2016-10-16
DNA - kwas deoksyrybonukleinowy
Podwójna helisa
ok. 3,2 miliardy par zasad (base pairs) A=T, G=C
Wprowadzenie do genetyki sądowej
ok. 20 000 - 30 000 genów
Ponad 99% identyczności w populacji;
1% różnic wykorzystywany w genetyce sądowej
część 2
DNA jądrowy - rejon kodujący (ok. 3 %) i niekodujący (ok. 97 %)
mtDNA - rejony kodujący (ok. 93 %) i niekodujący (ok. 7 %)
© 2016 | Pracownia Genetyki Medycznej i Sądowej | Katedra i Zakład Medycyny Sądowej
DNA – lokalizacja w komórce
Techniki i markery używane w genetyce sądowej
Komórki bez jądra
Zróżnicowanie sekwencji tandemowych
Analiza sekwencji tandemowo powtórzonych
•
•
Sekwencje mikrosatelitarne – STR
Sekwencje minisatelitarne – VNTR (znaczenie historyczne)
Sekwencjonowanie DNA mitochondrialnego
• Sekwencje minisatelitarne – VNTR
• Sekwencje mikrosatelitarne – STR
Analiza polimorfizmów typu SNP
1
2016-10-16
DNA typu minisatelitarnego: VNTR
DNA typu mikrosatelitarnego: STR
VNTR (variable number of tandem repeats) – występujące w genomie
sekwencje DNA o zmiennej liczbie tandemowych powtórzeń w locus
STR – krótkie powtórzenia tandemowe
Motyw powtórzony: od 9 do 100 bp
Motyw repetytywny: 2 – 6 bp
Bardzo duże sekwencje - długość nawet do kilkudziesięciu tysięcy bp
Ilość powtórzeń w regionie może różnić się pomiędzy osobami
Dziedziczenie i segregacja cech wg zasad Mendla
Duży polimorfizm; metoda analizy - PCR
Bardzo wysoki polimorfizm
Szeroko rozpowszechnione w ludzkim genomie gł. w regionach
niekodujących (brak informacji m. in. o rasie, predyspozycjach do chorób,
cechach fenotypowych np.: wzrost, kolor oczu / włosów)
Polimorfizm wykrywany technikami: VNTR-RFLP lub VNTR-PCR
Przykłady loci VNTR: D7S21, D12S11, D1S7
GCTCTTATGACGTATCATGACTAGT
TTCGAGTC
25 bp
AAGCTCAG TCAT TCAT TCAT TCAT TAAGCTCAG
TCGA
ACTC
36 powtórzeń
4 powtórzenia
(= 900 bp)
Markery STR
Tok pracy
Otrzymanie / pobranie materiału do badań
Izolacja / ekstrakcja DNA
Pomiar stężenia DNA
Amplifikacja DNA metodą PCR
Rozdział elektroforetyczny produktów PCR
Genotypowanie
Izolacja DNA
-
Kolumienki (Sherlock AX, Swab)
-
Kulki paramagnetyczne (PrepFiler)
-
Metoda organiczna (fenol-chloroform)
Izolacja DNA typu jądrowego metodą kolumienkową
•
•
•
•
•
•
•
Liza
Wstępne oczyszczanie
Wiązanie DNA
Płukanie (oczyszczanie)
Elucja
Wytrącanie
Suszenie i zawieszanie w wodzie
2
2016-10-16
Izolacja DNA jądrowego z materiału kostnego
Pomiar stężenia DNA
- zestaw:
• bufor
• specyficzny dla zestawu
barwnik
• fluorescencyjny
• 2 standardy stężenia DNA
- źródłem światła są diody
wykrywające fluorescencję
dsDNA w badanej próbie
Pomiar stężenia DNA
Pomiar stężenia DNA
PCR
PCR
Replikacja DNA – proces stale zachodzący w komórkach
Polymerase Chain Reaction (Kary Mullis, 1985r.)
Technika służąca powielaniu (amplifikacji) nici DNA
w warunkach laboratoryjnych
Polimeraza DNA – enzym syntetyzujący nić DNA
Konieczna jest nić matrycowa wraz z krótkim odcinkiem
dwuniciowym, powstałym po przyłączeniu się primera do matrycy
Wydłużanie primera poprzez dobudowywanie kolejnych
nukleotydów komplementarnych do nici matrycowej
3
2016-10-16
PCR
PCR
5’
3’
3’
5’
Matryca DNA
Mieszanina reakcyjna:
- Komplementarne do sekwencji DNA primery
- Polimeraza Taq
P
Primer 1
Primer 2
- Nukleotydy (A, G, C, T)
- BSA
- Mg2+
5’
3’
3’
5’
5’
3’
Denaturacja nici
– pękanie wiązań wodorowych
3’
5’
59oC
5’
3’
5’
PCR – zasada reakcji
PCR
94oC
Przyłączanie primerów do nici
5’ TCATAAGT 3’
3’ AGTATTCATTCATT 5’
72oC
Wydłużanie przez Polimerazę
nici komplementarnej do nici
matrycy
5’
3’
5’
5’
5’
1 cykl = 22 = 4 odcinki DNA
3’
5’
P
5’
3’
P
3’
5’
P
5’
3’
ok. 28-30 cykli PCR
5’
P
Multiplex PCR
Podwojenie ilości DNA w każdym cyklu
1, 2, 4, 8,16, 32, 64, 128, 256, 512, 1024, 2048, 4096, 8192, 16384, 32768, 65536, 131072, 262144, 524288 (20), 1.048.576 (21),
2097152, 4194304, 8388608, 16777216 (25), 33554432, 67108864, 134217728, 268435456, 536870912 (30), 1.073.741.824 (31)
5’
Mikrosatelitarny DNA
Jednoczesna amplifikacja wielu loci w jednej reakcji PCR
Odpowiedni zestaw primerów w mieszaninie reakcyjnej
– uniknięcie parowania się
Primery wyznakowane różnymi barwnikami fluorescencyjnymi
– odseparowanie od siebie loci o podobnym zakresie masy (bp)
Oszczędność czasu i materiału (degradacja DNA)
Potrzeba niewielkiej ilości DNA (0,2 ng)
Duża siła dyskryminacji zestawu 15 loci
104bp
110bp
4
2016-10-16
Multiplex PCR – standardowy zakres analizy
Y-STR
-
dziedziczenie w linii męskiej
-
Y-STR: męska linia rodowa – ten sam haplotyp
DZIADEK
Najczęstsza zmiana zachodząca w sekwencji DNA
Występują w genomie średnio co 100-300 bp
Utrwalone mutacje punktowe (tranzycja / transwersja)
Częstość przynajmniej 1% w populacji
Większość to bialleliczne markery (dwa warianty) >> niska siła dyskryminacji
Występowanie w kodujących i niekodujących regionach genomu
Niski polimorfizm pojedynczych SNP
Duża przydatność przy zdegradowanym materiale
Elektroforeza kapilarna – detekcja optyczna
WNUCZE
K
SNPs – Single Nucleotide Polymorphisms
2/3 wszystkich SNPs to zamiana C/T
ustalenie pochodzenia geograficznego
(brak materiału referencyjnego)
mtDNA
Genom mitochondrialny (16569 bp) został po raz pierwszy zsekwencjonowany przez
Andersona i wsp. (1981r.)
Standard – sekwencja CRS
Występowanie w mitochondriach - duża liczba kopii w komórce (200-1700)
Brak rekombinacji, dziedziczenie wyłącznie od matki (homoplazmia)
Duża zmienność mtDNA w populacji – wyższe tempo mutacji w porównaniu
z jądrowym DNA (ok. 10x)
Niekodująca część obejmuje 1200 bp - analiza poprzez odczytanie sekwencji mtDNA
w hiper-zmiennych segmentach regionu kontrolnego (pętli D)
HV1 (16024-16365), HV2 (73-340), HV3
Przydatność w badaniach pokrewieństwa, antropologicznych i ewolucyjnych, przy silnie
zdegradowanym materiale (gdy brak DNA jądrowego)
Bardzo duża czułość na kontaminację obcym DNA
Hetroplazmia komórkowa – u tej samej osoby
występuje więcej niż 1 haplotyp mtDNA
5
2016-10-16
POLIMORFIZM
Minisatelity – Mikrosatelity – SNP
MATERIAŁY BIOLOGICZNE:
zabezpieczanie oraz testy wstępne (jakościowe)
WIELKOŚĆ
© 2016 | Pracownia Genetyki Medycznej i Sądowej | Katedra i Zakład Medycyny Sądowej
Genetyka sądowa - zastosowanie
DNA jądrowy - źródła
Ustalanie pokrewieństwa
- ojcostwo / macierzyństwo
- brak rodziców – badanie krewnych
Identyfikacja osobnicza
(identyfikacja NN denatów / osób zaginionych /
ofiar katastrof masowych)
Kryminalistyka
- analiza zabezpieczonego materiału dowodowego
w postaci śladów biologicznych
- szukanie profilu sprawcy / ofiary na dowodach
Inne:
tkanki zatopione w parafinie, utrwalone w formalinie (możliwa degradacja DNA)
Analizy historyczne
Materiały biologiczne:
prawidłowe zabezpieczanie śladów
Warunki
Materiały suche: temp. pokojowa, dostęp powietrza
Ciecze, tkanki miękkie: -20oC do -80oC (kości)
Metody
Krew na EDTA (-20oC) lub FTA / bibuła / płótno (+20oC)
Wymazy (-20oC lub + 20oC po wysuszeniu)
Wysuszenie / zapakowanie w papierową kopertę,
temperatura pokojowa – niedopałki, znaczki, odzież
(pobranie fragmentów lub w całości), paznokcie wraz z materiałem
znajdującym się pod nimi
Materiały biologiczne
nieprawidłowe zabezpieczanie śladów
- praca w niesterylnych warunkach – brak rękawiczek, masek;
używanie niejałowej wody dest. – kontaminacja przy zabezpieczaniu
- zabezpieczanie krwi na heparynę (inhibicja PCR)
- niedosuszenie wymazów / zabezpieczanych śladów / przechowywanie
w szczelnie zamkniętych foliowych workach – rozwój mikroorganizmów
i późniejsze zgnicie
- zabrudzenie materiałów glebą (kwasy humusowe), rdzą, detergentami,
chemikaliami (kwasy / zasady) – degradacja / inhibicja DNA
- pozostawianie w nasłonecznionym miejscu – degradacja (UV)
6
2016-10-16
Ślina - testy jakościowe
Materiały biologiczne - testy jakościowe
α-amylaza - testy specyficzne:
a) test immunochromatograficzny
b) test odciskowy Phadebas
A. Ślina
– test niespecyficzny – test płytkowy (agar + skrobia)
– test specyficzny – test immunochromatograficzny
– test odciskowy
B. Krew
– testy niespecyficzne (luminol, H2O2)
– testy specyficzne - immunochromatograficzne
C. Sperma
– test niespecyficzny – UV / test bardziej specyficzny – Bluemaxx
– test specyficzny - immunochromatograficzny (obecność PSA)
Krew - testy jakościowe
α-amylaza:
– test niespecyficzny
Krew - testy jakościowe
– test niespecyficzny – 3% H2O2
– test niespecyficzny - LUMINOL
2 H2O2
Katalaza
2 H2O + O2
– test specyficzny - immunochromatograficzny
Luminol to substancja wykazująca chemiluminescencję związaną
z utlenianiem luminolu w środowisku alkalicznym, w obecności
określonych aktywatorów (hem) i utleniaczy (H2O2) z uwolnieniem
azotu oraz energii w formie światła.
Nasienie - testy jakościowe
a) test niespecyficzny – UV
b) test bardziej specyficzny Bluemaxx
c) test specyficzny PSA
7
Download

wprowadzenie do genetyki sądowej cz. 2