BIOINFORMATYKA – BT_1601 PS01 Znając sekwencję DNA

advertisement
Przykładowa instrukcja
BIOINFORMATYKA – BT_1601
PS01
Znając sekwencję DNA możemy ją przetłumaczyć na sekwencję kodującą białko,
identycznie jak przebiega to w komórce. Odczytaj sekwencję DNA dzieląc ją po 3
nukleotydy (jeden triplet) za każdym razem, następnie odczytaj jaki aminokwas jest
kodowany przez dany triplet. Uwzględnij możliwość przesunięcia ramki odczytu o
kolejno +1, +2.
1. Sekwencja DNA
1. ATGGAAGTATTTAAAGCGCCACCTATTGGGATATAAG
2. Sekwencja z podziałem na triplety
2. ATG GAA GTA TTT AAA GCG CCA CCT ATT GGG ATA TAA G (…)
3. Sekwencja aminokwasowa
3. M E V F K A P P I G I STOP
Zmiana ramki odczytu +1
1. ATGGAAGTATTTAAAGCGCCACCTATTGGGATATAAG
2. A TGG AAG TAT TTA AAG CGC CAC CTA TTG GGA TAT AAG
Przykładowa instrukcja
3. W K Y L K R H L L G Y K
Zmiana ramki odczytu +2
1. ATGGAAGTATTTAAAGCGCCACCTATTGGGATATAAG
2. AT GGA AGT ATT TAA AGC GCC ACC TAT TGG GAT ATA AG
3. G S I STOP A T Y W D I
Download
Random flashcards
123

2 Cards oauth2_google_0a87d737-559d-4799-9194-d76e8d2e5390

66+6+6+

2 Cards basiek49

Prace Magisterskie

2 Cards Pisanie PRAC

słowka

2 Cards kksenia.kot1997

Create flashcards