według przyjętej konwencji numeracji w genie.

advertisement
Zadanie I
Poniżej przedstawiono fragment sekwencji genu GAL1 S. cerevisiae.
GAL4
-393
-374
-356
GAL4
GAL4
5’
1
TGAAGTACGG ATTAGAAGCC GCCGAGCGGG CGACAGCCCT CCGACGGAAG ACTCTCCTCC GTGCGTCCTC GTCTTCACCG
sekwencja UASG
81
sekwencja UASG
80
sekwencja UASG
-291
GAL4
GTCGCGTTCC TGAAACGCAG ATGTGCCTCG CGCCGCACTG CTCCGAACAA TAAAGATTCT ACAATACTAG CTTTTATGGT
160
sekwencja UASG
161
TATGAAGAGG AAAAATTGGC AGTAACCTGG CCCCACAAAC CTTCAAATTA ACGAATCAAA TTAACAACCA TAGGATGATA
240
241
-86
ATGCGATTAG TTTTTTAGCC TTATTTCTGG GGTAATTAAT CAGCGAAGCG ATGATTTTTG ATCTATTAAC AGATATATAA
320
blok TATA (ang. TATA-box)
321
(+1)
ATGGAAAAGC TGCATAACCA CTTTAACTAA TACTTTCAAC ATTTTCAGTT TGTATTACTT CTTATTCAAA TGTCATAAAA
400
401
+62
GTATCAACAA AAAATTGTTA ATATACCTCT ATACTTTAAC GTCAAGGAGA AAAAACTATA ATGACTAAAT CTCATTCAGA
480
Met Thr Lys
481
AGAAGTGATT GTACCTGAGT TCAATTCTAG CGCAAAGGAA TTACCAAGAC CATTGGCCGA AAAGTGC
3’
574
Polecenia.
-
Podaj orientację nici DNA.
Odszukaj i zaznacz blok TATA.
Nad wszystkimi zaznaczonymi sekwencjami wpisz, jakie białka wiążą się z nimi, a pod sekwencjami podaj ich nazwę.
Podaj pozycję pierwszego nukleotydu z każdej z zaznaczonych sekwencji, według przyjętej konwencji numeracji w genie.
Zaznacz pierwsze trzy kodony sekwencji kodującej i podaj pozycję pierwszego nukleotydu tej sekwencji.
Podaj pozycję sekwencji 5'UTR , według numeracji przyjętej dla opisania genu.
Zadanie II
Celem niniejszego zadania jest prezentacja i omówienie posttranskrypcyjnych etapów ekspresji genu eukariotycznego wraz z elementami strukturalnymi,
warunkującymi ich właściwy przebieg.
ekson 1
ekson 2
ekson 3
DNA +1
5’
3’
ATTTATTATGGAGTATGGACATCAGT
AGAAACGACCATTGGATTAAGCTCAATAAAGCATAGCCAGCGACCTGCAGTGTTGTCCTAG
AGCGCTAGACCAGATTCAGT
intron 1
intron 2
promotor
Transkrypcja1
pre-mRNA2
5’ AUUUAUUAUGGAGUAUGGACAUCAGU---AGCGCUAGACCAGAUUCAGU---AGAAACGACCAUUGGAUUAAGCUCAAUAAAGCAUAGCCAGCGACCUGCAGUGUUGUCCUAG
Dodawanie czapeczki
Składanie pre-mRNA (ang: splicing)
Poliadenylacja
mRNA
5’UTR
Te procesy zachodzą
kotranskrypcyjnie
3’UTR
5’ m7GpppAUUUAUUAUGGAGUAUGGACAUCACGCUAGACCAGAUUCAAAACGACCAUUGGAUUAAGCUCAAUAAAGCAUAGCCAGCGACCUGCA(A)n
Sekwencja kodująca
Transport mRNA
Translacja
polipeptyd
3’
Jądro
Cytoplazma
N-Met Glu Tyr Gly His His Ala Arg Pro Asp Ser Lys Arg Pro Leu Asp-C
N- M E Y G H H A R P D S K R P L D -C
Obróbka potranslacyjna
Kompartmentacja
Polecenia.
3’
AKTYWNE BIAŁKO
- Narysuj schemat pre-mRNA, uwzględniając sekwencję.
- Narysuj schemat dojrzałego mRNA, zaznaczając otwartą ramkę odczytu oraz sekwencję 5’ i 3’ UTR.
- Narysuj schemat polipeptydu, zaznaczając aminokwasy kodowane przez otwartą ramkę odczytu.
- Przy strzałkach podaj w odpowiedniej kolejności nazwy procesów, prowadzących do powstania aktywnego białka oraz zapisz, w których przedziałach
komórkowych zachodzą.
- Zaznacz orientację nici pre-mRNA i mRNA oraz końców polipeptydu.
- Zaznacz nad sekwencją DNA pozycje eksonów.
- UWAGA 1 – w trakcie transkrypcji zachodzą kolejne etapy dojrzewania pre-mRNA. 2 – w związku uwagą nr 1, taka cząsteczka jest hipotetyczna.
Download
Random flashcards
123

2 Cards oauth2_google_0a87d737-559d-4799-9194-d76e8d2e5390

Create flashcards