Mikrosatelitarne sekwencje DNA - analizy dna drzew leśnych na

advertisement
Mikrosatelitarne sekwencje DNA
Małgorzata Pałucka
Wykorzystanie sekwencji mikrosatelitarnych w jądrowym DNA drzew leśnych do
udowodnienia pochodzenia materiału dowodowego w postępowaniu sądowym
27.09.2012
Leśny Bank Genów Kostrzyca
Spis treści
I. DNA
II. Ogólne zasady genetyki molekularnej
III.Reakcja PCR
IV.Markery genetyczne
V.Mikrosatelity
2
DNA
DNA
• kwas deoksyrybonukleinowy
(dawn. kwas dezoksyrybonukleinowy), w skrócie DNA
(od ang. deoxyribonucleic acid)
• wielkocząsteczkowy organiczny związek chemiczny
należący do kwasów nukleinowych
• może być zlokalizowany w jądrze komórkowym i
w cytoplazmie, u wirusów w kapsydach
• pełni rolę nośnika informacji genetycznej
organizmów żywych
• autorami modelu podwójnej helisy DNA są James
Watson i Francis Crick, na podstawie zdjęć
krystalografii rentgenowskiej wykonanych przez
Rosalind Franklin i Maurice’a Wilkinsa (1953 r.)
3
DNA
DNA
W komórkach DNA znajduje się w:
• jądrze komórkowym (nDNA- jądrowy DNA)
DNA
• chloroplastach (cpDNA- chloroplastowy DNA)
DNA
• mitochondriach (mtDNA- mitochondrialny DNA)
DNA
4
DNA
DNA- nieskomplikowana budowa chemiczna
• przeważnie cząsteczka jest dwuniciowa, nici są skręcone spiralnie wokół siebie
• koniec (5’) jednej nici leży naprzeciwko początku (3’) drugiej nici (usytuowanie naprzeciwległe)
• podstawową jednostką budulcową jest nukleotyd:
cukier (deoksyryboza lub ryboza) + zasada azotowa + reszta kwasu fosforowego
nukleotyd
5
DNA
DNA- nieskomplikowana budowa chemiczna
Zasady azotowe dwóch przeciwległych nici łączą się ze sobą komplementarnie
(łac. complementum – dopełnienie), tj. zawsze adenina łączy się z tyminą a cytozyna z guaniną
6
Ogólne zasady genetyki molekularnej
•
Przepływ informacji genetycznej w komórce odbywa się jednokierunkowo:
DNA
RNA
BIAŁKA
•
Wszystkie komórki organizmu zawierają identyczną, pełną informację genetyczną
•
Zależnie od rodzaju komórki, fazy cyklu życiowego, jej stanu i warunków
zewnętrznych- ekspresji ulegają inne fragmenty zapisu genetycznego
•
Jednostki informacji genetycznej (m.in.):
Nukleotyd- cukier (deoksyryboza lub ryboza) + zasada azotowa + reszta kwasu fosforowego
Gen- odcinek DNA odpowiedzialny za powstanie jednej cząsteczki białka, tRNA lub rRNA
Chromosom- nić DNA połączona z białkami, która jako całość wędruje z komórki
macierzystej do komórki potomnej
Genom- całość informacji genetycznej zawartej w komórce lub w określonym organellum np. genom
chloroplastowy, genom mitochondrialny
7
Ogólne zasady genetyki molekularnej
Każda cecha fenotypowa (np. kolor włosów) jest
warunkowana przez zapis genetyczny w genach
Locus (l. mnoga loci)loci określony obszar chromosomu
zajmowany przez gen. W obrębie chromosomu znajduje
się wiele różnych loci. W locus mogą znajdować się różne
warianty danego genu (różniące się sekwencją
nukleotydów w DNA) zwane allelami
Organizm haploidalny ma zestaw pojedynczych chromosomów (N)
Organizm diploidalny ma zestaw chromosomów połączonych parami (2N)
2N
8
Reakcja PCR
PCR- Reakcja łańcuchowa polimerazy (ang. Polymerase Chain Reaction) –
metoda powielania łańcuchów DNA w warunkach laboratoryjnych (w termocyklerze).
Składniki do przeprowadzenia PCR:
1)
2)
3)
4)
5)
9
wyizolowany, o odpowiedniej czystości DNA (z tkanek roślinnych, z krwi, z włosów itp.)
środowisko reakcji (bufor, jony magnezowe oraz odpowiedniej czystości woda)
primery (in. startery- czyli kilku do kilkunastu nukleotydowe sekwencje flankujące znany lub
nieznany odcinek DNA)
dNTP (wolne nukleotydy)
termostabilna (nie ulegająca degradacji w wysokich temperaturach) polimeraza DNA
Reakcja PCR
PCR- Reakcja łańcuchowa polimerazy (ang. Polymerase Chain Reaction) –
metoda powielania łańcuchów DNA w warunkach laboratoryjnych.
Technika została wynaleziona w 1983 r. przez Karye’go Mullisa z
kalifornijskiej firmy Cetus, za co Mullis otrzymał w roku 1993 Nagrodę
Nobla
PCR znajduje wiele zastosowań, m.in.:
w badaniach nad genomem
charakterystyce ekspresji genów
w klonowaniu genów
diagnostyce klinicznej
identyfikacji osób zaginionych
kryminalistyce
paleontologii
10
Reakcja PCR
11
Markery genetyczne
Markery genetyczne to cechy jakościowe organizmów podlegające prostym
zasadom dziedziczenia zgodnie z prawami Mendla.
Można je podzielić na 3 główne klasy:
I. Markery morfologiczne (brak chlorofilu, specyficzny kształt łusek szyszkowych czy blaszki
liściowej),
II. Markery biochemiczne (izoenzymy, terpeny, antygeny),
III. Markery DNA (oparte na zmienności sekwencji nukleotydów).
Markery genetyczne służą m.in.:
badaniu zmienności genetycznej populacji
umożliwiają identyfikację osobniczą, w tym analizę rodzicielstwa
umożliwiają badanie śladów biologicznych w miejscu przestępstwa i porównanie ich z
genotypami osób podejrzanych o jego popełnienie
są szeroko wykorzystywane w badaniach populacyjnych drzew leśnych.
12
Mikrosatelity
Specyficznym rodzajem markerów DNA są sekwencje mikrosatelitarne czyli
mikrosatelity- SSR (ang. Simple Sequence Repeats)
Występują jako tandemowe powtórzenia krótkich jednostek (sekwencji)
o długości od 1 do 6 nukleotydów.
O polimorfizmie (różnorodności) mikrosatelitów stanowi zmienność liczby
powtórzeń krótkich sekwencji, która w zależności od locus może wahać
się od kilku do ponad trzydziestu.
Polimorfizm mikrosatelitów bada się poprzez analizę długości fragmentów
DNA zawierających mikrosatelity, wykorzystując mechanizm reakcji PCR,
a różne allele identyfikuje się jako fragmenty DNA o różnej długości mierzone
liczbą nukleotydów.
13
Mikrosatelity
Mikrosatelity- SSR (ang. Simple Sequence Repeats) należą do grupy powtarzających się
sekwencji DNA.
Występują jako tandemowe powtórzenia krótkich jednostek (sekwencji) o długości od 1 do 6
nukleotydów np. :
O polimorfizmie (różnorodności) mikrosatelitów stanowi zmienność liczby powtórzeń krótkich
sekwencji,
sekwencji która w zależności od locus może wahać się od kilku do ponad trzydziestu:
14
Mikrosatelity
Typowy locus mikrosatelitarny składa się zatem z obszaru DNA, w ramach którego
występują sekwencje powtarzające się, oraz z konserwatywnych fragmentów końcowych,
które są podstawą do wyznaczenia (opracowania) starterów – oligonukleotydów o
długości ok. 20 nukleotydów wykorzystywanych w reakcji PCR.
5’
CTACCCGAACACACACACACATTTCGACATTA
3’
3’
GATGGGCTTGTGTGTGTGTGTAAAGCTGTAAT
5’
fragment końcowy, flankujący
fragment końcowy, flankujący
mikrosatelita
15
Mikrosatelity
Zalety i wady mikrosatelitów
Zalety
• wykazują wysoki polimorfizm
• kodominacyjny system dziedziczenia
• genotyp można analizować na podstawie każdej tkanki, z której można wyizolować DNA
• analizy laboratoryjne są wysoce powtarzalne, a sam proces można w dużym stopniu
zautomatyzować
Wady
• stosunkowo wysokie koszty wyposażenia laboratoryjnego
• umiarkowanie wysokie koszty analiz laboratoryjnych
• podawana przez niektórych autorów podatność tych markerów na zmienność mutacyjną
oraz błędy określania genotypów wynikające m.in. z występowania alleli null
16
Dziękuję za uwagę
[email protected]
autorki
prezentacji: E. Kaczmarek, A. Pasławska
Zdjęcia w prezentacji:
www.corbis.com
Internet
A.Pasławska
M.Pałucka
Wykorzystano m.in.
Markery mikrosatelitarne DNA i ich wykorzystanie w badaniach z zakresu genetyki
drzew leśnych, J.Burczyk
17
Download
Random flashcards
Create flashcards