Napisz komplementarną sekwencję nukleotydową podanej niżej

advertisement
Napisz komplementarną sekwencję nukleotydową podanej niżej nici kodującej DNA. Na w ten sposób stworzonej nici matrycowej DNA
przeprowadź transkrypcję, a następnie translację nici mRNA. Użyj kodonów jednoliterowych i odczytaj zakodowaną wiadomość.
1. TATAATCGAACTAAAGCAAACAAGGCTAATGAGAGGTGGCAATGGGCATAA
2. AGGCCTATGTGTAGTAAGGTTAACAAAAGCCCTCGCGTGTATAGCAAGGTTAACAAGAGTATCGAGTGA
3. TGGGTCGTCATGGCAACTGTTGCGAGCGGTGCAGGCAACGAGTAG
Ułóż własne hasło i postępując odwrotnie zakoduj je w postaci DNA.
Download
Random flashcards
bvbzbx

2 Cards oauth2_google_e1804830-50f6-410f-8885-745c7a100970

Motywacja w zzl

3 Cards ypy

Pomiary elektr

2 Cards m.duchnowski

2-2=0

2 Cards jogaf85537

Create flashcards