzonych badań
wynika, Ŝe zdolność tkanek do regeneracji zaleŜała od stanu fizjologicznego komórek i
mogła mieć bezpośredni związek z podwyŜszoną produkcją reaktywnych form tlenu czy
nadtlenku wodoru, prawdopodobnie jako konsekwencja większej intensywności
metabolizmu. Temperatura 4°C i 30°C nie indukowała róŜnicowania kalusa powstałego
z dojrzałych zarodków. Natomiast temperatura 4°C stymulowała regenerację o 50% w
porównaniu z temperaturą 25°C (kontrola), a 30°C całkowicie hamowała regenerację i
przyspieszała obumieranie kalusa (tab. 1). Pozytywny wpływ okresowego działania
niskiej temperatury na róŜnicowanie komórek obserwowano wielokrotnie w badaniach
HOU i in. [1997], JIMÉNEZ i BANGERTH [2001], XYNIAS i in. [2001] czy TREJO-TAPIA i in. [2002].
Tabela 1; Table 1
Procent kalusów bobiku regenerujących pędy w zaleŜności od rodzaju eksplantatu
i od 3 tygodniowego okresu wzrostu w temperaturze 4°C, 25°C i 30°C
(analizy wykonano na 9 tygodniowym kalusie)
Per cent of field bean calluses regenerating shoots in response to the type of explants
and to 3 week growth at temperature of 4°C, 25°C and 30°C
(analyses were done on the 9 week old callus)
Rodzaj eksplantatu; Type of explant
% kalusów regenerujących pędy
% of calluses regenerating shoots
Aktywność SOD [U/µg białka]
SOD activity [U/µg proteins]
S OD ...
ZMIANY
ENZYMÓW ANTYOKSYDACYJNYCH
H2AKTYWNOŚCI
O2
2000
1500
1000
500
0
Aktywność CAT [ABS/µg białka]
CAT activity [ABS/µg proteins]
Eksplantaty;
Explants
0,4
0,3
0,2
0,1
0
Kalus; Callus
Niedojrzałe zarodki; Immature embryos
Dojrzałe zarodki; Mature embryos
Rys. 1.
Fig. 1.
NR
R
0,03
0,02
0,01
0
Eksplantaty;
Explants
Kalus; Callus
POD
CAT
Eksplantaty;
Explants
215
0,04
Kalus; Callus
Aktywność POD [ABS/µg białka]
POD activity [ABS/µg proteins]
Amount of H 2O2 [nl/g FW]
Ilość H2O2 [nl/g FW]
2500
2
1,5
1
0,5
0
Eksplantaty;
Explants
Kalus; Callus
4°C
25°C
30°C
65
0
30
0
0
0
Ilość endogennego H2O2 oraz aktywność SOD, CAT i POD w eksplantatach i kalusie
bobiku nieregenerujących (NR) i regenerujących (R) po 3 tygodniach indukcji w
25°C (wartości średnie z trzech powtórzeń ± SD)
Endogenous amount of H2O2 and activity of SOD, CAT and POD in non-regenerable
(NR) and regenerable (R) explants and callus of field bean after 3 weeks of induction
at 25°C (mean values from three replicates ± SD)
Eksplantaty oraz 3 tygodniowy kalus bobiku, zdolne do regeneracji, produkowały
większe ilości nadtlenku wodoru (H2O2) w porównaniu z eksplantatami i kalusem
nieregenerującym (rys. 1). W ciągu kolejnych 7 dni prowadzenia kultury ilość H2O2 w
kalusie regenerującym była nieznacznie wyŜsza niŜ w kalusie nieregenerującym i
utrzymywała się na stałym poziomie (rys. 2). W kolejnych dniach prowadzenia kultury
poziom H2O2 gwałtownie wzrastał zarówno w kalusie regenerującym jak i
nieregenerującym, ale tym razem jego produkcja była większa w kalusie niezdolnym do
regeneracji. Udział H2O2 w stymulacji regeneracji potwierdzają badania KAIRONG i in.
E. Skrzypek, M. Szechyńska-Hebda, G. Dąbrowska
216
[1999], gdzie dodany do poŜywek podwyŜszał zdolność tkanek do embriogenezy.
S OD
H2O 2
0,04
Aktywność SOD [U/µg białka]
SOD activity [U/µg proteins]
Ilość H2O2 [nl/g FW]
Amount of H 2O2 [nl/g FW]
3000
2500
2000
1500
1000
500
0
NR
R
0,03
0,02
0,01
0
0
1
2
4
7
14
28
0
Dni prowadzenia kultury; Days of culture
1
Aktywność POD [ABS/µg białka]
POD activity [ABS/µg proteins]
Aktywność CAT [ABS/µg białka]
CAT activity [ABS/µg proteins]
0,03
0,02
0,01
0
2
7
14
28
POD
0,04
1
4
Dni prowadzenia kultury; Days of culture
CAT
0
2
4
7
14
28
Dni prowadzenia kultury; Days of culture
2
1,5
1
0,5
0
0
1
2
4
7
14
28
Dni prowadzenia kultury; Days of culture
Rys. 2.
Ilość endogennego H2O2 oraz aktywność SOD, CAT i POD w kalusie bobiku
nieregenerującym (NR) i regenerującym (R) w ciągu 28 dni wzrostu na poŜywkach
regeneracyjnych w 25°C (wartości średnie z trzech powtórzeń ± SD)
Fig. 2.
Endogenous amount of H2O2 and activity of SOD, CAT and POD in non-regenerable
(NR) and regenerable (R) callus of field bean during 28 days of growing on the
regeneration media at 25°C (mean values from three replicates ± SD)
ZMIANY AKTYWNOŚCI ENZYMÓW ANTYOKSYDACYJNYCH ...
217
Aktywności enzymów antyoksydacyjnych: dysmutazy ponadtlenkowej (SOD),
katalazy (CAT) i peroksydazy (POD) równieŜ były wyŜsze w eksplantach i 3
tygodniowym kalusie regenerującym, w porównaniu z eksplantatami i kalusem
nieregenerującym (rys. 1). Aktywności SOD i POD, podobnie jak H2O2, były wyŜsze w
kalusie zdolnym do regeneracji i zmniejszały się w ciągu kolejnych 7 dni prowadzenia
kultury, a w następnych dniach stopniowo wzrastały. Zmiany SOD dotyczyły głównie
izoformy manganowej (dane nieprzedstawione), co wskazuje na zwiększoną produkcję
rodnika ponadtlenkowego w mitochondriach i peroksysomach. Badania KAIRONG i in.
[1999] wykazały, Ŝe aktywność SOD rośnie we wczesnych etapach dyferencjacji i
stopniowo maleje wraz z podziałami i rozwojem wielokomórkowego zarodka.
Natomiast wprowadzenie blokerów SOD obniŜało potencjał embriogenezy. PRAMANIK i
in. [1996] równieŜ wykazali istotne róŜnice aktywności SOD dla kalusów regenerujących
pędy i kalusów nieregenerujących. DE VRIES [1992] wyizolował izoenzym peroksydazy,
która podwyŜszała potencjał embriogenny tkanek oraz stymulowała rozwój wczesnych
stadiów zarodka. Aktywność CAT spadła 10-krotnie po 3 tygodniowym okresie
indukcji kalusa (po pasaŜu), (rys. 2) i utrzymywała się na porównywalnym poziomie w
kalusie regenerującym i nieregenerującym do 14 dnia prowadzenia kultury. Następnie
aktywność CAT malała w kalusie regenerującym, a znacząco wzrastała w kalusie
niezdolnym do regeneracji. Podobną zaleŜność obserwowali KAIRONG i in. [1999], czyli
wyŜszą aktywności CAT w kalusie i spadającą gwałtownie w pierwszych dniach
dyferencjacji.
E. Skrzypek, M. Szechyńska-Hebda, G. Dąbrowska
0,2
Aktywność SOD [U/µg białka]
SOD activity [U/µg proteins]
Amount of H 2O2 [nl/g FW]
Ilość H2O2 [nl/g FW]
S OD
H2O 2
218
2500
2000
1500
1000
500
NR
0,15
0,1
0,05
0
0
4 ºC
25 ºC
4 ºC
30 ºC
Aktywność POD [ABS/µg białka]
POD activity [ABS/µg proteins]
0,6
0,5
0,4
0,3
0,2
0,1
0
4 ºC
25 ºC
30 ºC
25 ºC
30 ºC
POD
CAT
Aktywność CAT [ABS/µg białka]
CAT activity [ABS/µg proteins]
R
25 ºC
30 ºC
2,5
2
1,5
1
0,5
0
4 ºC
Rys. 3. Ilość endogennego H2O2 oraz aktywność SOD, CAT i POD w kalusie bobiku nieregenerującym (NR)
i regenerującym (R) po 3 tygodniach wzrostu w temperaturze 30°C, 4°C i 25°C (wartości
średnie z trzech powtórzeń ± SD)
Fig. 3. Endogenous amount of H2O2 and activity of SOD, CAT and POD in non-regenerable (NR) and
regenerable (R) callus of field bean after 3-week growth the temperature of 30°C, 4°C and 25°C
(mean values from three replicates ± SD)
Aktywności enzymów zmieniały się takŜe w zaleŜności od warunków hodowli,
modyfikujących róŜnicowanie kalusa (rys. 3). Warunki stymulacji (temperatura 4°C) i
inhibicji (temperatura 30°C) zwiększały aktywność SOD, CAT i POD w komórkach
kalusa nieregenerującego, w porównaniu z kalusem rosnącym w temperaturze 25°C.
Zmiany te nie były widoczne w przypadku aktywności SOD i POD w kalusie
regenerującym. Obserwowano natomiast istotne zmiany aktywności CAT a kalusie
regenerującym, 4°C obniŜały jej aktywność, a 30°C zwiększały ją w porównaniu z
aktywnością CAT w 25°C.
Zmiany aktywności enzymów oraz ilości endogennego H2O2 w badanych
tkankach sugerują, Ŝe nadtlenek wodoru moŜe być jednym z czynników stymulującym
regenerację.
ZMIANY AKTYWNOŚCI ENZYMÓW ANTYOKSYDACYJNYCH ...
219
Wnioski
1.
Tkanki zdolne do regeneracji (eksplantaty i kalus) charakteryzują się wyŜszą
aktywnością dysmutazy ponadtlenkowej, katalazy oraz peroksydazy,
w porównaniu z tankami nieregenerującymi.
2.
Wysoka zawartość nadtlenku wodoru w kalusie regenerującym przy niskiej
aktywności katalazy, moŜe być czynnikiem zwiększającym potencjał regeneracyjny tkanek.
Literatura
AEBI H. 1984. Catalase in vitro. Metch. Enzymol. 105: 121-12.
BRADFORD M. 1976. A rapid and sensitive method for the quantitation of microprogram
quantitaties of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:
248-254.
CORTELAZZO A.L., MARAIC M.F., JOSELEAU J.P. 1996. Changes in peroxidases in suspension culture of Rubrus fructicosus during growth. Plant Cell, Tissue and Organ Culture
46: 27-33.
DE MARCO A., GUZZARDI P., JAMET E. 1999. Isolation of tobacco isoperoxidases accumulated in cell suspension culture medium and characterisation of activities related to
cell wall metabolism. Plant Physiol. 120: 371-381.
DE MARCO A., ROUBELAKIS-ANGELAKIS K.A. 1996. The complexity of enzymic control of
hydrogen peroxide may affect the regeneration potential of plant protoplasts. Plant
Physiol. 110: 137-145.
DE VRIES S.C. 1992. Secreted proteins as modulators of plant embryogenesis, w: Procesy
róŜnicowania w kulturach tkanek i komórek roślinnych. Szweykowska A. 1994, Prace
Ogrodu Botanicznego PAN 5/6: 9-18.
GAZARYAN I.G., LAGRIMINI L.M., ASHBY G.A., THORNELEY R. 1996. The mechanism of
indolile-3-acetic acid oxidation by plant peroxidases: anaerobic stopped-flow spectrophotometric studies on horsedish and tobacco peroxidases. Biochem. J. 313: 841-847.
HOU B., YU H., TENG S. 1997. Effects of low temperature on induction and differentiation
of wheat calluses. Plant Cell, Tissue and Organ Culture 49: 35-38.
ISHIKAWA T., TAKEDA T., SHIGEOKA S., HIRAYAMA O., MITSUNAGA T. 1993. Hydrogen peroxide generation in organelles of Euglena gracilis. Phytochemistry 33: 1297-1299.
JIMÉNEZ V.M., BANGERTH F. 2001. Endogenous hormone levels in explants and in
embryogenic and non-embryogenic cultures of carrot. Physiol. Plant. 111: 389-395.
KAIRONG C., GENGSHENG X., XINMIN L., GENGMEI X., YAFU W. 1999. Effect of hydrogen
peroxide on somatic embryogenesis of Lycium barbanum L. Plant Sci. 146: 9-16.
LI W.Z., SONG Z.H., GUO B.T., XU L.J. 2001. The effects of DNA hypomethylating drugs on
androgenesis in barley (Hordeum vulgare L.). In Vitro Cell. Dev. Biol. Plant. 37:
605-608.
LIBIK M., KONIECZNY R., PATER B., ŚLESAK I., MISZALSKI Z. 2005. Differences in the
activities of some antioxidant enzymes and in H2O2 content during rhizogenesis and
somatic embryogenesis in callus cultures of the ice plant. Plant Cell Rep. 23(12):
834-41.
LIMAM F., CHAHED K., OUELHAZI N., GHRIR R., OUELHAZI L. 1998. Phytohormones regu-
220
E. Skrzypek, M. Szechyńska-Hebda, G. Dąbrowska
lation of isoperoxidases in Catharanthus roseus suspention culture. Phytochemistry 49:
1219-1225.
LÜCK 1962. Methoden der enzymatisch en Analyse. Verlag Chemie, GmbH Weinheim:
895-897.
MCCORD J.M., FIODOVICH I. 1969. Superoxide dismutase an enzymic function for erytrocuperein (hemocuperein). J. Biol. Chem. 244: 6049-6055.
MURASHIGE T., SKOOG F. 1962. A revised medium for rapid growth and bioassays with
tobacco tissue cultures. Physiol. Plant. 15: 473-497.
PAPADAKIS A.K., ROUBELAKIS-ANGELAKIS A. 1999. The generation of active oxygen species differs in tobacco and grapevine mesophyll protoplasts. Plant Physiol. 121:
197-205.
PRAMANIK S., RAYCHAUDHURI S.S., CHAKRABORTY S. 1996. Changes in esterase and superoxide dismutase isosymes during in vitro morphogenesis in Plantago ovata Forssk.
Plant Cell, Tissue and Organ Culture 44: 123-127.
RACCHI M., TERRAGNA C. 1993. Catalase izozymes are useful markers of differentiation
in maize tissue cultures. Plant Sci. 93: 195-202.
TREJO-TAPIA G., AMAYA U.M., MORALES G.S., SANCHEZ A.J., BONFIL B.M., RODRIGUEZMONROY M., JIMENEZ-APARICIO A. 2002. The effect of cold-pretreatment and carbon
source on anther culture of rice. Plant Cell, Tissue and Organ Culture 71: 41-46.
VRANOVA E., INZE D., VAN BREUSEGEM F. 2002. Signal transduction during oxidative
stress. J. Exp. Bot. 372: 1227-1236.
XYNIAS I.N., ZAMANI I.A., GOULI-VAVDINOULI E. 2001. Effect of cold pre-treatment and
incubation temperature on bread wheat (Triticum aestivum L.) anther culture. Cer. Res.
Com. 29: 331-338.
Słowa kluczowe:
dysmutaza ponadtlenkowa (SOD), katalaza (CAT), nadtlenk
wodoru (H2O2), peroksydaza (POD), regeneracja, Vicia faba L.
minor
Streszczenie
W pracy określono zmiany aktywności enzymów antyoksydacyjnych podczas
róŜnicowania i regeneracji kalusa bobiku w kulturach in vitro. Badania prowadzono na
dwóch rodzajach kalusa: regenerującym, otrzymanym z niedojrzałych zarodków i
nieregenerującym, otrzymanym z dojrzałych zarodków. Eksplantaty oraz 3 tygodniowy
kalus bobiku, zdolne do regeneracji produkowały większe ilości nadtlenku wodoru
(H2O2) w porównaniu z eksplantatami i kalusem nieregenerującym. W ciągu kolejnych
7 dni prowadzenia kultury ilość H2O2 utrzymywała się na stałym poziomie, a następnie
gwałtownie wzrastała niezaleŜnie od zdolności regeneracyjnych kalusa. Aktywności
enzymów antyoksydacyjnych: dysmutazy ponadtlenkowej (SOD), katalazy (CAT) i
peroksydazy (POD) były wyŜsze w eksplantatach i kalusie regenerującym po 3
tygodniach indukcji, w porównaniu z eksplantatami i kalusem nieregenerującym.
Aktywności te zmieniały się równieŜ w zaleŜności od warunków hodowli,
modyfikujących róŜnicowanie kalusa. Warunki stymulacji regeneracji (temperatura
4°C) i inhibicji (temperatura 30°C) istotnie zwiększały aktywność SOD, CAT i POD w
komórkach kalusa nieregenerującego, w porównaniu z kalusem rosnącym w
temperaturze 25°C. Kalus regenerujący rosnący w 25°C charakteryzował się większą
aktywnością SOD i POD niŜ kalus nieregenerujący. Ich aktywność stopniowo malała do
7 dnia prowadzenia kultury, a w kolejnych dniach ponownie wzrastała. Aktywność
CAT w kalusie regenerującym i nieregenerującym utrzymywała się na porównywalnym
poziomie do 14 dnia prowadzenia kultury, następnie jej aktywność malała w kalusie
ZMIANY AKTYWNOŚCI ENZYMÓW ANTYOKSYDACYJNYCH ...
221
regenerującym, a znacząco wzrastała w kalusie niezdolnym do regeneracji. Z
przeprowadzonych badań wynika, Ŝe zdolność tkanek do regeneracji zaleŜy od stanu
fizjologicznego komórek i moŜe mieć bezpośredni związek z produkcją nadtlenku
wodoru i reaktywnych form tlenu. Zmiany aktywności enzymów oraz ilości
endogennego H2O2 w badanych tkankach sugerują, Ŝe H2O2 moŜe być jednym z
czynników stymulującym regenerację.
CHANGES OF ANIOXIDATIVE ENZYME ACTIVITIES
DURING REGENERATION OF FIELD
BEAN (Vicia faba L. minor) CALLUS
Edyta Skrzypek 1, Magdalena Szechyńska-Hebda 1, GraŜyna Dąbrowska 2
1
Institute of Plant Physiology, Polish Academy of Sciences, Kraków
2
Department of Genetic, Nicolas Copernicus University, Toruń
Key words:
superoxidase dismutase (SOD), catalase (CAT), hydrogen peroxide
(H2O2), peroxidase (POD), regeneration, Vicia faba L. minor
Summary
The aim of the experiment was to determine changes in antioxidative enzyme
activities during the differentiation and regeneration of field bean in the tissue culture.
The experiment was carried out with two types of callus: regenerable, obtained from
immature embryos and non-regenerable, obtained from mature embryos. Explants and
3-week-old callus of field bean, able to regenerate, produced more hydrogen peroxide
(H2O2) than explants and callus not able to regenerate. During the next 7 days of
culture, the amount of H2O2 was constant and then sharply increase independently of the
regeneration abilities of calli. Activities of antioxidative enzymes: superoxidase
dismutase (SOD), catalase (CAT) and peroxidase (POD) were higher in regenerable
explants and callus after 3 weeks of induction as compared to explants and nonregenerable callus. These activities also changed in relation to the culture condition,
which modified callus differentiation. Both conditions: stimulating (4°C) and inhibiting
(30°C) regeneration increased the activities of SOD, CAT and POD in non-regenerable
callus as compared to callus grown at 25°C. Regenerating callus grown at 25°C had a
higher activity of SOD and POD, than non-regenerating one. Their activities decreased
till day 7 of the culture, and again increased in the subsequent days of the culture. CAT
activity in callus able and not able to regenerate was on the same level till day 14 of the
culture. Than, the activity of CAT decreased in regenerable callus and significantly
increased in non-regenerable ones. The conducted experiment showed that the abilities
of tissues to regenerate depended on the physiological state of cells and might be
correlated with the production of hydrogen peroxide and reactive oxygen species.
Changes of antioxidative enzyme activities and endogenous H2O2 level in the examined
tissues suggest that hydrogen peroxide might be one of the factors stimulating
regeneration.
Dr Edyta Skrzypek
Instytut Fizjologii Roślin im. F. Górskiego
Polska Akademia Nauk
ul. Niezapominajek 21
30-239 KRAKÓW
e-mail: [email protected]
222
E. Skrzypek, M. Szechyńska-Hebda, G. Dąbrowska
ZESZYTY PROBLEMOWE POSTĘPÓW NAUK ROLNICZYCH 2007 z. 523: 223-227
PRÓBY STYMULACJI PRODUKCJI
METABOLITÓW WTÓRNYCH
W KULTURACH in vitro Ginkgo biloba L.
Agnieszka Szewczyk
Katedra i Zakład Botaniki Farmaceutycznej Collegium Medicum,
Uniwersytet Jagielloński w Krakowie
Wstęp
Miłorząb japoński (Ginkgo biloba L.) jest jedynym i reliktowym przedstawicielem klasy Ginkgopsida. Liście Ginkgo biloba L. są źródłem farmakologicznie
czynnych laktonów z grupy di- i seskwiterpenoidów oraz związków flawonoidowych (o
strukturze mono- i dimerycznej). Preparaty z liści są stosowane w lecznictwie, głównie
w zaburzeniach krąŜenia mózgowego i obwodowego [WICHTL 1997]. Badania biogenezy
terpenoidów oraz moŜliwości pozyskiwania tych związków metodami
biotechnologicznymi, z róŜnego typu kultur in vitro tego gatunku, są przedmiotem
wielu prac naukowych. W dostępnym piśmiennictwie jest natomiast niewiele doniesień
na temat występowania innych metabolitów wtórnych w kulturach in vitro Ginkgo
biloba. W tkance kalusowej oraz kulturach zawiesinowych stwierdzono obecność
katechin i oligomerycznych proantocyjanidyn. Zawartość związków farmakologicznie
czynnych jest niŜsza niŜ w roślinach gruntowych [BEEK 2000].
Celem niniejszej pracy było zbadanie moŜliwości zwiększenia produkcji flawonoidów poprzez zastosowanie metody elicytacji jasmonianem metylu kultur
zawiesinowych z okazów Ŝeńskich Ginkgo biloba. Liczne doniesienia literaturowe
wskazują, Ŝe jasmonian metylu moŜe stymulować kultury in vitro róŜnych gatunków
roślin do zwiększenia produkcji biogenetycznie róŜnych grup metabolitów wtórnych
m.in. antocyjanów, hyperycyny, saponin triterpenowych [LU 2001; WALKER 2002; PLATA
2003].
Materiał i metody
Kultury in vitro
Komórkowe kultury zawiesinowe zainicjowano z tkanki kalusowej wyprowadzonej z liści okazów Ŝeńskich Ginkgo biloba L. otrzymanych z Ogrodu Botanicznego
UJ w Krakowie. Wytrząsanie kultur zawiesinowych prowadzono w kolbach Erlenmeyera na poŜywce płynnej wg Murashige-Skooga [MURASHIGE, SKOOG 1962] z dodatkiem pikloramu (4 mg⋅dm-3) oraz BA (2 mg⋅dm-3), pH 5,6, w temp. 25°C±1°C, przy
ciągłym, sztucznym oświetleniu (ok. 2000 lx).
224
A. Szewczyk
Elicytacja
W ramach prowadzonych badań przetestowano ilość i sposób dodawania
jasmonianu metylu: ilość dodawanego do hodowli jasmonianu metylu – 250 µM,125
µM, 50µM, 25 µM, sposób dodawania elicytora – po 0, 1, 2, 3 tygodniach hodowli.
Hodowle po elicytacji likwidowano co 24 godz. w ciągu 5 dni. Biomasę oraz poŜywki
zbierano i liofilizowano.
Hydroliza
Badany materiał poddano hydrolizie roztworem wodnym kwasu solnego (25%
HCl) w celu odłączenia reszt cukrowych od aglikonów. 0,5 g zliofilizowanego surowca
zalewano 5 ml 25% wodnego roztworu HCl oraz 25 ml MeOH i wytrząsano przez 60
min. Otrzymane hydrolizaty oczyszczono wstępnie od substancji balastowych techniką
SPE (kolumna C18).
Analizy HPLC
Analizy prowadzono z wykorzystaniem aparatu Merck Hitachi (detektor UV L7400, kolumna LiChrospher 100 RP-18e). Warunki analizy dla monomerycznych
flawonoidów: λ = 370 nm, faza ruchoma metanol: 0,5% kwas fosforowy 1 : 1 v/v; substancje wzorcowe (Sigma), czasy retencji (min.): apigenina RT = 34,7; kemferol RT =
31,7; kwercetyna RT = 16,1; luteolina RT = 18; mirycetyna RT = 6,85. Warunki analizy
dla biflawonoidów: λ = 330 nm, faza ruchoma tetrahydrofuran : woda : 85% kwas
fosforowy 40 : 60 : 1 v/v/v; substancje wzorcowe (Promochem), czasy retencji (min):
amentoflawon RT = 16,54; bilobetyna RT = 22,5; ginkgetyna RT = 25,19.
Wyniki i dyskusja
Na podstawie doniesień literatury stwierdzono, Ŝe stosowane dotychczas stęŜenia
jasmonianu metylu (JM) jako elicytora zaleŜały od rodzaju gatunku rośliny i rodzaju
kultury in vitro. W kulturze zawiesinowej Ipomoea batatas PLATA i in. [2003]
zastosowali 4,5-44,5 µM JM, natomiast ZHAO i in. [2004] w kulturze zawiesinowej
Caesalpinia pulcherrima 0,3 mM tego związku. W korzeniach transformowanych
Scutellaria baicalensis najlepsze okazało się stęŜenie 100 µM jasmonianu metylu
[KUZOVKINA i in. 2001]. Po przeprowadzeniu optymalizacji procesu elicytacji w prezentowanej pracy stwierdzono, Ŝe najlepsze wyniki uzyskano w przypadku uzupełnienia
poŜywki 25 µM jasmonianu metylu po 2 tygodniach hodowli. W wyniku analizy
chromatograficznej HPLC biomasy stwierdzono zwiększenie produkcji mono- i
dimerycznych flawonoidów po elicytacji jasmonianem metylu. Tabela 1 przedstawia
wyniki analizy ilościowej flawonoidów w kulturach kontrolnych i poddanych elicytacji.
Zaobserwowano 50% wzrost produkcji kwercetyny i kemferolu po 48 godz. od dodania
elicytora. W przypadku biflawonoidów zaobserwowano zmiany ilościowe i jakościowe.
Po elicytacji znacząco zwiększyła się produkcja bilobetyny (87% po 48 godz.), wykryto
równieŜ ginkgetynę oraz śladowe ilości amentoflawonu, nieobecne w próbach
kontrolnych. W poŜywkach pobranych po 24 godz. i 48 godz. elicytacji stwierdzono
śladową zawartość obu grup flawonoidów. W dostępnej literaturze nie znaleziono
doniesień o występowaniu flawonoidów w kulturach in vitro Ginkgo biloba oraz o
próbach zwiększenia ich produkcji metodą elicytacji. Po elicytacji jasmonianem metylu
kultur korzeni transformowanych Scutellaria baicalensis, zawartość flawonoidów po 72
godz. wzrosła 2,3-krotnie [KUZOVKINA i in. 2001].
PRÓBY STYMULACJI PRODUKCJI METABOLITÓW WTÓRNYCH ...
225
Tabela 1; Table 1
Zawartość flawonoidów w kulturach in vitro Ginkgo biloba L.
Content of flavonoids in in vitro cultures of Ginkgo biloba L.
Zawartość
flawonoidów
Content of
flavonoids
(mg⋅g-1 s.m.;
DM)
Kwercetyna
Quercetin
Kemferol
Kaempferol
Ginkgetyna
Ginkgetin
Czas dodania prekursora; Elicytor-adding time
kontrola
control
24 godz.; 24 h
48 godz.; 48 h
72 godz.; 72 h
96 godz.; 96 h
0,006±0,0003
0,0078±0,00009
0,0091±0,00003
0,009±0,0002
0,0086±0,0009
0,0021±0,0002
0,0029±0,0002
0,0044±0,0001
0,0041±0,0001
0,0037±0,00005
0,0005±0,0001
0,0007±0,00006
0,000935±0,0002
0,0009±0,0001
0,0008±0,0004
Wnioski
Zastosowanie elicytora w ilości 25 µM nie powoduje zamierania hodowli
zawiesinowych w ciągu 5 dni. Wyniki analizy chromatograficznej HPLC pozwalają
stwierdzić, Ŝe elicytacja jasmonianem metylu moŜe stymulować kultury Ginkgo biloba
do zwiększenia produkcji flawonoidów.
Literatura
BEEK T.A. 2000. Ginkgo biloba. Harwood Academic Publishers, Amsterdam.
KUZOVKINA I.N., GUSEVA A.V., ALTERMAN I.E., KARNACHUK R.A. 2001. Flavonoid pro-
duction in transformed Scutellaria baicalensis roots and ways of its regulation. Russian
J. Plant Physiol. 48: 523-528.
LU M.B., WONG H.L., TENG W.L. 2001. Effects of elicitation on the production of saponin
in cell culture of Panax ginseng. Plant Cell Rep. 20: 674-677.
MURASHIGE T., SKOOG F. 1962. A revised medium for rapid growth and bioassays with
tobacco tissue cultures. Physiol. Plant 15: 473-497.
PLATA N., KONCZAK-ISLAM I., JAYRAM S., MCCLELLAND K., WOOLFORD T., FRANKS P. 2003.
Effect of methyl jasmonate and p-coumaric acid on anthocyanin composition in sweet
potato cell suspension culture. Biochem. Engineering Journ. 14: 171-177.
WALKER T.S., BAIS H.P., VIVANCO J.M. 2002. Jasmonic acid-induced hypericin production in cell suspension cultures of Hypericum perforatum L. (St. John’s wort).
Phytochemistry 60: 289-293.
WICHTL M. 1997. Teedrogen und Phytopharmaka. Wissenschaft. Verl., Stuttgart:
257-260.
ZHAO P., YUKO I., ISAO K., YASUKUNI E., HIROBUMI Y. 2004. Stimulating the production of
homoisoflavonoids in cell suspenion cultures of Caesalpinia pulcherrina using cork
tisssue. Phytochemistry 65: 2455-2461.
Słowa kluczowe:
flawonoidy, Ginkgo biloba L., zawiesinowe komórkowe kultury,
A. Szewczyk
226
jasmonian metylu
Streszczenie
Kultury zawiesinowe Ginkgo biloba L. wyprowadzono z tkanek kalusowych
regenerowanych z liści okazów Ŝeńskich. Kultury prowadzono na podłoŜu MurashigeSkooga z dodatkiem pikloramu (4 mg⋅dm-3) oraz BA (2 mg⋅dm-3). Zbadano wpływ
stęŜenia i sposobu dodawania elicytora - jasmonianu metylu na akumulację flawonoidów oraz wzrost hodowli zawiesinowych. Stwierdzono, Ŝe najlepszą metodą jest
dodatek 25 µM jasmonianu metylu w 14 dniu hodowli. Analizy ekstraktów
metanolowych prowadzono metodą HPLC. Detekcję aglikonów flawonoidów prowadzono po hydrolizie glikozydów 25% wodnym roztworem HCl. Wyniki sugerują, Ŝe
dodatek jasmonianu metylu moŜe stymulować kultury zawiesinowe Ginkgo biloba do
zwiększenia produkcji flawonoidów.
THE STUDIES OF STIMULATION OF THE SECONDARY
METABOLITE PRODUCTION IN in vitro
CULTURES OF Ginkgo biloba L.
Szewczyk Agnieszka
Chair and Department of Pharmaceutical Botany, Collegium Medicum,
Jagiellonian University, Kraków
Key words:
flavonoids,
smonate
Ginkgo biloba L., cell suspension cultures, methyl jaSummary
Cell suspension cultures of Ginkgo biloba L. were initiated from female plant
callus cultures. Cultures were maintained on the Murashige-Skoog medium
supplemented with picloram (4 mg⋅dm-3) and BA (2 mg⋅dm-3). The aim of this study
was to investigate the impact of elicitor concentration and elicytor-adding time on the
flavonoid accumulation and the cell growth of Ginkgo biloba cell suspensions. Methyl
jasmonate was used as the elicytor. The optimum concentation of methyl jasmonate (25
µM) and time to add elicitor (14 the day of inoculation) was found. The analyses of
methanol extracts were conducted by the HPLC method. Aglycons of flavonoids were
detected after the hydrolisis of glycosides in 25% aqueous HCl. The results suggest that
the addition of an elicytor to Ginkgo biloba cell suspension cultures could stimulate the
production flavonoids.
Mgr Agnieszka Szewczyk
Katedra i Zakład Botaniki Farmaceutycznej Collegium Medicum
Uniwersytet Jagielloński
ul. Medyczna 9
30-688 KRAKÓW
e-mail: [email protected]
ZESZYTY PROBLEMOWE POSTĘPÓW NAUK ROLNICZYCH 2007 z. 523: 229-236
POTENCJAŁ MORFOGENETYCZNY EKSPLANTATÓW
Arabidopsis thaliana (L.) HEYNH. W KULTURACH in vitro
Kinga Szczypińska, Robert Cegielski, Lucyna Drozdowska
Katedra Fizjologii Roślin,
Uniwersytet Technologiczno-Przyrodniczy im. J.J. Śniadeckich w Bydgoszczy
Wstęp
Tworzenie de novo pędów jest procesem złoŜonym, warunkowanym przez szereg
endo- i egzogennych czynników i nie do końca poznanym. U Arabidopsis thaliana
waŜnym czynnikiem róŜnicującym zdolności do regeneracji roślin in vitro jest genotyp.
Polimorfizm genetyczny w obrębie gatunku rzutujący na zmienny profil ekspresji
genów, jest na tyle duŜy, Ŝe część z ekotypów takich jak: Columbia, czy C-24 i
Landsberg, szeroko wykorzystywanych do badań podstawowych, cechuje niski
potencjał morfogenetyczny [ZHU i in. 2001]. DuŜą rolę w morfogenezie in vitro pełnią
równieŜ fitohormony. Stąd wyjaśnienie mechanizmu działania cytokinin przez
wykorzystanie w badaniach mutantów i roślin transgenicznych Arabidopsis z
nadekspresję izopentenylotransferazy (ipt), jak i wykazujących niski poziom cytokinin
przez zastosowanie nadekspresji oksydazy cytokininowej, oraz wyjaśnienie roli
cytokinin w transdukcji sygnałów w procesie morfogenezy, są w kręgu zainteresowań
badaczy [CARY i in. 2001; CATTEROU i in. 2002; HOWELL i in. 2003]. Regenerację roślin
Arabidopsis moŜna uzyskać na drodze organogenezy pośredniej [FELDMANN, MARKS
1986; CHAUDHURY, SINGER 1989; AKAMA i in. 1992; NABIAŁKOWSKA i in. 1997] oraz
bezpośredniej somatycznej embriogenezy [GAJ 2001; GAJ, CZUBIN 2004], przy czym
efektywność procesu nie zawsze jest zadawalająca.
W pracy podjęto próbę opracowania wydajnej metody regeneracji Arabidopsis
thaliana ekotyp Columbia w kulturach in vitro oraz pośrednio potwierdzenia róŜnic
genotypowych dotyczących zdolności do odpowiedzi morfogenetycznej eksplantatów.
Materiał i metody
Materiałem roślinnym do badań był rzodkiewnik pospolity (Arabidopsis thaliana
(L.) HEYNH.) ekotyp Columbia. Nasiona sterylizowano w 70% (v/v) etanolu (1 min), a
następnie w 2,5% (v/v) podchlorynie sodu (5 min), po czym płukano sterylną wodą
destylowaną. Sterylne nasiona kiełkowały na poŜywce MS0, którą była zmodyfikowana
poŜywka MURASHIGE i SKOOGA [1962] (tab. 1).
Z 2-tygodniowych siewek rzodkiewnika izolowano liście oraz 0,5 cm segmenty
korzeni, które wykładano na poŜywkę indukującą tworzenie kalusa CIM (ang. callus
inducing medium). Zastosowano dwa warianty poŜywki CIM: R3 oraz PG1 róŜniące się
rodzajem i stęŜeniem regulatorów wzrostu (tab. 1) [FELDMANN, MARKS 1986].
K. Szczypińska, R. Cegielski, L. Drozdowska
230
Źródłem eksplantatów były równieŜ korzenie utrzymywane w płynnej prekulturze, którą wyprowadzono z korzeni 2-tygodniowych siewek. Prekulturę prowadzono przez 4 tygodnie na poŜywce MS1 (tab. 1), na wytrząsarce przy obrotach 150
rpm. Eksplantaty pobierano po 2 i 4 tygodniach prekultury i umieszczano na poŜywce
CIM.
Tabela 1; Table 1
Skład poŜywek uŜytych w doświadczeniu
Composition of media used in the experiment
Wyszczególnienie
Specification
MS0
MS1
CIM
PG1
R3
SIM
RIM
MS
Sole; Salts
MS
MS
MS
MS
MS
Sacharoza; Sucrose (g⋅dm-3)
20
20
20
20
20
20
Witaminy; Vitamins
B5
B5
B5
B5
B5
B5
IAA (mg⋅dm-3)
-
-
-
5,0
0,15
-
2,4 D (mg⋅dm-3)
-
-
2,2
0,5
-
-
-
-
-
-
5,0
-
Kinetyna; Kinetin (mg⋅dm )
-
-
0,05
0,3
-
0,1
IBA (mg⋅dm-3)
-
-
-
-
-
12
2iP (mg⋅dm-3)
-3
-3
Agar (g⋅dm )
pH
7
-
7
7
7
7
5,7
5,7
5,7
5,7
5,7
5,7
MS
B5
sole MURASHIGE i SKOOG’A [962]; MURASHIGE and SKOOG salts mixture [1962]
witaminy B5 w/g Gamborg’a; Gamborg's B5 vitamin
inozytol; inositol (100 mg⋅dm-3)
tiamina-HCl; thiamine-HCl (10 mg⋅dm-3)
kwas nikotynowy; nicotinic acid (1 mg⋅dm-3)
pirydoksyna-HCl; pyridoxine-HCl (1 mg⋅dm-3)
CIM poŜywka do indukcji kalusa; callus inducing medium
SIM poŜywka do indukcji pędów; shoot inducing medium
RIM poŜywka do indukcji korzeni; root inducing medium
IAA kwas indolilo-3-octowy; indole-3-acetic acid (Sigma)
2,4 D kwas 2,4-dichlorofenoksyoctowy; 2,4-dichlorophenoxyacetic acid (Sigma)
2iP
6(γ, γ, dimetyloalliloamino)-puryna; 6-(γ, γ-dimethylallylamino)-purine
IBA kwas indolilo-3-masłowy; indole-3-butyric acid
Po 7 dniach kultury eksplantaty liści i korzeni wraz z tworzącą się tkanką kalusową pasaŜowano na poŜywkę indukującą regenerację pędów SIM (shoot inducing
medium) [FELDMANN, MARKS 1986].
Pędy rozwinięte na eksplantatach oddzielano od tkanki kalusowej i pasaŜowano
na poŜywkę stymulującą tworzenie korzeni RIM (root inducing medium) [FELDMANN,
MARKS 1986].
Przedstawione wyniki są średnią z dwóch powtórzeń. KaŜda kombinacja zawierała 100 eksplantatów.
Wyniki i dyskusja
Indukcja organogenezy w kalusie pochodzącym z róŜnych eksplantatów jest
powszechnie stosowaną metodą regeneracji pędów u Arabidopsis thaliana w kulturach
in vitro. Próby opracowania bądź ulepszenia istniejących metod regeneracji nie zawsze
kończyły się powodzeniem, szczególnie, gdy dotyczyły ekotypu Columbia [CHAUDHURY,
POTENCJAŁ MORFOGENETYCZNY EKSPLANTATÓW ...
231
SINGER 1989; AKAMA i in. 1992]. W niniejszym doświadczeniu wykorzystano dwuetapową
metodę regeneracji pędów rzodkiewnika z eksplantatów liści opisaną przez FELDMANNA i
MARKSA [1986], dokonując jej modyfikacji. Źródłem eksplantatów były młodsze, 14-
dniowe siewki, z których izolowano liście i korzenie umieszczając je na zestalonej
poŜywce do indukcji kalusa (PG1, R3). Dodatkowo jako eksplantaty wykorzystano
korzenie utrzymywane w ciągłej kulturze płynnej.
Na eksplantatach liści rzodkiewnika wyłoŜonych na poŜywkę CIM tworzył się
zielony kalus. W większości przypadków formował się on na ogonkach liściowych,
blaszki natomiast po krótkim okresie inkubacji na poŜywce bielały (fot. 1).
Zaproponowana metoda okazała się więc nieskuteczna dla regeneracji pędów z liści
ekotypu Columbia. FELDMANN i MARKS [1986], prowadząc badania na ekotypach
Wassilewskija oraz RLD, uzyskali kalus a następnie regenerację pędów na wszystkich
eksplantatach liści rzodkiewnika. Z kolei NABIAŁKOWSKA i in. [1997], VELAZQUEZ i in.
[2004], DAL CORSO i in. [2005] podają, Ŝe liście rzodkiewnika róŜnych genotypów, w
porównaniu z innymi eksplantatami, posiadają najniŜszy potencjał morfogenetyczny.
Fot. 1.
Photo 1.
Liście A. thaliana po 4 tygodniowej inkubacji na poŜywce do indukcji pędów
Leaves of A. thaliana after four week culture on the shoot inducing medium
Eksplantaty korzeni badanego ekotypu wykazały zróŜnicowany potencjał
morfogenetyczny. W pierwszym etapie doświadczenia (inkubacja na poŜywce CIM), na
segmentach korzeni izolowanych z 2-tygodniowych siewek oraz z korzeni po 2 lub 4
tygodniach prekultury tworzył się kalus. W drugim etapie, po przeniesieniu
eksplantatów z kalusem na poŜywkę SIM róŜnicowały się pędy (fot. 2). Najwięcej
eksplantatów zdolnych do regeneracji pędów izolowano z korzeni 2-tygodniowych
siewek oraz z korzeni po 2 tygodniach prekultury na poŜywce płynnej. WydłuŜenie
czasu prekultury do 4 tygodni znacznie obniŜało potencjał morfogenetyczny
eksplantatów. Następczy wpływ na regenerację pędów miały równieŜ rodzaje
regulatorów wzrostu i ich stęŜenia zastosowane w poŜywce do indukcji kalusa (tab. 2).
Stwierdzono efektywniejsze działanie auksyn i cytokinin zawartych w poŜywce R3 niŜ
PG1. Najwięcej, 27% eksplantatów, którymi były odcinki korzeni izolowane bezpośrednio z siewek, jak i z korzeni po 2 tygodniowej prekulturze wykazało zdolność do
tworzenia pędów po inkubacji na poŜywce R3. Tygodniowa inkubacja na poŜywce PG1
ograniczała zdolność do pędogenezy, która w zaleŜności od sposobu przygotowania
eksplantatów wahała się w granicach 23,5-5,5%. Obserwowano takŜe róŜnice w liczbie
korzeni przybyszowych formowanych na eksplantatach. Znaczniej więcej korzeni
tworzyło się na eksplantatach po inkubacji na poŜywce R3 niŜ na PG1. Wskazuje to, Ŝe
następczy wpływ rodzaju poŜywki zastosowanej w pierwszym etapie doświadczenia (do
K. Szczypińska, R. Cegielski, L. Drozdowska
232
indukcji kalusa), jest waŜnym czynnikiem decydującym o wydajności regeneracji
pędów. WyŜszy poziom cytokininy w poŜywce R3 oraz szersze spektrum jakościowe
auksyn w stosunku do poŜywki PG1 zapewniało wyŜszy poziom kompetencji
eksplantatu i co za tym idzie moŜliwość zadawalającej odpowiedzi morfogenetycznej
wyraŜającej się pędogenezą.
Fot. 2.
Photo 2.
Regeneracja pędów z eksplantatów korzeni siewek A. thaliana inkubowanych przed
pasaŜem na poŜywkę do indukcji pędów na poŜywce CIM R3
Shoot formation from A. thaliana root explants. Explants were incubated on CIM R3
and then transferred to the shoot inducing medium
Tabela 2; Table 2
Potencjał morfogenetyczny eksplantatów korzeni rzodkiewnika
Morphogenetic potential of Arabidopsis thaliana root explants
Źródło eksplantatu
Source of explant
Eksplantaty
tworzące pędy
Explants forming
shoots
(%)
Całkowita liczba
pędów
Total number
of shoots
Średnia liczba
pędów/eksplantat
Mean number of
shoots
per explant
Rośliny
kwitnące
Flowering
plants
(%)
PG1
R3
PG1
R3
PG1
R3
PG1
R3
2-tyg. siewki
2 week-old seedlings
23,5
27,0
58,0
61,5
2,5
2,3
43,6
46,5
2-tyg. kultura płynna
2 week-old liquid culture
16,5
27,0
29,5
57,0
1,8
2,1
54,9
50,9
4-tyg. kultura płynna
4 week-old liquid culture
5,5
6,0
12,5
10,0
2,3
1,7
34,0
47,8
Średnia liczba pędów przypadających na eksplantat była zbliŜona dla wszystkich
wariantów doświadczenia i zawierała się w przedziale od 1,7 do 2,5. Zregenerowane
pędy umieszczano na poŜywce ukorzeniającej. Zaobserwowano trudności w
formowaniu korzeni przez pędy. JednakŜe wytworzenie korzeni nie było warunkiem
koniecznym do zakwitnięcia. Po około 3 tygodniach kultury na pędach pojawiały się
kwiaty (fot. 3).
POTENCJAŁ MORFOGENETYCZNY EKSPLANTATÓW ...
Fot. 3.
Photo 3.
233
Kwitnące rośliny A. thaliana po 4 tygodniach inkubacji na poŜywce ukorzeniającej
Flwering A. thaliana plants after 4 week culture on the root inducing medium
Procent zregenerowanych pędów, które kwitły w warunkach in vitro wahał się w
granicach od 34% do 55%. Najwięcej kwitnących pędów pochodziło z eksplantatów
fragmentów korzeni po 2 tygodniowej prekulturze (tab. 2).
Przeprowadzone badania wykazały, Ŝe w celu regeneracji pędów w kulturach in
vitro u ekotypu Columbia mogą być wykorzystane eksplantaty korzeni siewek, jak i
korzenie z 2 tygodniowej prekultury. Te ostatnie mogą być stałym źródłem
eksplantatów, poniewaŜ prekultura na poŜywce płynnej bez dodatku regulatorów
wzrostu nie powoduje zmian ploidalności [CZAKO i in. 1993]. Jak jednak wykazali CZAKO
i in. [1993] czas, w ciągu którego korzenie inkubowane w kulturze płynnej zachowują
zdolności morfogenetyczne zaleŜy od genotypu. Korzenie ekotypu RLD utrzymywane
przez 21 miesięcy w kulturze płynnej nie traciły zdolności morfogenetycznych i były
podatne na transformację za pomocą Agrobacterium tumefaciens. Dodatkowym
zabiegiem umoŜliwiającym zachowanie ich zdolności regeneracyjnych było osuszanie
eksplantatów przed kaŜdym pasaŜem.
W niniejszej pracy wykazano równieŜ, iŜ skład poŜywki zastosowanej do
indukcji kalusa jest jednym z czynników warunkujących nabycie kompetencji przez
komórki eksplantatów korzeni do odpowiedzi na sygnał pobudzający morfogenezę,
pochodzący z poŜywki indukującej pędy.
Wyjaśnienie przyczyn nabywania morfogenetycznej kompetencji przez komórki,
na przykładzie modelowej rośliny A. thaliana, z uwzględnieniem molekularnego
podłoŜa tego procesu [CARY i in. 2001; CHE i in. 2002] moŜe przyczynić się do
efektywnego i powtarzalnego zastosowania metod regeneracji roślin in vitro
w laboratorium badawczym, jak i w produkcji roślin.
Wnioski
1.
Najlepszą zdolność do tworzenia pędów wykazały fragmenty korzeni A. thaliana,
izolowane z 2-tygodniowych siewek oraz pochodzące z 2-tygodniowej
prekultury.
2.
Następczy wpływ na zwiększenie efektywności regeneracji pędów, miała
234
K. Szczypińska, R. Cegielski, L. Drozdowska
inkubacja fragmentów korzeni na poŜywce CIM R3, która poprzedzała pasaŜ
eksplantatów na poŜywkę stymulująca organogenezę.
Literatura
AKAMA K., SHIRAISHI H., OHTA S., NAKAMURA K., KIYOTAKA O., SHIMURA Y. 1992. Efficient
transformation of the Arabidopsis thaliana: comparison of the efficiences with organs,
plant ecotypes and Agrobacterium strains. Plant Cell Rep. 12: 7-11.
CARY A., UTTAMCHANDANI S.J., SMETS R., VAN ONCKELEN H.A., HOWELL S.H. 2001. Arabidopsis mutants with increased organ regeneration in tissue culture are more competent to respond to hormonal signals. Planta 213: 700-707.
CATTEROU M., DUBOIS F., SMETS R., VANIET S., KICHEY T., ONCKELEN H.V., SANGWANNORREEL B.S., SANGWAN R.S. 2002. hoc: an Arabidopsis mutant overproducing cytokinins
and expressing high in vitro organogenic capacity. Plant J. 30: 273-287.
CHAUDHURY A.M., SINGER E.R. 1989. Relative regeneration proficiency of Arabidopsis
thaliana ecotypes. Plant Cell Rep. 8: 368-369.
CHE P., GINGERICH D.J., LALL S., HOWELL S.H. 2002. Global and hormone-induced gene
expression changes during shoot development in Arabidopsis. The Plant Cell. 14:
2771-2785.
CZAKO M., WILSON J., YU X., MARTON L. 1993. Sustained root culture for regeneration
and vegetative propagation of transgenic Arabidopsis thaliana. Plant Cell Rep. 12:
603-606.
DAL CORSO G., BORGATO L., FURINI A. 2005. In vitro plant regeneration of the heavy metal
tolerant and hyperaccumulator Arabidopsis halleri (Brassicaceae). Plant Cell Tissue
Org. Cult. 82: 267-270.
FELDMANN K.A., MARKS M.D. 1986. Rapid and efficient regeneration of plants of explants
of Arabidopsis thaliana. Plant Sci. 47: 63-69.
GAJ M.D. 2001. Regeneracja roślin Arabidopsis thaliana (L) Heynh. drogą bezpośredniej somatycznej embriogenezy. Biotechnologia 2(53): 90-98.
GAJ M.D., CZUBIN M. 2004. Efficiency of direct somatic embryogenesis in Arabidopsis
thaliana(L.) Heynh. under various in vitro culture conditions. Biotechnologia 1(64):
221-235.
HOWELL S.H., LALL S., CHE P. 2003. Cytokinins and shoot development. Trends in Plant
Science 8: 453-459.
MURASHIGE T., SKOOG F. 1962. A revised medium for rapid growth and bioassays with
tobacco tissue cultures. Physiol. Plant. 15: 473-497
NABIAŁKOWSKA D., SZAREJKO I., MAŁUSZYŃSKI M. 1997. Regeneration ability of different
explants derived from mutagenically treated Arabidopsis thaliana (L.) Heynh plants.
Zesz. Nauk. AR Kraków 318: 433-436.
VELAZQUEZ I., VALENCIA S., LOPEZ-LERA A., DE LA PENA A., CANDELA M. 2004. Analysis of
natural allelic variation in in vitro organogenesis of Arabidopsis thaliana. Euphytica
1973: 73-79.
ZHU T., BUDWORTH P., HAN B., BROWN D., CHANG H.S., ZOU G., WANG X. 2001. Toward
elucidating the global gene expression patterns of developing Arabidopsis: parallel
analysis of 8300 genes by high-density oligonucleotide probe array. Plant Physiol.
Biochem. 39: 221-242.
POTENCJAŁ MORFOGENETYCZNY EKSPLANTATÓW ...
Słowa kluczowe:
235
kultury in vitro, morfogeneza, Arabidopsis thaliana L. HEYNH,
ekotyp Columbia
Streszczenie
Ekotypy Arabidopsis thaliana L. HEYNH takie jak Columbia, C-24, czy Landsberg,
które są powszechnie wykorzystywane w biologii molekularnej, cechuje niski potencjał
morfogenetyczny w kulturach in vitro.
W pracy podjęto próbę optymalizacji warunków dla regeneracji pędów Arabidopsis thaliana ekotyp Columbia w kulturach in vitro. Eksplantaty izolowano z 2tygodniowych siewek hodowanych na zmodyfikowanej poŜywce MURASHIGE i SKOOGA
[1962] zestalonej agarem (eksplantaty korzeni i liści), bądź z prekultury korzeni
prowadzonej w poŜywce płynnej (eksplantaty korzeni) i wykładano na poŜywki
indukujące kalus. PoŜywki zawierały następujące rodzaje i stęŜenia regulatorów
wzrostu: 2,2 mg⋅dm-3 2,4-D + 0,05 mg⋅dm-3 K (poŜywka CIM PG1) oraz 5,0 mg⋅dm-3
IAA + 0,5 mg⋅dm-3 2,4-D + 0,3 mg⋅dm-3 K (poŜywka CIM R3). Po tygodniu kultury,
eksplantaty przenoszono na poŜywkę indukującą tworzenie pędów z 0,15 mg⋅dm-3 IAA
+ 5,0 mg⋅dm-3 2iP.
Na eksplantatach liści tworzył się tylko kalus. Najlepszą zdolność do tworzenia
pędów wykazały fragmenty korzeni, izolowane z 2-tygodniowych siewek oraz
pochodzące z 2-tygodniowej prekultury. Wykazano, iŜ następczy wpływ na zwiększenie
efektywności regeneracji pędów, miała inkubacja fragmentów korzeni na poŜywce CIM
R3, która poprzedzała pasaŜ eksplantatów na poŜywkę stymulująca organogenezę.
MORPHOGENETIC POTENTIAL OF Arabidopsis thaliana L. HEYNH
EXPLANTS CULTURED in vitro
Kinga Szczypińska, Robert Cegielski, Lucyna Drozdowska
Department of Plant Physiology, Faculty of Agriculture,
University of Technology and Life Sciences, Bydgoszcz
Key words:
in vitro culture, morphogenesis, Arabidopsis thaliana L. HEYNH, ecotype
Columbia
Summary
Arabidopsis thaliana ecotypes such as Columbia, C-24 or Landsberg, widely used
in molecular biology, present low regeneration efficiency.
The influence of explants and growth regulators that were added to MURASHIGE
and SKOOG [1962] medium supplemented with Gamborg’s B5 vitamins on shoots
regeneration of Arabidopsis thaliana ecotype Columbia were compared. The number of
obtained fertile plants, was also evaluated.
Sources of explants were 14 days old seedlings (leaf and root explants), sterile
grown on solid medium or precultured roots (root explants) maintained in a liquid
medium. Explants were placed on the medium inducing callus containing: 2,4-D 2.2
mg⋅dm-3; kinetin 0.05 mg⋅dm-3 (CIM PG1 medium), and IAA 5.0 mg⋅dm-3; 2,4-D 0.5
mg⋅dm-3; kinetin 0.3 mg⋅dm-3 (CIM R3 medium). After 7 days they were transferred
onto the shoot inducing medium supplemented with IAA 0.15 mg⋅dm-3; 2iP 5.0
mg⋅dm-3.
236
K. Szczypińska, R. Cegielski, L. Drozdowska
The leaf explants formed callus only. The highest organogenesis rate was
observed on root explants incubated on the CIM R3 medium before being replaced onto
the shoot inducing medium.
Prof. dr hab. Lucyna Drozdowska
Katedra Fizjologii Roślin
Uniwersytet Technologiczno-Przyrodniczy im. J.J. Śniadeckich
ul. Bernardyńska 6
85-029 BYDGOSZCZ
e-mail: [email protected]
ZESZYTY PROBLEMOWE POSTĘPÓW NAUK ROLNICZYCH 2007 z. 523: 237-245
WPŁYW REGULATORÓW WZROSTU NA REGENERACJĘ
in vitro GATUNKÓW Z RODZAJU Carlina
Alina Trejgell, Agata Kowalczyk, Andrzej Tretyn
Instytut Biologii Ogólnej i Molekularnej,
Uniwersytet Mikołaja Kopernika w Toruniu
Wstęp
Cytokininy, które są izopentenylowymi pochodnymi adeniny, odkryto ponad 50
lat temu podczas badań nad czynnikami stymulującymi podziały komórkowe [MILLER i
in. 1955]. ZaangaŜowane są one w indukcję odpowiedzi morfogenetycznej w roślinnych
kulturach tkankowych, gdzie szczególnie istotny wpływ ma stosunek ilościowy
cytokinin do auksyn w procesie organogenezy, która przebiega najczęściej na drodze
pośredniej poprzez rozwój kalusa z eksplantatu wyjściowego, a następnie inicjację
nowych organów [WAREING, PHILLIPS 1985]. Ponadto cytokininy znoszą dominację
wierzchołkową, przez co stymulują rozgałęzianie się pędów, wpływają na rozwój
chloroplastów i metabolizm składników pokarmowych, co spowalnia starzenie się liści,
a takŜe hamują tworzenie się korzeni [KOPCEWICZ, LEWAK 2002; KAKIMOTO 1996].
Celem naszych badań było określenie wpływu róŜnych cytokinin na zdolności
regeneracyjne wybranych gatunków dziewięćsiłów (Carlina acaulis L., C. caulescens
LAM. i C. onopordifolia BESSER). Gatunki z rodzaju Carlina są obięte całkowitą ochroną
gatunkową w Polsce, poniewaŜ obserwuje się zmniejszanie liczebności populacje tych
gatunków. Źródłem zagroŜenia dla dziewięćsiłów jest sukcesja roślinności na
śródleśnych polanach i wtórnych murawach oraz bezpośrednie niszczenie (zrywanie) ze
względu na walory dekoracyjne. Dlatego wydaje się zasadne zastosowanie czynnej
ochrony dla gatunków z rodzaju Carlina polegającej na opracowaniu wydajnej metody
mikronamnaŜania. Z wcześniejszych doniesień wiadomo, Ŝe Carina acaulis
regenerawano z niedojrzałych zarodków [GRUBISIĆ i in. 2004] i pędów kwiatonośnych
[GALEK, KUKUŁCZANKA 2000]. Natomiast w przypadku C. caulescens i C. onopordifolia
jest to pierwsze doniesienie dotyczące regeneracji tych gatunków.
Materiały i metody
Materiałem wyjściowym do badań były wierzchołki wzrostu oraz fragmenty
liścieni, hypokotyli i korzeni 10-dniowych siewek wybranych gatunków dziewięćsiłów
(Carlina acaulis, C. caulescens i C. onopordifolia). Zastosowano zmodyfikowaną
poŜywkę MURASHIGE i SKOOG [1962] uzupełnioną róŜnymi kombinacjami cytokinin:
benzyloaminopuryna (BA), kinetyna (Kn) i zeatyna (Zea) w stęŜeniach 1 i 3 mg⋅dm-3 z
kwasem naftalenooctowym (NAA) w stęŜeniu 0,1 mg⋅dm-3. Eksplantaty wykładano na
poŜywki zestalone agarem i prowadzono hodowlę w temperaturze 26°C i natęŜeniu
A. Trejgell, A. Kowalczyk, A. Tretyn
238
światła 40 µM⋅m-2⋅s-1. Po 4 tygodniach hodowli w przypadku C. acaulis i C. caulescens
oraz 10 tygodniach w przypadku C. onopordifolia dokonano oceny zdolności
morfogenetycznej eksplatantów. Analizowano następujące parametry: procent
eksplantatów zdolnych do wytwarzania pędów i liczbę pędów przybyszowych na
eksplant (wskaźnik namnaŜania). Ponadto dokonano analizy morfologicznej
uzyskanych pędów przybyszowych (długość liści oraz obecność kutneru).
Wyniki i dyskusja
Eksplanty badanych gatunków wykazywały zróŜnicowaną reakcję na zastosowane cytokininy (rys. 1).
Carina caulescens
% organogenezy pędów
% of shoot organogenesis
100
80
60
40
20
0
BA
Kn
Zea BA
wierzchołek
pędu; shoot tip
Kn
Zea BA
hypokotyl;
hypocotyl
Zea BA
liścień;
cotyledon
Kn
Zea
korzeń; root
Carlina acaulis
100
% organogenezy pędów
% of shoot organogenesis
Kn
80
60
40
20
0
BA
Kn
Zea BA
wierzchołek
pędu; shoot tip
Kn
Zea BA
hypokotyl;
hypocotyl
Kn
Zea BA
liścień;
cotyledon
Kn
Zea
korzeń; root
WPŁYW REGULATORÓW WZROSTU NA REGENERACJĘ in vitro ...
239
Carlina onopordifolia
% organogenezy pędów
% of shoot organogenesis
100
80
60
40
20
0
BA
Kn
Zea BA
wierzchołek
pędu; shoot tip
Kn
hypokotyl;
hypocotyl
1 mg.dm-3
Rys. 1.
Fig. 1.
Zea
BA
Kn
Zea BA
liścień;
cotyledon
Kn
Zea
korzeń; root
1 mg.dm-3
Wpływ róŜnych rodzajów cytokinin i typu eksplantatu na regenerację pędów
u Carlina caulescens, C. acaulis i C. onopordifolia
Effect of the different cytokinins and type of explants on shoot regeneration of
Carlina caulescens, C. acaulis i C. onopordifolia
C. caulescens wykazała największe moŜliwości regeneracyjne. Indukcja pędów
przybyszowych była obserwowana na wszystkich uŜytych w doświadczeniu eksplantach
na poŜywce uzupełnionej BA. NajwyŜszy odsetek eksplantów wykazujących zdolność
do organogenezy pędów uzyskano z wierzchołków wzrostu pędów i wynosił on 85 i
97% odpowiednio dla BA w stęŜeniu 1 i 3 mg⋅dm-3. Pozostałe typy eksplantów
wykazywały znacznie niŜszą zdolność morfogenetyczną i wynosiła ona 66 i 21% dla
fragmentów hypokotyli odpowiednio dla stęŜenia 1 i 3 mg⋅dm-3. Natomiast fragmenty
liścieni i korzeni były zdolne do regeneracji pędów jedynie na poŜywkach
uzupełnionych BA w stęŜeniu 3 mg⋅dm-3, a odsetek eksplantów wykazujących zdolność
do organogenezy pędów nie przekraczał 19% dla liścieni i 5% korzeni. W przypadku
zastosowania kinetyny w poŜywce zdolność do regeneracji pędów wykazało 60%
wierzchołków wzrostu pędów eksponowanych na poŜywkę uzupełnioną Kn w stęŜeniu
1 mg⋅dm-3 oraz 76% w stęŜeniu 3 mg⋅dm-3. Natomiast ekspozycja eksplantów na
poŜywki z zeatyną dała odpowiedź morfogenetyczną na wierzchołkach wzrostu pędów
(59 i 68% odpowiednio dla stęŜenia 1 i 3 mg⋅dm-3) oraz 20% w przypadku hypokotyli
wykładanych na poŜywkę uzupełnioną Zea w stęŜeniu 1 mg⋅dm-3. Średnia liczba pędów
przybyszowych uzyskanych na jednym eksplancie w przypadku wierzchołków wzrostu
pędów, hypokotyli i liścieni eksponowanych na poŜywce z BA w stęŜeniu 3 mg⋅dm-3
była porównywalna i wynosiła odpowiednio 12, 10 i 11, natomiast na fragmentach
korzeni wynosiła około 1 (rys. 2). Wskaźnik namnaŜania pędów w przypadku zastosowania w poŜywkach regeneracyjnych Kn i Zea nie przekraczał 5. Analizując
zdolności morfogenetyczne C. acaulis stwierdzono, Ŝe do organogenezy pędów zdolne
były wierzchołki wzrostu pędów na wszystkich zastosowanych poŜywkach oraz
fragmenty hypokotyli eksponowane na poŜywki z BA w obu uŜytych stęŜeniach i Kn w
stęŜeniu 3 mg⋅dm-3 (rys. 1). Podobnie, jak w przypadku wcześniej opisanego gatunku
BA okazała się najefektywniejszą cytokininą i odsetek eksplantów, na których
obserwowano indukcję pędów wynosił w przypadku wierzchołków wzrostu 90 i 100%,
a w przypadku hypokotyli 10 i 63% odpowiednio dla stęŜenia 1 i 3 mg⋅dm-3. Wskaźnik
A. Trejgell, A. Kowalczyk, A. Tretyn
240
namnaŜania nie przekraczał 6 dla wierzchołków wzrostu (rys. 2) oraz 10 w przypadku
hypokotyli. Zastosowanie kinetyny oraz zeatyny w poŜywce regeneracyjnej
powodowało nie tylko zmniejszenie liczby eksplantów zdolnych do organogenezy
pędów w porównaniu do poŜywki z BA, ale takŜe mniejszą liczbę pędów
przybyszowych uzyskanych na jednym eksplancie. C. onopordifolia okazała się
gatunkiem o najmniejszych zdolnościach regeneracyjnych i w analizowanym układzie
doświadczalnym jedynie wierzchołki wzrostu wykazywały zdolność morfogenetyczną.
RównieŜ u tego gatunku BA okazała się najefektywniejszą cytokininą i zdolność do
organogenezy pędów obserwowana była u 43 i 91% eksplantów odpowiednio dla
stęŜenia 1 i 3 mg⋅dm-3 BA, a liczba pędów uzyskanych na jednym wierzchołku wzrostu
nie przekraczała 4. Zastosowanie pozostałych cytokinin w poŜywkach regeneracyjnych
było znacznie mniej efektywne. Odsetek eksplantów zdolnych do regeneracji pędów w
tym przypadku wynosił 25% (kinetyna 3 mg⋅dm-3) oraz 57% (zeatyna 3 mg⋅dm-3), a
wskaźnik namnaŜania pędów wynosił około 2 w kaŜdym z wariantów. We
wcześniejszych badaniach nad regeneracją C. acaulis, takŜe BA okazała się
najskuteczniejszą cytokininą podczas regeneracji pędów [GALEK, KUKUŁCZANKA 2000;
GRUBISIĆ i in. 2004]. Ponadto, ten regulator wzrostu jest najbardziej efektywną cytokininą
w procesie regeneracji wielu innych gatunków roślin [VENKATACHALAM, JAYABALAN 1997;
liczba pędów / eksplant
number of shoot/eksplant
SUJATHA, REDDY 1998; CHAUDHURI i in. 2004].
Carina caulescens
20
18
16
14
12
10
8
6
4
2
0
BA
Kn
Zea BA
wierzchołek
pędu; shoot tip
Kn
Zea BA
hypokotyl;
hypocotyl
Kn
Zea BA
liścień;
cotyledon
Kn
Zea
korzeń; root
liczba pędów / eksplant
number of shoot/eksplant
WPŁYW REGULATORÓW WZROSTU NA REGENERACJĘ in vitro ...
241
Carlina acaulis
20
18
16
14
12
10
8
6
4
2
0
BA
Kn
Zea BA
wierzchołek
pędu; shoot tip
Kn
Zea BA
hypokotyl;
hypocotyl
Kn
Zea BA
liścień;
cotyledon
Kn
Zea
korzeń; root
liczba pędów / eksplant
number of shoot/eksplant
Carlina onopordifolia
20
18
16
14
12
10
8
6
4
2
0
BA
Kn
Zea BA
wierzchołek
pędu; shoot tip
Kn
Zea BA
hypokotyl;
hypocotyl
1 mg.dm-3
Rys. 2.
Kn
Zea BA
liścień;
cotyledon
Kn
Zea
korzeń; root
3 mg.dm-3
Wpływ róŜnych rodzajów cytokinin i typu eksplantatu na liczbę pędów przybyszowych u Carlina caulescens, C. acaulis i C. onopordifolia
Effect of different cytokinins and type of explants on the number of axilary shoots of
Carlina caulescens, C. acaulis i C. onopordifolia
Fig. 2.
Wśród uzyskanych pędów przybyszowych oprócz zmian ilościowych były
obserwowane takŜe róŜnice jakościowe. Dotyczyły one długości liści oraz obecności
włosków kutnerowych na powierzchni blaszki liściowej. Pędy rozwijające się na
poŜywkach z dodatkiem zeatyny charakteryzowały się znacznie dłuŜszymi, ale wiotkimi
liśćmi (fot. 1A) w porównaniu do tych, uzyskanych na poŜywkach uzupełnianych BA i
Kn (fot. 1B, 1C), co szczególnie wyraźnie było widoczne w przypadku pędów
przybyszowych C. caulescens i C. acaulis.
B
A
C
A. Trejgell, A. Kowalczyk, A. Tretyn
242
Fot. 1.
Photo 1.
Pędy przybyszowe Carlina acaulis uzyskane na poŜywkach z dodatkiem róŜnych
cytokinin: zeatyny (A), benzyloaminopuryny (B) i kinetyny (C) w stęŜeniu 3 mg.dm-3
The axillary shoots obtained on media containing the following cytokinins: zeatin
(A), benzyloaminopurin (B) i kinetin (C) in concentration 3 mg⋅dm-3
RóŜnice te mogły wynikać z szybszego tempa wzrostu nie skorelowanego z tempem
rozwoju tkanki wzmacniającej na poŜywkach z zeatyną. Ponadto, obserwowano duŜe
zróŜnicowanie wykształcenia powierzchni liści niezaleŜnie od zastosowanej cytokininy
w poŜywce regeneracyjnej. Uzyskano pędy przybyszowe o róŜnych typach liści: całych
i pierzastowrębnych oraz nie wytwarzających włosków kutnerowych na powierzchni
blaszki liściowej lub z kutnerem o róŜnym stopniu gęstości: od rzadkiego do bardzo
gęstego, wręcz filcowatego, nie występującego u osobników na stanowiskach
naturalnych u badanych gatunków (rys. 3).
19,23%
28,85%
51,92%
WPŁYW REGULATORÓW WZROSTU NA REGENERACJĘ in vitro ...
243
30,90%
51,80%
17,30%
11,76%
47,06%
41,18%
gęsty kutner
rzadki kutner
brak kutneru
Rys. 3.Procentowy udział pędów przybyszowych z kutnerem wykształconym w róŜnym stopniu u
Carlina acaulis (A), C. caulescens (B) i C. onopordifolia (C)
Fig. 3.
Percentage of axillary shoots with hair on the surface lamina developed to a different
extent of Carlina acaulis (A), C. caulescens (B) i C. onopordifolia (C)
Największe zróŜnicowanie tego parametru wykazywały pędy uzyskane na
poŜywkach z BA. Wszystkie opisane wyŜej róŜnice morfologiczne pędów przybyszowych miały charakter nietrwały i po przeniesieniu do warunków ex vitro zanikały
po 2-3 miesiącach uprawy w gruncie. Zaobserwowane zjawisko wskazuje na zmienność
somaklonalną o charakterze epigenetycznym, która moŜe wynikać ze zmian metylacji
DNA (hiper- i hypometylacje), która modyfikuje ekspresje genów [KAEPPLER i in. 2000;
CASSELLS, CURRY 2001].
Wnioski
1.
Benzyloaminopuryna jest najbardziej efektywną cytokininą w procesie organogenezy gatunków z rodzaju Carlina.
2.
Wierzchołki wzrostu pędów wykazują największą zdolność do regeneracji
pędów.
3.
Obserwowane zmiany morfologiczne pędów mają charakter epigenetyczny
i zanikają po przeniesieniu do warunków ex vitro.
244
A. Trejgell, A. Kowalczyk, A. Tretyn
Literatura
CASSELLS A.C., CURRY R.F. 2001. Oxidative stress and physiological, epigenetic and
genetic variability in plant tissue culture: implication for micropropagationa and
genetic engineers. Plant Cell Tiss. Org. Cult. 64: 145-157.
CHAUDHURI K.N., GHOSH B., JHA S. 2004. The root: a potential new source of competent
cells for high-frequency regeneration in Tylophora indica. Plant Cell Rep. 22: 731-740.
GALEK R., KUKUŁCZANKA K. 2000. Regeneracja dziewięćsiłu bezłodygowego metodą
kultur tkankowych. IX Ogóln. Konf. Kultur in vitro i biotechnologii roślin „Modyfikowanie genomu roślin”, Gdańsk-Sobieszewo 10-13 IX 2000 (Abstract): 132.
GRUBISIĆ D., SAVIKIN-FODULOVIC K., MISIC D., GIBA Z., KONJEVIC R. 2004. In vitro stem
elongation of stemless carline thistle. Plant Growth Regul. 44: 65-69.
KAEPPLER S.M., KAEPPLER H.F., RHEE Y. 2000. Epigenetic aspects of somaclonal variation in plant. Plant Mol. Biol. 43: 179-188.
KAKIMOTO T. 1996. CKI1, a histidine kinase homolog implicated in cytokinin signal
transduction. Science 274: 982-985.
KOPCEWICZ J., LEWAK S. 2002. Regulacja procesów fizjologicznych przez czynniki endogenne w: Fizjologia roślin. PWN Warszawa: 146 ss.
MILLER C.O., SKOOG F., SALTZA M.H. 1955. Kinetin, a cell division factor from deoxyribonucleic acid. J. Am. Chem. Soc. 77: 1329-1334.
MURASHIGE T., SKOOG F. 1962. A revised medium for rapid growth and bioassays with
tabacco tissue cultures. Physiol. Plant. 15: 437-497.
SUJATHA M., REDDY T.P. 1998. Differential cytokinin effects on stimulation of in vitro
shoot proliferation from meristematic explants of castor (Ricinus communis L.). Plant
Cell Rep. 17: 561-566.
VENKATACHALAM P., JAYABALAN N. 1997. Effect of auxins and citokinins on efficient plant
regeneration and multiple-shoot formation from cotyledons and cotyledonary-node
explants of groundnut (Arachis hypogaea L.) by in vitro culture technology. Appl.
Biochem. Biotech. 67: 237-246.
WAREING P.F., PHILLIPS I.D.J. 1985. Wzrost i róŜnicowanie się roślin. PWN Warszawa:
124-131.
Słowa kluczowe:
dziewięćsił, regeneracja, cytokinina, wierzchołki wzrostu pędów,
hypokotyl, liścień
Streszczenie
Określono zdolności regeneracyjne wierzchołków wzrostu oraz fragmentów
liścieni, hypokotyli i korzeni 10-dniowych siewek wybranych gatunków dziewięćsiłów
(Carlina acaulis, C. caulescens i C. onopordifolia). Zastosowano zmodyfikowaną
poŜywkę Murashige i Skoog uzupełnioną róŜnymi kombinacjami cytokinin
(benzyloaminopuryna, kinetyna i zeatyna) w stęŜeniach 1 i 3 mg⋅dm-3 z kwasem
naftalenooctowym (NAA) w stęŜeniu 0,1 mg⋅dm-3. Eksplantaty wykładano na poŜywki
WPŁYW REGULATORÓW WZROSTU NA REGENERACJĘ in vitro ...
245
zestalone agarem i prowadzono hodowlę w temperaturze 26°C i natęŜeniu światła 40
µM⋅m-2⋅s-1.
Obserwowano zróŜnicowaną reakcje eksplantów badanych gatunków. Najlepsze
wyniki regeneracji uzyskano stosując merystemy wierzchołkowe u wszystkich
badanych gatunków. Organogeneza pędów była obserwowana na pozostałych typach
eksplantów u C. acaulis i C. caulescens, ale w przypadku C. onopordifolia jedynie
wierzchołki wzrostu wykazywały zdolność morfogenetyczną. Wykazano, Ŝe najbardziej
efektywną cytokininą w indukcji organogenezy pędów była benzyloaminopuryna. Pędy
przybyszowe uzyskane na poŜywkach uzupełnionych róŜnymi cytokininami
wykazywały zróŜnicowanie morfologiczne.
EFFECT OF GROWTH REGULATORS
ON THE REGENERATION
in vitro OF SELECTED SPECIES OF Carlina
Alina Trejgell, Agata Kowalczyk, Andrzej Tretyn
Institute of General and Molecular Biology,
Nicolaus Copernicus University, Toruń
Key words:
carline thistle, regeneration, cytokinin, shoot tips, hypocotyl, cotyledon
Summary
The aim of the experiment was to estimate the regeneration abilities of shoot tips
and fragments of cotyledons, hypocotyls and roots exised from 10-days-old seedlings of
selected species of carline thistle (Carlina acaulis, C. caulescens i C. onopordifolia).
Murashige and Skoog modified medium, supplemented with different combinations of
cytokinins (BA, Kn i Zea) in concentrations 1 and 3 mg⋅dm-3 with NAA in
concentration 0.1 mg⋅dm-3 was used. The explants were placed on the solidified media
and cultured at 26°C with light intensity of 40 µM⋅m-2⋅s-1.
There were significant differences in the number of shoots regenerated from
explants of the studied species. For all species the best regeneration was obtained from
shoot tips. Shoot organogenesis from the other types of explants of C. acaulis and C.
caulescens was observed, but in the case of C. onoporgifolia only shoot tips
demonstrated morfogenetic ability. The results showed that the most efficient cytokinin
for induction of shoot organogenesis was benzyloaminopurin. The axillary shoots which
were obtained on media containing different cytokinins revealed morphological
diversity.
Dr Alina Trejgell
Instytut Biologii Ogólnej i Molekularnej
Uniwersytet Mikołaja Kopernika
ul. Gagarina 9
87-100 TORUŃ
e-mail: [email protected]
246
A. Trejgell, A. Kowalczyk, A. Tretyn
ZESZYTY PROBLEMOWE POSTĘPÓW NAUK ROLNICZYCH 2007 z. 523: 247-252
ORGANOGENEZA PRZYBYSZOWA W ELEMENTACH
KWIATU GORCZYCY BIAŁEJ (Sinapis alba L.)
Łukasz Zarychta, Maciej Zenkteler, ElŜbieta Zenkteler
Instytut Biologii Eksperymentalnej, Uniwersytet im. Adama Mickiewicza w Poznaniu
Wstęp
Gorczyca biała (Sinapis alba L.) jest waŜną rośliną uŜytkową wykorzystywaną w
przemyśle spoŜywczym i farmaceutycznym. Uzyskanie nowych odmian gorczycy, o
obniŜonej zawartości kwasu erukowego i glukozylanów, zwiększyłoby wykorzystanie
konsumpcyjne i przemysłowe jej nasion [KUROWSKI, JANKOWSKI 2003]. Dlatego włączono
kultury in vitro do prac hodowlanych, na tej podstawie wykazano, Ŝe gorczyca naleŜy
do gatunków, u których szczególnie niskim potencjałem regeneracyjnym charakteryzują
się liścienie [JAIN i in. 1989], a takŜe trudno zaindukować rozwój gynogenetyczny i
androgenetyczny [KLIMASZEWSKA, KELLER 1983]. Próby indukowania androgenezy u
odmiany Nakielska równieŜ nie powiodły się [ZARYCHTA i in. 2006a, 2006b], chociaŜ
stwierdzono przy tym wysoki potencjał regeneracyjny elementów jej kwiatu.
Celem pracy było wykorzystanie słupków i pręcików jako eksplantatów
w opracowaniu protokołu mikrorozmnaŜania Sinapis alba L.
Materiały i metody
Kwiatostany gorczycy białej odm. Nakielska otrzymano z IHAR w Poznaniu.
Zamknięte pąki kwiatowe o długości 0,5-0,8 cm odkaŜano w 70% (v/v) alkoholu
etylowym i w 2% (v/m) roztworze podchlorynu sodu przez 5 min, po czym trzykrotnie
płukano w sterylnej wodzie bidestylowanej. Z pąków kwiatowych gorczycy izolowano
słupki i pręciki, które wykładano na wcześniej dobraną poŜywkę podstawową MS
-3
-3
-3
[MURASHIGE, SKOOG 1962], zawierającą 3 mg⋅dm BAP, 1,6 mg⋅dm 2,4-D, 30 g⋅dm
-3
sacharozy i 8 g⋅dm agaru. Na poŜywkę wyłoŜono ok. 100 słupków i 120 pręcików.
Kultury prowadzono w temperaturze 22°C +/- 3°C przy świetle ciągłym, białym o
długości fali w zakresie 400-700 nm, przy natęŜeniu 20-70 µE⋅m-2⋅s-1 i wilgotności
względnej RH 70-80%. Po 45 dniach pędy przybyszowe pasaŜowano na poŜywkę
ukorzeniającą MS, bez BAP i 2,4-D, z dodatkiem 1 mg⋅dm-3 IAA. Po 60 dniach rośliny
aklimatyzowano w kulturze hydroponicznej, a po dalszych 21 dniach wysadzano do
doniczek w podłoŜe o składzie 2 części ziemi ogrodniczej, 1 część torfu i 1 część
perlitu.
Wyniki i dyskusja
Uzyskane wyniki potwierdziły wysoki potencjał regeneracyjny wybranych
248
Ł. Zarychta, M. Zenkteler, E. Zenkteler
elementów kwiatu gorczycy białej (słupki i pręciki) w kulturach in vitro. Po 7-10 dniach
od inicjacji kultury na zmodyfikowanej poŜywce MS, stwierdzono powiększanie się
słupków i pręcików spowodowane wzrostem objętości komórek parenchymatycznych
eksplantatów, przy równoczesnej proliferacji tkanki kalusowej u podstawy obydwu
typów eksplantatów (fot. 1 i 3).
Fot. 1.
Photo 1.
Kalus proliferujący z nasadowej części słupka Sinapis alba L.
Proliferation of callus from the pistil base
Foto. 2.
Photo 2.
RóŜnicujące się pąki przybyszowe z tkanki parenchymatycznej zaląŜni
Differentiation of adventitious shoots from an ovary parenchyma tissue
Zlokalizowane tam komórki merystemu interkalarnego [RAGHAVAN 1997], wykazały
znaczną wraŜliwość na stymulację regulatorami wzrostu. Po 15 dniach w tkance
kalusowej proliferującej w miejscu odcięcia nitki pręcika od dna kwiatowego
stwierdzono formowanie się elementów trachealnych i zakładanie gniazd
merystematycznych. W późniejszym okresie z gniazd merystematycznych formowały
się liczne wierzchołki wzrostu pąków (fot. 3). Rozwijające się z nich pędy przybyszowe
w 45 dniu kultury oddzielano od eksplantatów i ukorzeniano (fot. 4) na poŜywce MS z
dodatkiem 1 mg⋅dm-3 IAA [ZARYCHTA i in. 2006b]. Rośliny otrzymane poprzez
organogenezę pośrednią (fot. 5) wysadzono do doniczek po 75 dniach kultury.
ORGANOGENEZA PRZYBYSZOWA ...
Fot. 3.
Photo 3.
249
Kalus proliferujący w nasadowej części nitki pręcika
Callus proliferation from stamen base
Fot. 4. Pąki przybyszowe rozwijające się w tkance kalusowej u podstawy pręcika
Photo 4.
Adventitious shoots regenerated from callus at the base of stamen
We wcześniejszej pracy, dotyczącej indukcji androgenezy u gorczycy [ZARYCHTA i
in. 2006b] wykazano aktywność proliferacyjną łącznika. Obecnie stwierdzono, Ŝe
nasadowa część pręcika znacznie obficiej kalusuje i charakteryzuje się bardzo wysokim
potencjałem regeneracyjnym. TakŜe u wszystkich wyłoŜonych na poŜywkę słupków
występowało kalusowanie nasady i organogeneza przybyszowa w rozwijającym się tam
Ł. Zarychta, M. Zenkteler, E. Zenkteler
250
kalusie (tab. 1). NiezaleŜnie od kalusowania nasady słupka, stwierdzono równieŜ
organogenezę bezpośrednią i róŜnicowanie się pąków przybyszowych z komórek
parenchymatycznych ściany zaląŜni (fot. 2, tab. 1). Bezpośrednie formowanie pąków
przybyszowych obserwowano wyłącznie w tkance słupków, co potwierdzono na
podstawie analizy histologicznej (fot. 2).
Tabela 1; Table 1
Wpływ eksplantatu inicjalnego na przebieg organogenezy
w kulturach in vitro gorczycy
Effect of the explant type on organogenesis in tissue culture of Sinapis alba
Rodzaj eksplantatu; Type of explants
Liczba
dni
Days
nasada słupka; pistil base
8-12
25
45
60
70
nitka pręcika; filament of the stamen
organogeneza
pośrednia
indirect organogenesis
organogeneza
bezpośrednia
direct organogenesis
organogeneza
pośrednia
indirect organogenesis
organogeneza
bezpośrednia
direct
organogenesis
proliferacja kalusa
callus proliferation
róŜnicowanie pąków
przybyszowych
differentation of
adventitious shoots
ukorzenianie
rooting
aklimatyzacja
acclimatization
wysadzanie
plant potting
-
proliferacja kalusa
callus proliferation
róŜnicowanie pąków
przybyszowych
differentation of
adventitious shoots
ukorzenianie
rooting
aklimatyzacja
acclimatization
wysadzanie
plant potting
-
róŜnicowanie pąków
przybyszowych
differentation of
adventitious shoots
ukorzenianie
rooting
aklimatyzacja
acclimatization
wysadzanie
plant potting
-
-
ORGANOGENEZA PRZYBYSZOWA ...
Fot. 5.
Photo 5.
251
Roślina gorczycy białej otrzymana z kultur słupka
Plant of white mustard derived from the pistil culture
ChociaŜ aktywność regeneracyjna elementów generatywnych kwiatu u Brassicaceae jest juŜ od dawna przedmiotem badań [ZENKTELER 1984; ZENKTELER i in. 2006]
dopiero ostatnio prowadzone badania w obrębie tej rodziny potwierdzają, Ŝe elementy
kwiatu mogą być z powodzeniem wykorzystywane przy mikrorozmnaŜaniu.
Literatura
JAIN R.K., BRUNE U., FRIEDT W. 1989. Plant regeneration from in vitro cultures of co-
tyledon explants and another of Sinapis alba its implication on breeding of Crucifers.
Euphytica. 43: 153-163.
KLIMASZEWSKA K., KELLER W.A. 1983. The production of haploids from Brassica hirta
Moench (Sinapis alba L.) anther culture. Z. Pflanzenphysiol. 109: 235-241.
KUROWSKI T.P., JANKOWSKI K. 2003. Wpływ nawoŜenia na zdrowotność gorczycy białej i
sarepskiej. Rośliny oleiste XXIV(2): 465-488.
MURASHIGE T., SKOOG F. 1962. A revised medium for rapid growth and bioassays with
tobacco tissue cultures. Physiol. Plant. 15: 473-479.
RAGHAVAN V. 1997. Molecular embryology of flowering plants. Cambridge University
Press: 181-208.
ZARYCHTA Ł., ZENKTELER M., ZENKTELER E., CEGIELSKA-TARAS T. 2006a. Analiza mikroskopowa kultur pylników lnu Linium ussitattisimum L. i gorczycy białej Sinapis alba
L. Abstrakty XI Ogólnop. Konf. „Kultury in vitro i biotechnologia roślin” Międzyzdroje
7-8 IX 2006: 126.
ZARYCHTA Ł., ZENKTELER M., ZENKTELER E., SAMARDAKIEWICZ S., BIELUSZEWSKI T.
Ł. Zarychta, M. Zenkteler, E. Zenkteler
252
2006b. Określanie fazy jednojądrowej mikrospory w pylnikach gorczycy białej Sinapis
alba L. na podstawie pozycji pąka w kwiatostanie. Abstrakty VII Ogólnop. Konf.
„Kultury in vitro w fizjologii roślin” Kraków 7-8 XII 2006: 45.
ZENKTELER M. 1984. Hodowla komórek i tkanek roślinnych. PWN, W-wa: 480 ss.
ZENKTELER M., ZENKTELER E., DOSTATNIA I. 2006. Somatic embryogenesis from broccoli
stigmas in tissue culture. Acta Biol. Crac. Ser. Bot. 48/2: 109-113.
Słowa kluczowe:
gorczyca biała, regeneracja z elementów kwiatu, pędy przybyszowe
Streszczenie
W pracy dokonano oceny potencjału regeneracyjnego pręcików i słupków kwiatu
gorczycy białej (Sinapis alba L.) oraz sprawdzenie ich przydatności do mikrorozmnaŜania. Eksplantaty wykładano na poŜywkę regeneracyjną MS z dodatkiem 3
mg⋅dm-3 BAP i 1,6 mg⋅dm-3 2,4-D. Pędy przybyszowe ukorzeniano na poŜywce MS z
dodatkiem 1 mg⋅dm-3 IAA. Po 75 dniach otrzymane rośliny wysadzano do doniczek.
Stwierdzono, Ŝe wybrane elementy kwiatu gorczycy charakteryzowały się wysokim
potencjałem regeneracyjnym (organogeneza pośrednia i bezpośrednia) i mogą być
zalecane jako eksplantaty inicjalne do mikrorozmnaŜania. Rośliny otrzymane tą metodą
rozwijały się prawidłowo w dalszej uprawie.
ORGANOGENESIS FROM FLOWER ELEMENTS
OF WHITE MUSTARD (Sinapis alba L.)
Łukasz Zarychta, Maciej Zenkteler, ElŜbieta Zenkteler
Institute of Experimental Biology, Adam Mickiewicz University, Poznań
key words: white mustard, plant regeneration, flower explants, adventitious shoots
Summary
A protocol has been developed of plantlets regeneration from pistils and stamens
of white mustard (Sinapis alba L.). Both explants demonstrated a high potential of
direct and indirect organogenesis. Adventitious shoots were obtained from basal parts of
pistils and stamens cultured on MS medium containing 3 mg⋅dm-3 BAP and 1,6 mg⋅dm-3
2,4-D. The first shoots were noticed after the fourth week following inoculation. Fully
formed plantlets were developed during the 8-th week and after the next 10 th week
plantlets were transferred to pots where they soon started to flower.
Mgr Łukasz Zarychta
Instytut Biologii Eksperymentalnej
Zakład Botaniki Ogólnej
ul. Umultowska 89
61-614 POZNAŃ
e-mail: [email protected]
Download
Random flashcards
123

2 Cards oauth2_google_0a87d737-559d-4799-9194-d76e8d2e5390

Create flashcards