Antywirulentny potencjał białek fagowych

advertisement
2017-01-25
Antywirulentny potencjał
białek fagowych
Grażyna Majkowska-Skrobek
Zakład Biologii Patogenów i Immunologii
Instytut Genetyki i Mikrobiologii UWr
IMMUNOGENNOŚĆ
BAKTERII
PATOGENNOŚĆ
BAKTERII
BAKTERIOFAGI
BIAŁKA FAGOWE
1
2017-01-25
Bakteriofagi
fagoterapia
Gruzja
1920-1940
1915-1917
F. Twort
(1877-1950)
antybiotykoterapia
A. Fleming
(1881-1955)
F. d’Herelle
(1873-1949)
terapia oparta
na fagach i ich
białkach
Bakteriofag
(gr. phagein-jeść)
1031
108
LIZA
2
2017-01-25
rząd Caudivirales
•
•
•
•
96% znanych fagów
gospodarze: Eubacteria i Archaea
ikozaedralna główka + ogonek, brak osłonki
(płytka podstawna, włókna, haczyki)
liniowe dsDNA
rodzina Myoviridae
8 rodzajów
[25% fagów ogonkowych,
opisanych1300]
rodzinaSiphoviridae
9 rodzajów
[61% fagów ogonkowych,
opisanych ponad 3200]
rodzinaPodoviridae
podrodzina Autographivirinae (3 rodz.)
podrodzina Picovirinae (2 rodz.)
6 rodzajów
[14% fagów ogonkowych,
opisanych 750]
DEPOLIMERAZY
1. Rozpoznanie i adsorbcja
faga do komórki
Cykl lityczny
2. Wprowadzenie DNA fagowego
do komórki i degradacja DNA
gospodarza
3. Synteza wczesnych
białek wirusowych
ENDOLIZYNY
4. Replikacja genomu
i synteza późnych białek
wirusowych
5. Składanie i dojrzewanie
6. Uwalnianie
3
2017-01-25
Bariery na powierzchni bakterii
GRAM +
GRAM --
Adsorbcja – degradacja polisacharydów
otoczkowych




liazy alginatowe
hialuronidazy
endosialidazy
depolimerazy
alginat
hialuronian
kwas polisialowy
amyloworan
polisacharydy Klebsiella
(K-antygen)
4
2017-01-25
Adsorbcja – degradacja LPSu
endoramnozydazy
Adsorbcja – degradacja peptydoglikanu
VAPGHs – virion-associated peptidoglycan hydrolases
Exoliziny = lizyny strukturalne
1. lizozym (gp5 fagaT4)
2. transglikozylazy (gp16 fagaT7; białko P7 faga PRD1)
3. N-acetyl-muramoylamidases
4. Glukozaminidazy
5. endopeptydazy (białko P5 faga phi6 ; Tal2009 fagaTuc2009)
5
2017-01-25
Klebsiella pneumoniae
Jeden z najczęstszych czynników zakażeń
• w szpitalu
• poza szpitalem
• Zakażenia dróg moczowych
• Ropnie wątroby
• Zakażenia łożyska krwi (urosepsis, odcewnikowe)
• Zapalenie płuc
• Zakażenia skory i tkanki podskórnej
• Zapalenie otrzewnej
• Zapalenie dróg żółciowych
• Zapalenie opon m-rdz
ANTYBIOTYKI
– penicyliny, wczesne cefalosporyny, fluorochinolony – leki I rzutu
– cefalosporyny III generacji – „cudowne” leki lat 1980-90
– aminoglikozydy– „rezerwa”
– karbapenemy – leki „ostatniej szansy” – szczepy wielooporne, szpitale,
ciężkie zakażenia
Klebsiella pneumoniae
Paczosa et al. 2016
6
2017-01-25
a)
b)
c)
d)
e)
f)
KP15 Myoviridae family
KP27 Myoviridae family
KP16 Siphoviridae family
KP36 Siphoviridae family
KP32 Podoviridae family
KP34 Podoviridae family
Kęsik-Szeloch et al. Virology Journal 2013
łysinka
halo
murawa
Plaque morphology of KP36 on K. pneumoniae 486
7
2017-01-25
Produkcja rekombinowanych depolimeraz
Dodanie Adeniny
(wektor zakończony Tyminą)
Oczyszczanie
produktów PCR
PCR
Polimeraza Dream Taq
Produkt PCR
LIGACJA
8
2017-01-25
SEKWENCJA DEPOLIMERAZY
atggcactatacagagaaggcaaagcggctatggccgcagacggaaccgttaccgggactggcacaaaatggcaatcttcgctttcgctgattcgcccaggcgcgacgattatgtttttgtcgtc accaattcaaatggccgtcgtaaacaaggtg
gttagcgatactgaaattaaagccatcaccacaaacggcgctgtcgtagcgtctagcgattacgcgatcctgttaagtgactcacttaccgttgacggtctggcgcaagatgttgctgaaactct gcgctactatcagtcacaggaaaccgtgatcgc
ggatgcagtcgagttcttcaagaactttgatttcgattccctgcaagatcttgctaaccaaattaatgcagactctgaatctgcacaatcaagcgctgcggctgctgctgcgtctgaaaatgcggccaaaacttcagagaataacgccaagtcttcaga
ggtggctgcggagaatgcaagagaccaagttcagcagatcattaatgacgctggagacgcatcaacactggttgtgctggcgaatcctgatggatttaggcacatagggcgttgcaaagatattgccactctgaggacaattgagccagtagaa
agccggcaggttattgaggttctaagctactacaacggcttggcacaaggaggcggaacattctggtacgatcctaacgattcagtaactgaggacaatggcgggagttgtattgtcacaaatggcggaaagcgctggaagcgaatcattgacg
gagcggtagatgttttgagctttggagccaagccagacgatataagttttgatagcgcccctcacattcaagccgcacttgacaaccatgacgcagtatcattgtacggacgcagctattatatc ggaagcccgatctatatgccgtcaaggactgtgt
tcgatggtatgggaggaaagctaacctccatagctccaagcacggctggcttcatggctgggtcaatcttcgcgcctggaaactaccacccagacttttgggaagaggttccgaaggtagcggcc accacgacgcttgggagtgccaacatcac
gctggcagatccgaatatagtgaacgttggagacatcatccggctttcgtcaaccactggtgtcctgagcgccgggttcttcgtttccgagtatctacagatggcccgcgtcttgagtaagacag gcaatgtcatcacgattgatggcccggttgaatc
gcagcttacgttggtggcagctaatgccaaccagccagggtatcttgcgcgcttcaataaaccgttgttctgctgtgtcgattcaataattcagaatatcgaaatcgatacctgggattactggactgccgactcagcaacttataacgtaaaattctcga
atatatggggttcagcaaaggcagtggcctatggcaacaccttctgccgttcacttttcgaggatatacggattgttttctccgggcgtgtatcggagttggcttttgggtcgcatgacacgaac ctagttcgcatcacggctattgccagccctaaaggct
tatctgcatcagttgtctttggttgggctgaatctggcaggcgctgcacgattgataccttttctatcatgttgaacgctaatgctaatcccagcacggtaattcgtgtatctggtcatcgggat agcttgatcaagaacggaagcatatatgtccataacaa
caccaataatatccttagcgtcgagaactatggcactaccgctgatggtgttagaccagattgcgacaacataacgttcgagaacgtgagcatcttcgtaactggatcatctgctgtagtgtgtg atgtatataaatccgccgacaactcggttattaaa
aatgttgcgtttaaaaacataaaatatttcgggcctacaccaagcgtcgcattataccgcgctcgcggaacgttggcgaatttcgtgaagggagttcaggcgaacatatcttccgatactggcgg agccattgttctcagcaattcggaaaataacgtt
ctgacatttaccggcccggtgagcgttacatcgctcgtctctgctgccgcaaaaaatacgttgtccatcagaaactatgccagatctagcgcgaaggcgaacaatttcacgcaagagtctacctt gaacgtgactgatactacggcaaacgctgtca
gcaaagaatttacatatcctgctggctctctcagaattaacgataagatcaagctgtcgttgggtggtagtacggctgggactgtcggtaaaaagaccgtacaggtgggtttcattgggtctgac ggtgcgttcaagtacgttgagttggcagctttggc
aaccgatcaagtatattggacgatggaggttgaaatatcgttcctcaggacgacgaatagccagacaaatgagcttgagacctcggctattatcacttccttcctttcgaagggtgcggctaccggcgcggcattatctggctcaagggcgctggcg
gttgtgtcggatttagcgctctcgaattttgtcgtccaagttcgcgcctggaaggaaaatgcggcagatggattgtcactgtcaagaatgaatcttcagttagaagatttgacggca taa
Produkcja rekombinowanych depolimeraz cd.
indukcja ekspresji
IPTG
zebranie komórek
bakteryjnych
przez wirowanie
E.coli
9
2017-01-25
Produkcja rekombinowanych depolimeraz cd.
1. lizat (przed nałożeniem na
kolumnę)
2.
3. oczyszczone białko
Majkowska-Skrobek et al. Viruses 2016
Charakterystyka depolimeraz
10
2017-01-25
120
Relative activity [%]
Charakterystyka
depolimeraz
100
80
60
40
20
0
3.0
4.0
5.0
6.0
7.0
8.0
9.0
62
70
80
Relative activity [%]
pH
120
100
80
60
40
20
0
20
Tm=65OC
37
45
56
temperature [°C]
Majkowska-Skrobek et al. Viruses 2016
Anty-wirulentny potencjał depolimeraz in vivo
Galleria mellonella
100
24h
po infekcji
% survival
PBS
107 CFU
80
107 CFU + depoKP36
60
107 CFU after depoKP36
treatment
*
40
n = 30
p < 0.003
*
20
0
0
24
48
72
time post infection (h)
Majkowska-Skrobek et al. Viruses 2016
11
2017-01-25
Anty-wirulentny potencjał depolimeraz in vitro
300
control
depoKP32 (10 μg/ml)
depoKP32 (50 μg/ml)
depoKP32 (100 μg/ml)
survivial rate (%)
250
200
150
100
50
0
0
1
2
3
time (h)
ENDOLIZYNY
TERAPIA FAGOWA
LIZA BAKTERII
IDENTYFIKACJA
I DETEKCJA
BAKTERII
DEPOLIMERAZY
UWRAŻLIWIENIE BAKTERII NA
CZYNNIKI ANTYBAKTERYJNE I
MECHANIZMY UKŁADU
ODPORNOŚCIOWEGO
12
2017-01-25
BIOLOGIA
MOLEKULARNA
klonowanie
ekspresja
oczyszczanie
interakcje
BIOINFORMATYKA
identyfikacja
przewidywanie struktury
dokowanie
modelowanie homologii
BIOLOGIA STRUKTURALNA
krystalizacja
określenie struktury przestrzennej
Kryształy depoKP36
Institute of Biostructures and Bioimaging,
National Research Council, Naples
13
Download
Random flashcards
ALICJA

4 Cards oauth2_google_3d22cb2e-d639-45de-a1f9-1584cfd7eea2

bvbzbx

2 Cards oauth2_google_e1804830-50f6-410f-8885-745c7a100970

Motywacja w zzl

3 Cards ypy

66+6+6+

2 Cards basiek49

Create flashcards